nomic DNA revealed that the gene for the a subunit is ... forms of mouse meprins revealed that they can exist as hetero- .... 2% SDS, and 100 pg/ml denatured fragmented salmon sperm DNA. ..... (left) and ENl/aC followed by ENl/ECl (right). bp, base pairs. ... widely distributed in higher organisms. .... The second sea urchin.
THEJOURNAL OF BIOLOGICAL CHEMISTRY
Vol. 268, No. 14, Issue of May 15, pp. 10380-10385,1993 Printed in U.S.A.
Tissue-specific Expression and Chromosomal Localization of the cx Subunit of Mouse Meprin A* (Received for publication, October 21, 1992, and in revised form, December 18, 1992)
Weiping JiangSI, PhilipM. SadlerS, Nancy A. Jenkinsfl, Debra J. Gilbertfl, Neal G. Copelandll, and Judith S. BondSII From the $Departmentof Biochemistry, Virginia Polytechnic Instituteand State University,Blacksburg, Virginia 24061-0308 and the llMammalianGenetics Laboratory, Advanced BioScience Laboratories, Inc.-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center,Frederick, Maryland 21 702
Meprins, membrane-bound oligomeric metalloendo- isolated from kidney of certain inbred mouse strains (such as peptidases, contain a and/or 8 subunits. Their activities C57BL/6) and from random bred mice (such as ICR mice) have been found in the mouse and rat kidney. The that exhibits high azocasein-degrading activity. Meprin B cloned cDNA for themouse a subunit of meprin A (EC refers to the enzyme isolated from kidney of other inbred 3.4.24.18) was used here to survey mRNA expression mouse strains (such as C3H/He) that has low andlatent in kidney of different mouse strains and in various azocasein-degrading activity. Meprin B activity can be actitissues of mice and rats. A single message of 3.6 kilovated in oitro by treatment with trypsin-likeproteinases bases was found in kidney of random bred (ICR) and inbred mice (C67BL/6, DBA/2) that contain high me- (Butler andBond, 1988). An enzyme that is catalytically and prin A activity andin Sprague-Dawley rat kidney. The structurallysimilar to mouse meprin A (previously called a subunit message was undetectable in the kidney of “endopeptidase-2”) has been isolated from rat kidney (Kenny C3H/He and CBA mice, inbred strains thatdo not ex- and Ingram, 1987). Mouse and rat meprins are oligomeric press meprin A activity. Therefore, meprin A activity glycosylated proteins with disulfide-linked subunits. Theyare in the kidney of mouse strains correlates with the capable of hydrolyzing proteins such as azocasein as well as are totally amount of ct subunit mRNA present. The 3.6-kilobase polypeptides such as insulinBchain.Meprins mRNA meprin a subunit message was also detected in inhibited by metal chelators such as EDTA and 1,lO-phenthe small intestine of the rat but not in mice. No mes- anthroline but notby phosphoramidon, an inhibitor of some sagewas detected in brain,heart,skeletal muscle, metalloendopeptidases such as thermolysin and neprilysin liver, lung,or spleen of mice or rats. Polymerase chain (EC 3.4.24.11, formerly referred to as neutral endopeptidase reaction amplification or Southern blot analysis of ge- 24.11, NEP, or enkephalinase). nomic DNA revealed that thegene for the a subunit is Recent biochemical characterization of membrane-bound present in all mouse strains as well as in human, mon- forms of mouse meprins revealed that theycan existas heterokey, rat, mouse, dog, cow, rabbit, and chicken, but it oligomeric or homo-oligomeric proteins (Gorbea et al., 1991). was not detected in yeast. There is one gene copy Three tetrameric forms, ad, a&, and p4, were identified in present in the mouse genome. The gene was localized mouse kidney brush border membranes. The a4and a& forms to mousechromosome 17 centromerictothe major histocompatibility complex (H-2) by the interspecific are associated with meprin A activity. The p4form is associbackcrossing method. The localization of this allele to ated with meprin B activity. All mouse strains contain thep subunit (110 kDa), but only certain strains contain the CY Mep-1, the gene previously found toregulatethe expression of meprin A activity in mice, supports the subunit (90 kDa). Rat meprin also contains two different proposal that Mep-1 is the structural gene for the a types of subunits with molecular weights of 80,000 and 74,000 (Kenny andIngram, 1987).Based on comparisons of the NH2subunit. terminal sequences of these two subunits with those of the mouse subunits, it has been concluded that the 80-kDa subunit is equivalent to the mouse a subunit (90 kDa), and the Meprins are cell surface oligomeric glycoproteins that have 74-kDa subunit is equivalent to the mouse /3 subunit (110 metalloendopeptidase activity. They were first isolated from kDa) (Jianget al., 1992). Rat meprin appears to be a tetramer, mouse kidney and are expressed at high levels in the brush as judged by gel filtration. Under nonreducing conditions, rat border membrane of kidney proximal tubule cells (Beynon et meprin can be dissociated into disulfide-linked heterodimers al., 1981). MeprinA(EC 3.4.24.18) refers tothe enzyme consisting of CY and /3 subunits (Johnson and Hersh,1992). Previous work demonstrated thatseveral inbred strains of * This work was supported by the National Institutes of Health mice are deficient in meprin Aand that theactivity deficiency Grant DK 19691 (to J. S. B.) and by the National Cancer Institute, is associated with a lack of the 90-kDa a subunit protein in Department of Health and Human Services, under Contract N01- the kidney brush border membrane (Beynon and Bond, 1983, CO-74101 with Advanced Bioscience Laboratories, Inc. (to N. A. J.). 1985). Recombinant and congeneic mouse strains were used The costs of publication of this article were defrayed in part by the payment of page charges. This articlemust therefore be hereby to map the position of the gene involved in the expression of marked “advertisement” in accordance with 18 U.S.C. Section 1734 the a subunit (Reckelhoff et al., 1985). The gene, Mep-1, was solely to indicate this fact. localized to mouse chromosome 17 near the H-2 complex Present address: Dept. of Biological Chemistry, Penn StateUni- (Bond et al., 1984). Mep-1 could be the structuralgene for the versity College of Medicine, Hershey, PA 17033. a subunit or could it regulate the expression of the CY structural )I To whom correspondence and reprint requests should be ad- gene located elsewhere in the genome. Until the present work, dressed. Present address: Dept. of Biological Chemistry, Penn State there was no additional information to support either of these University College of Medicine, Hershey, PA 17033. Tel.: 717-531two possibilities. 8586; Fax: 717-531-7072.
10380
Expression of the a Subunit of Meprin A
10381
isolated from mouse and rattissues using a modified acid guanidinium thiocyantate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987). All the solutions were prepared in baked glass containers with DEPC-treated water (Sambrook et al., 1989). Briefly, tissues (2 g) wereexcised from animals and immediately homogenized in 10 ml of GITC solution (4M GITC, 25 mM sodium citrate, pH 7.0, 0.5% Sarcosyl, and 10 mM mercaptoethanol). Sodium acetate (2 ml of 1 M solution, pH 4.0), water-saturated phenol (10 ml), and chloroform (2 ml) were added to the homogenized solutions separately, vortexed, and cooled on ice for 15 min. The mixtures were centrifuged for 20 min in baked corex tubes at 12,000 rpm (4 "C). RNA in the aqueous phase was precipitated with equal volume of isopropyl alcohol at -20 "C. RNA was precipitated by centrifugation, dissolved in GITC solution, and then precipitated with isopropanol. RNA precipitates were washed with 75% ethanol, dried in a Speedvac, and dissolved in a minimal volume (1-2 ml) of DEPC-treated water. Concentrations of RNA samples were calculated based on absorbance at 260 nm. RNA samples were stored at -20 "C after 2 volumes (2-4 ml) of ethanol were added. Isolation of Chromosomal DNA from Mouse-Genomic DNA was isolated from mouse kidneys using a modified standard procedure (Sambrook et al., 1989). Frozen kidney tissues (2 g) were homogenized in 20 ml of extraction buffer (10 mM Tris/HCl, pH 8.0,O.l M EDTA, 0.5% SDS, and 20 pg/ml RNase A). The homogenized solution was incubated at 37 "C for 1 h. Proteinase K (20 mg/ml) was added to the solution to a final concentration of 0.1 mg/ml. The mixture was incubated at 50 "C for 3 h. The mixture was then extracted with halfvolume of phenol equilibrated with Tris/HCl, pH 8.0. Ammonium acetate (7.5 M ) was added to the aqueous phase to a final concentration of 2.5 M. Two volumes of ethanol were layered on the top of the EXPERIMENTALPROCEDURES solution, and DNA was spooled by slowly mixing two phases with a Materials-Enzymes, including restriction endonucleases and Pasteur pipette. DNA was air-dried, eluted from the Pasteur pipette DNA polymerase (Klenow fragment), and Prime-a-Gene Labeling into water, and dissolved by shaking the tube overnight at room System were purchased from Promega. The GENECLEAN I1 kit was temperature. DNA was stored at 4 "C until use. Northern Blots-RNA blotting experimentswere performed essenfrom BIO 101. The radioisotope-labeled compound ([a-32P]dCTP) was obtained from Du Pont-New England Nuclear. Pure nitrocellu- tially as described previously (Jiang et al., 1992). There were a few lose membranes and nylon membranes (Micron Separation Inc.) were exceptions, however. For example, nylon membranes in addition to from Bio-Rad and Fisher, respectively. X-ray films (type XAR 5) nitrocellulose membranes were used for transfer, RNA samples were were obtained from Kodak. Solvents, including phenol, chloroform, immobilized on membranes byUV cross-linking instead of baking, and isopropyl alcohol, and chemicals such as guanidine thiocyanate and hybridizations of nylon membranes were performed in 30% (GITC) were purchased from Fisher. All other chemicals, including formamide, 5 X SSPE (100 ml: 4.4 g of NaCl, 0.7 g of NaH2P04.H20, 0.2 g of EDTA, pH 7.4), 10 X Denhardt's reagent (100 ml: 0.2 g of diethyl pyrocarbonate (DEPC), were from Sigma. Ficoll, 0.2 g of polyvinylpyrrolidone, 0.2 g of bovine serum albumin), Sources of Animaki-Adult male mice (strains of C57BL/6, C3H/ He, ICR) were obtained from Dr. Francis Gwazdauskas of the De- 2% SDS, and 100 pg/ml denatured fragmented salmon sperm DNA. Amplification of GenomicDNA-GenomicDNAwas amplified partment of Dairy Science at Virginia Polytechnic Institute and State University. Other adult male mice (strains of CBA and DBA/2) were using the GeneAmp polymerase chain reaction (PCR) kit with purchased directly from Jackson Laboratories. Rats (Sprague-Daw- AmpliTaq DNA polymerase (Perkin-ElmerCetus). The optimal MgClz concentration used was 4 mM. The initial denaturation of the ley) were obtained from Harlan Industries, Indianapolis, IN. Isohtion andLabeling of the cDNA Fragments Used in Hybridiza- genomic DNA (1pg in 100 p l ) occurred at 94 "C, 5 min. Amplification tion Experiments-Plasmid DNA was isolated from Escherichia coli on the GeneAmp PCR System 9600 (Perkin-Elmer Cetus) was perusing the alkaline lysis method (Birnboim and Doly, 1979). DNA formed in the first five cycles: 94 "C, 30 s; 40 "C, 30 s; 72 "C, 1 min. preparations were digested with an appropriate restriction endonuThe next 25 cycles were 94 "C, 30 s; 55 "C, 30 s; 72 "C, 1 min with a clease such as EcoRI and were then subjected to agarose gel electro- 5-s increment every cycle. Two synthetic oligonucleotides, based on phoresis in the presence of ethidium bromide (0.5 pg/ml). The DNA the a subunit cDNA sequence, were used as primers (100 pmol each) fragments containing coding regions of the a subunit were excised in the first round of the PCR. A portion of the products from the from gels and purified using the GENECLEAN kit according to the first round of the PCR was diluted 10-fold and was amplified with a manufacturer's procedure. Yields and concentrations of DNA frag- different pair of primers using the same thermal cycle parameters. ments were estimated by running a sample on agarose gel electropho- The products from the second round of the PCR were analyzed by resis and comparing signal intensities of these fragmentswith known agarose gel electrophoresis. DNA markers. The isolated DNA fragments (25 ng) were labeled Southern Blots-Genomic DNA was digested with EcoRI or PstI, with 32P(50 pCi) using the Prime-a-Gene System. Efficiencies of concentrated by precipitation with ethanol, and subjected to agarose radioisotope incorporations were determined after thin layer chro- gel electrophoresis. Gels were photographed to measure positions of matography (TLC) (polyethyleneimine cellulose, Sigma). The TLC DNA makers (HindIII-cleaved X DNA). Capillary transfer of DNA plates were developed in 1N HC1. The plates were cut intotwo halves; samples from gel to nitrocellulose membrane was performed with 10 the tophalf contained free nucleotides, and thebottom half contained x SSC (1liter: 88 g of NaCl, 44 g of sodium citrate, pH 7.0) overnight. labeled fragments. Radioactivities were measured in a scintillation Membranes were baked for 1h a t 80 "C in a vacuum oven. Conditions counter, and incorporation efficiencies were calculated. More than of hybridization were the same as those for Northern blot experi50% of the radioisotopes were incorporated into labeled fragments. ments. A zoo blot containing EcoRI-cleaved genomicDNAfrom Usually, 5 X lo' cpm were incorporated into labeled fragments. The several species (Clontech) was also used for hybridization. labeled fragments were used directly, without further purification, in Interspecific Backcross Mapping-Interspecific backcross progeny hybridization experiments. were generated by mating (C57BL/6 X Mus spretus)Fl females and Isolation of Total RNA from Mammalian Tissues-Total RNA was C57BL/6 males as described (Copeland and Jenkins, 1991). A total of 205 N? progeny were obtained a random subset of these N, mice 'The abbreviations used are: kb, kilobase(s); GITC, guanidine were used to map the Mep-la locus (see text for details). DNA thiocyanate; DEPC, diethyl pyrocarbonate; PCR, polymerase chain isolation, restriction enzyme digestion, agarose gel electrophoresis, reaction; RFLPs,restrictionfragment length polymorphisms; nt, Southern blot transfer, andhybridization were performed essentially nucleotides; BMP-1, bone morphogenetic protein-1; ACE, angioten- as described (Jenkinset al., 1982). All blots were prepared with sin I-converting enzyme; Ig, immunoglobulin(s); MHC, major histo- Zetabind nylon membrane (AMF-Cuno). The meprin a subunit probe, compatibility complex. a 1.1-kb mouse cDNA, was labeled with [ O ~ - ~ ' P ] ~ Cusing T P a nick
Molecular cloning and sequencing of the a subunit of mouse meprin A has provided important information on the primary structure of the a subunit and probes to study the expression of the subunit (Jiang et al., 1992). Initial studies using the cloned cDNA for the a subunit revealed that a single mRNA species of 3.6 kilobases (kb)' was abundant in the kidney of C57BL/6 mice and absent in the kidney of C3H/He mice. This observation indicated that high and low meprin activity in the kidney of inbred mouse strains correlated with the amount of a subunit mRNA present. The present work extends that observation to other mouse strains and explores the expression of the a subunit mRNA in mouse and rat tissues. The data herein support the hypothesis that thedeficiency of meprin A activity, and the meprin a subunit protein in certain mouse strains, is due to a lack of the mRNA for the subunit. The expression of the a subunit mRNA was found to be kidney-specific in mice that have meprin A activity and kidney- and intestine-specific in the rat. Furthermore, the 01 subunit gene is shown to be present in several higher organisms and once in the mouse genome. In addition, the structural gene ( M e p - l a )for the a subunit of mouse meprin A was localized to the Mep-I locus of mouse chromosome 17 by the interspecific backcrossing method.
Expression of the cy Subunit of Meprin A
10382
translation labeling kit (Boehringer Mannheim); washing was done to a final stringency of 0.2 X SSC, 0.1% SDS, 65 "C. Fragments of 12.0, 6.0, and 4.0 kb were detected in Sad-digested C57BL/6 DNA, and fragments of 8.0, 6.8, and 3.6 kb were detected in Sad-cleaved M. spretus DNA. The three M. spretus-specific Sac1 fragments cosegregated, and their presence or absence was followed in backcross mice. A description of the probes and restriction fragment length polymorphisms (RFLPs) for the loci linked to Mep-la, including the H2 region and preferred integration site, Moloney virus-1 (Pim-I 1, has been reported (Siracusa et al., 1991). Recombination distances were calculated as described (Green, 1981) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns. RESULTS
T
3 4 5 6 7 8 9
I I
When the cloned cDNA for the mouse a subunit was used to probe total RNAisolated from the kidney of several strains of mice, the Q subunit mRNA of3.6 kb was found to be abundant in three strains of mice (ICR,C57BL/6,and DBA/2) that have high meprin A activity (Fig. 1, left). The message was undetectable in thekidney of two mouse strains C3H/He and CBA that have meprin B but no meprin A activity. As a control, the same RNA blot was probed with the human @-actin cDNA (Fig. 1, right). All the mouse strains tested contained similar amounts of the actin message, indi0 1 2 3 4 5 6 7 8 9 cating that the amount and quality of the RNA samples from FIG. 2. Northern Blots oftotal RNA from various tissues of thedifferentstrains of mice were similar. Therefore,the C57BL/6 mice. The method used was the same as that in Fig. 1. difference in the intensity of the signal for the a subunit Total RNA (20 pg in each lane except for spleen where 100 pg was message reflectsits concentration in the kidney. These results loaded) was probed with mouse a subunit cDNA (top) and with indicate that thelack of meprin A activity in the kidneys of human &actin cDNA (bottom).Sources of RNA were: K, kidney; T, inbred mouse strains correlates with the absence of Q subunit testis; B, brain; H, heart; V , skeletal muscle; V , liver; L, lung; S, spleen; I, small intestine; and E , E. coli. The ribosomal RNA markers mRNA. (16 and 23 S from E. coli and 18 and 28 S from mouse tissues) were The RNA from several additional tissues from C57BL/6 mice were also probed with the a subunit cDNA (Fig. 2, top). determined on ethidium bromide-stained gels. The 3.6-kb Q subunit mRNAwas abundant in thekidney but was undetectable in the other tissues tested including brain, Differences intheintensity of the signalfor the @-actin heart, liver, lung, skeletal muscle, small intestine, spleen, and message reflect differential expression of actin genes. Most testis. There was no a subunit signal detected in the E. coli tissues express asingle @-actin mRNA of2.0 kb,whereas RNA sample. The lack of detection of a subunit mRNA in heart and skeletalmuscle produced a major message of lower mouse tissues other than kidney was not due to the quantity molecule weight (a-actin) (Gunning et al., 1987). L'wer expressed the least amountof @-actinmessage. or quality of RNA samples obtained, as determined from Total RNA was also isolated from various tissues of C3H/ probing the same blot with a human @-actin probe (Fig. 2, bottom). The same amount of RNA (20 pg) was present on He mice and probed with the meprin a subunit cDNA. This the blot for each tissue except spleen,where more RNA was was done in orderto see whether thea subunit was expressed added togels because of a n observed partial RNA degradation. in tissues other than kidney in these mice that express only meprin B activity in kidney. The a subunit mRNA was not detected in any of the tissues examined, including kidney, brain, heart, liver, lung, small intestine, spleen, and testis (data not shown). From the tissues examined, these results indicate that the expression of the a subunit mRNA is kidneyspecific in mice that have meprinA activity and that there is no expression of the Q subunit mRNA inmice that have only meprin B activity. T o determine whether thegene for the a subunit is present in the genomes of mice that do not express its message, a PCR approachwas employed to amplify portions of the gene. For the first round of the PCR, the following primer pairs were synthesized. The first pair, PN1 (sense and 245-264: nt L I L 1 12 23 34 45 5 CTCGTCAGAATTCGAAATGCCATGCGAGATCCC) and (antisense and nt 820-840: ATACGGATCCTAFIG. 1. Expression ofthe a subunit of meprin A in the PC1 kidney of various mouse strains. Total RNA was isolated using ATGTGTTGCGGTGCAGTTGTA), encode the N and C teran establishedprocedure (Chomczynski and Sacchi, 1987). RNA mini of the protease domain of the a subunit (nucleotides samples (20 pg) were subjected to formaldehyde-gel electrophoresis underlined match exactly with the cDNA or its complemenin the presence of ethidium bromide, transferred tonylon membranes, tary sequence and ntnumbers correspond to the positionsin and hybridized to the 32P-labeled a subunit cDNA (left) and the the cDNA sequence as reported by Jiang et al., 1992). The human @-actincDNA (right). An autoradiogram of 24-h exposure is shown here. Mouse strains were IC, ICR 3 H , C3H/He; 57, C57BL/6; second pair, EN1 (sense and nt 2062-2085: GGACGAATTCB, CBA; and DB, DBA/2. The 18 and 28 S RNA makers were CATATGTACTTCAGAGACCCCTGTGACCCA) andaC1 (antisenseandnt 2279-2299: GAGAGGATCCTCACTGCdetermined from ethidium bromide-stained gels.
Expression of the cy Subunit of Meprin A CGCAGCTTTCCGT, encode the N terminus of the epidermal growth factor-like domain and the C terminus of the a subunit. Genomic DNA was isolated from mouse kidneys and amplified using thesetwo primer pairs. A portion of the first round of PCR products was amplified using a different pair of primers. For the PNl/PCl amplified products, PN1 and oligo(A) (antisense and nt373-401: CTCTCTCCTTCATAGGGCTTGAAATCCAC) were used. For the ENl/aCl amplified products, EN1 and EC1 (antisense and nt 2189-2211:
10383
28s18s-
ATTCTAGAGGATCCTCACAAGCTGCCGTGCACGTG-
-I
CATGG) were used. The products from the second round of 1 2 3 4 5 6 7 8 the PCR were analyzed by agarose gel electrophoresis in the presence of ethidium bromide (Fig. 3). It is clear that the same products were amplified from all mice, including two strains (C3H/He and CBA, lanes 3 and 5 ) that have no a K B H I V L S U subunit mRNA and two strains (C57BL/6 and ICR,lunes 2 and 4 ) that express abundant a subunit mRNA. The amplified regions are located near the N and C terminus of the a 28ssubunit. Therefore, the gene for the a subunit is present in q>. -. all mouse strains tested,including the mice that do not express the a subunit mRNA. In addition, the corresponding genomic 18sDNA fragments from the second round PCR amplification do not contain introns, because their amplified products have the same length as those from a recombinant plasmid con1 2 3 4 5 6 7 8 taining thea subunit cDNA (lane 1 ). The cloned cDNA for the mouse a subunit was used to FIG. 4. Northern blots of total RNA from various tissues of probe RNA isolated from variousrat tissues (Fig. 4, top). The Sprague-Dawley rats. The procedure was as described in Fig. 1. rat a subunit message was clearlydetected in thekidney (lane Total RNA (20 pg in each lane) was probed with the (Y subunit cDNA 1 ). Some message was also present in the small intestine (lane (top) and with human p-actin cDNA (bottom).The abbreviations are: 4 ) . There was no message detected in the brain, heart,liver, K, kidney; B, brain; H, heart; I, small intestine; V , liver; L,lung; S, spleen; and U,skeletal muscle. lung, spleen, and muscle (lunes 2, 3, and 5-8). The same rat RNA blotwas probed again with the human @-actin cDNA to assess the qualityof the RNA isolated from different tissues (Fig. 4, bottom). The tissue distribution of rat actin mRNA was similartothat of mouse actinmRNA.Mosttissues 9.4 1 expressed a single @-actin mRNA of2.0 kb, whereas heart 6.6 and muscleproduced a majormessage of lower molecule weight. Liver expressed the least amountof @-actinmessage. 4.4 Overall, the data indicate that thelack of detection of the a subunit mRNA in many rat tissues is not due to the quality 2.3 or quantity of RNA samples prepared from these tissues. 2.0 From the tissues examined, these results indicate that expression of the a subunit mRNA of rat meprin is kidney- and 1 2 3 4 5 6 7 8 9 intestine-specific; the level of a subunit mRNA is much higher in thekidney than in the small intestine. FIG. 5. Southern blot of chromosomal DNA from several The clonedmouse a subunit cDNAwasused to probe species. The genomic DNA fragments were hybridized with the 32Pgenomic DNA fragments from several species (Fig. 5). The a labeled clone 713 insert (Jiang et al., 1992). Abbreviations are as subunit gene was detected in human, monkey, rat, mouse, follows: H , human; K, monkey; R, rat; M, mouse; D, dog; W, cow; B, I
i
I
--
;
rabbit; C, chicken; and Y , yeast.
dog, cow, rabbit, and chicken but was not detectable in yeast (lane 9). These results indicate that the a subunit gene is widely distributed in higher organisms. The gene copy number of the a subunit was determined for the mouse genome. The EcoRI- and PstI-cleaved mouse chromosomal DNA was probed with a 200-base pair cDNA fragment (Fig. 6). A single mouse genomic fragment generated by either EcoRI or PstI hybridized to this probe. This result indicates that there is one gene copy for the a subunit present in the mouse genome. The mouse chromosomal location of Mep-la was deter1 21 32 43 54 5 mined by interspecific backcross analysis using progeny deFIG. 3. PCR amplification of mouse genomic DNA. Products rived from matings of [ (C57BL/6 X Mus spretus)F,X C57BL/ of the second round of the PCR (see text) were detected on ethidium 61 mice. This interspecific backcross mapping panel has been bromide-stained agarose gels. The DNA samples were a plasmid typed for over 1000 loci that are well distributed among all containing the (Y subunit cDNA (P,lune I ) and genomic DNA from C57BL/6 (57), C3H/He ( 3 H ) , ICR ( I C ) , and CBA (CB)mice (lunes the autosomes as well as the X chromosome (Copeland and 2-5). The primers used were PNl/PCl followed by PNl/oligo(A) Jenkins, 1991). C57BL/6 and M . spretus DNAs were cleaved with several enzymes and analyzed by Southern blot hybrid(left)and ENl/aC followed by ENl/ECl (right).bp, base pairs.
10384
:R 4.4
-
2.3
-
2.0
Expression of the N Subunit of Meprin A
1 2 FIG.6. Southern blot of mouse genome DNA.Genomic DNA was isolated frommouse kidney (Sambrook et al., 1989). DNA samples (10 pg) were digested with EcoRI (lane E) and PstI ( l a n e P)and were subjected to agarose gel electrophoresis. Samples were subsequently transferred to a nitrocellulose membrane and hybridized to a 3zPlabeled200-base pair cDNAcodingfor the the NH2 terminus of mature a subunit.
17
t
R Pim-1
6p21
H-2
6p21.3
ization for informativeRFLPsusing a meprin a subunit 4.8 probe. The 8.0-, 6.8-, and 3.6-kb M. spretus Sac1 RFLPs (see Mepda “Materials and Methods”) were used to follow the segregation of the Mep-la locus in backcross mice. The mapping results indicated that Mep-lais located toward the middle region of mouse chromosome 17 linked to Pim-1 and H-2. Although 119 mice were analyzed for all threeloci and are shown in the segregation analysis (Fig. 7), up to 164 mice were typed for FIG.7. Chromosomallocalization of the a subunit structural some pairs of loci. Each locus was analyzed in pairwise com- gene of mouse meprin A. The segregation patterns of Mep-la and binations for recombination frequencies using the additional flanking genes in 119 backcross animals that were typed for all loci data. The ratios of the total number of mice exhibiting recom- are shown at the top of the figure. For individual pairs of loci, up to 164 mice were typed (see text). Each column represents thechromobinant chromosomes to the total number of mice were ana- some identified in the backcross progeny that was inherited from the lyzed for each pair of loci, and the mostlikely gene order is: (C57BL/6 X M. spretw) FIparent. The black boxes represent the centromere > Pim-1 > 51164 > H-2 > 61124 > Mep-la. The presence of a C57BL/6 allele, and white boxes represent thepresence recombination frequencies (expressed as genetic distances in of M . spretus allele. The number of offspring inheriting each typeof centimorgans & the standard error) are: Pim-1 (3.1 f 1.3) > chromosome is listed at the bottom of each column. A partial chromosome 17 linkage map showing the location of Mep-la in relation H-2 > (4.8 & 1.9) > Mep-la. DISCUSSION
The work herein shows that inbred mouse strains that contain high or low meprin A activity contain the allele for the meprin a subunit in thegenome. However, only the mice that have high levels of kidney meprin A activity, and the 90kDa a subunit protein, have high levels of the a subunit mRNA. The reason for the lack of a subunit mRNA in low activity mice isunknown. It could resultfrom alack of transcription of the gene or from instability of the message. We suggest that the lack of message in low activity mice is due to lack of transcription because no fragments of the a subunitmRNA(degradationproducts) were observed on Northern blots of kidney tissue from those mice, and the quality and quantity of the mRNA isolated from different mouse strains was the same. The work also demonstrates that the meprin a subunit is clearly expressed in a tissue-specific manner. This is true in mice and ratsfrom the tissuesexamined. Of the mouse tissues tested, only kidney had significant amountsof the a subunit message, where as both kidney and intestine contained the message in the rat. These data confirm conclusions drawn from immunohistochemical data, indicating that only kidney contained abundant a subunit protein in mice (Bond et al., 1988) and that rats contained detectable protein in kidney and intestine (Barneset al., 1989). The later study presented some data showing that thea subunit proteinwas also present in mouse intestine, but the mRNA studies presented here support the contention that the subunit is not present in mouse tissue. Interestingly,immunohistochemicalstudies with human tissues indicate that the a subunit is expressed
to linked genes is shown at the bottom of the figure. Recombination distances between loci in centimorgans are shown to the left of the chromosome, and the positions of loci in human chromosomes, where known, are shown tothe right. References for thehumanmap positions of loci mapped in this study can be obtained from GDB (Genome Data Base), a computerized data base of human linkage information maintained by The William H. Welch Medical Library of The Johns Hopkins University (Baltimore).
primarily in the intestine and not in kidney? the The different tissue distributions may indicate specific functions for the enzyme in the differentspecies. Previous immunohistochemical and in situ hybridization studies indicated that thea subunit of the mouse and rat is only expressed in specific cell types of the kidney (Craig et al., 1991; Corbeil et al., 1992). Thus, the protein and mRNA for the a subunit is found only in the juxtamedullary region of the kidney cortex. This is further evidence for the highly specific expression of the protein subunit. Thisseems to be a pattern for the other relatedmetalloproteinases, the “astacin family” members (Dumermuth et al., 1991). Members of this family include astacin, bone morphogenetic protein-1 (BMPl),tolloid, B P 10, SpAN, UVS.2, N-benzoyl-L-tyrosyl-p-aminobenzoic acid hydrolase, the a and p subunits of mouse and rat meprins. Several of the members of this family are involved in developmental processes. These proteins arehighly inducible and are expressed only a t specific stages of development. The Drosophila dorsal-ventral patterning gene, tolloid, is only expressed dorsally at thebastoderm stage during early this embryogenesis (Shimell et al., 1991). The transcription -
E. E. Sterchi, personal communication.
10385
Expression of the a Subunit of Meprin A of the sea urchin BP 10 gene is transiently activated around the 16- to 32-cell stage and is also spatially controlled during embryogenesis (Lepage et al., 1992). The second sea urchin gene, SpAN, is expressed only during embryogenesis and spatially restricted along the animal-vegetal axis of embryos (Reynolds et al., 1992). The Xenopus laeuis gene, WVS.2, is expressed exclusively in the anterior neural fold of neurula stage during the dorsoanterior development (Sato and Sargent, 1990). The human BMP-1 is also inducible and involved in bone formation (Wozney et al., 1988). Astacin is found exclusively in the digestive tract of the crayfish. Overall, these metalloproteinases are subject to highly specialized expression. The a subunit gene occurs in a wide range of higher organisms. The stronger hybridization of humanand chicken chromosomal DNA fragments to the mouse probe observed in Southern blots might indicate that thereare multiple copies of the a subunit gene present in these genomes. Preliminary results indicate that there is more than one copy of the CY subunit gene in the human g e n ~ m eThere .~ was, however, no detectable mRNA for the a subunit inE. coli nor was the gene in yeast. These observations indicate that either anancestral gene for the a subunit in E. coli or yeastis very different from the mammalian and bird a subunit, or the a subunit gene evolved later than bacteria or lower eukaryotes. We recently found that a group of bacterial metalloendopeptidases contain a putative zinc-binding site that is similar to astacin and meprins and differentfrom other metalloendopeptidases such as thermolysin (Jiang and Bond, 1992). Thus, the mode of binding zinc found in astacin and other family members has roots in prokaryotes, although the primary structures of the eukaryotic and prokaryotic metalloendopeptidases show little or no similarity. The localization of the M e p - l a gene to chromosome 17 supports the possibility that the CY subunit structural gene is the same as the Mep-1 gene, which was found previously to be the locus associated with meprin A deficiency in certain mouse strains (Bond et al., 1984). Mep-1 was mapped telomeric to H-2D near the Tla gene and between Pgk-2 and Ce-2 genes on mouse chromosome 17 using congeneic and recombinant mouse strains (Reckelhoff et al., 1988). The linkage study revealed that Mep-1 is 2.1 crossover units telomeric to H-2D and 0.6 crossover unit from Tla (Reckelhoff et al., 1985). The present study using an interspecific backcrossing method showed that M e p - l a was localized telomeric to H-2, between Otf-3g and Pim-2. The same location of M e p - l a and Mep-1 on the mouse chromosome supports the proposal that Mep-1 is the structuralgene for the a subunit. It is possible that this gene not only encodes the structural part for the CY subunit but also contains the regulatory region which determines the expression o f the a subunit of mouse meprin A. However, it is also possible that Mep-1 encodes a separate protein which regulates M e p - l a gene expression. In addition tothe close proximity of the CY subunit structural gene to the H-2 complex on the mouse chromosome, there is other evidence that strengthens the tiebetween the CY subunit of meprin A and immunoglobulin-major histocompatibility complex (Ig.MHC) proteins. There is an Ig.MHC protein signature, (F, Y ) X C X ( V , A)XH, present in the CY subunit primary structure (YNCTATH). This signature is found in all immunoglobulin-related proteins, and thecysteine residue is involved in the formation of a disulfide bond in all these W. Jiang and J. S. Bond, unpublished data.
proteins. The cysteine in the a subunit is predicted to form a disulfide bridge from comparison with astacin (Dumermuth et al., 1991). Mouse and rat meprins provide two new examples of metalloproteinases that have different isozymic forms and tissuespecific expression. Other examples include thimet oligopeptidase (EC 3.4.24.15) and peptidyl-dipeptidase A (angiotensin I-converting enzyme, ACE, EC 3.4.15.1). Thimet oligopeptidase exists in two forms in tissues and cell lines, a predominant soluble form, and a minor membrane-bound form. The cDNA encoding the soluble form was cloned from the rat testes (Pierottiet al., 1990). Northern blot analyses using this cDNA indicated the presence of mRNA encoding the enzyme in rattestesbut not in other rat tissues. Thereare two isozymes of ACE, which are translated from two different mRNAs that are differentially expressed (Ehlers andRiordan, 1991). ACEp is synthesized in the endothelial cells of blood vessels as well as kidney and in several other tissues. ACEt is synthesized exclusively in testicularsperm cells. The different isozymic forms and tissue-specific expression may be responsible for specific physiological functions in different cellular compartments or tissues. Acknowledgments-We thank Dr. Won Oh for providing E. coli RNA samples, Dr. Thomas Sitz for providing DBA/2 mice, and B. Cho and D. A. Swing for excellent technical assistance. REFERENCES Barnes, K., Ingram, J., and Kenny, A. J. (1989) Biochem. J . 264,335-346 Beynon, R. J., and Bond, J. S. (1983) Science 219,1351-1353 Beynon, R. J., andBond, J. S. (1985) Intracellular Protein Catabolism (Khairallah, E., Bond, J. S., and Bird, J. W. C., eds) pp. 185-194, Alan R. LISS, Inc., New York Beynon, R. J., Shannon, J. D., and Bond, J. S. (1981) Biochem. J. 199, 591wm ”“-
Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7,1513-1523 Bond. J. S.. Bevnon. R.. J.. Reckelhoff. J. F.. and David. C. S. (1984) Proc. Natl. Acah. 5%. U.’S.A. dl, 5541-5545 ’ ’ Bond, J. S., Stroupe, T.,Macadam, G. C., Hall, J. L., and Beynon, R. J. (1988) in Mammalinn B r w h Border Membrane Proteirw (Lentze, M. J., and Sterchi, E. E., eds) pp. 139-147, Thieme Medical Publishers Inc., New York Butler, P. E.. and Bond. J. S. (1988) J. B~ol.Chem. 263.13419-13426 Chomczyns!&,P., and Sacchi, N. (1987) Anal. Biochem. iS2,156-159 Copeland, N. G., and Jenkins, N. A. (1991) Trends Genet. 7 , 113-118 Corbeil, D., Gaudoux, F., Wainwright, S., Ingram J., Kenny, A. J., Boileau, G., and Crine, P. (1992) FEBS Lett. 309,203-20; Craig, S. S., Mader, C., and Bond, J. S. (1991) J. Histochem. Cytochem. 39, 123-129 Dumermuth E. Sterchi, E. E., Jiang, W., Wolz R. L., Bond, J. S., Flannery, A. V., and’BeGnon, R. J. (1991) J. Biol. Chem.’266, 21381-21385 Ehlers. M. W.. and Riordan. J. F. (1991) Biochemistrv 30. 7118-7126 Gorbea, C. M.; Flannery, A.V., and Bond, J. S. (1991j Arch. Biochem. Biophys. 290,549-553 Green, E. L. (1981) in Genetics and Probability in Animal Breeding Experiments, pp. 77-113, Oxford Universitv Press, New York Gunning, P., Hardeman, E., Wide, R., Ponte, P., Bains, W., Blau, H. M., and Kedes, L. (1987) Mol. Cell. Biol. 7 , 4100-4114 Jenkins, N. A., Copeland, N. G., Taylor, B. A,, and Lee, B. K. (1982) J. Virol. 43.26-36 . ~ ... Jiang, W., and Bond, J. S. (1992) FEBS Lett. 3 1 2 , 110-114 Jiang, W., Gorbea, C. M., Flannery, A.V., Beynon, R. J., Grant, G. A,, and Bond, J. S. (1992) J. Biol. Chem. 267,9185-9193 Johnson, G. D., and Hersh, L. B. (1992) J . Biol. Chem. 267,13505-13512 Kenny, A. J., and Ingram, J. (1987) Blochem. J. 246,525-524 Lepage, T.,Ghiglione, C., and Gache, C. (1992) Development (Camb.) 1 1 4 , I~
~
147-164
~
~
I
~
Pierotti, A,, Dong, K.-W., Glucksman M. J., Orlowski, M., and Roberts, J. L. (1990) Biochemistry 29,10323-103i9 Reckelhoff, J. F., Bond, J. S., Beynon, R. J., Savarirayan, S., and David, C. S. (1985) Immunogenetics 22,617-623 Reckelhoff, J. F., Butler, P. E., Bond J. S., Beynon, R. J., and Passmore, H.C. (1988) Immunogenetics 27,298-360 Reynolds, S. D., Angerer, L. M., Palis J., Nasir, A,, and Angerer, R. C. (1992) Development (Camb.) 114,769-78d Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Moleculur Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Sato, S. M., and Sargent, T.D. (1990) Deu. Biol. 137, 135-141 Shimell, M. J., Fergfuson, E. L., Childs, S. R., and O’Connor, M. B. (1991) Cell 67,469-481 Siracusa, L. D., Jenkins, N. A., and Copeland, N. G. (1991) Genetics 127,169179 Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M., and Wang, E. A. (1988) ’Science 2 4 2 , 1528-1534
