Tissue-Specific Expression of the Diazepam-Binding Inhibitor in ...

Vol. 14, No. 10

MOLECULAR AND CELLULAR BIOLOGY, OCt. 1994, p. 6983-6995

0270-7306/94/$04.00 + 0 Copyright © 1994, American Society for Microbiology

Tissue-Specific Expression of the Diazepam-Binding Inhibitor in Drosophila melanogaster: Cloning, Structure, and Localization of the Gene MEELIS KOLMER,l* CHRISTOPHE ROOS,2 MIKA TIRRONEN,2 SANNA MYOHANEN,3 AND HANNU ALHO' Department of Biomedical Sciences, University of Tampere, FIN-33101 Tampere,1 Department of Genetics, FIN-00014 University of Helsinki,2 and Department of Biochemistry and Biotechnology, University of Kuopio, FIN-70211 Kuopio,3 Finland Received 25 April 1994/Returned for modification

1

June 1994/Accepted 27 June 1994

The diazepam-binding inhibitor (DBI; also called acyl coenzyme A-binding protein or endozepine) is a 10-kDa polypeptide found in organisms ranging from yeasts to mammals. It has been shown that DBI and its processing products are involved in various specific biological processes such as GABAA/benzodiazepine receptor modulation, acyl coenzyme A metabolism, steroidogenesis, and insulin secretion. We have cloned and sequenced the Drosophila melanogaster gene and cDNA encoding DBI. The Drosophila DBI gene encodes a protein of 86 amino acids that shows 51 to 56% identity with previously known DBI proteins. The gene is composed of one noncoding 5' and two coding exons and is localized on the chromosomal map at position 65E. Several transcription initiation sites were detected by RNase protection and primer extension experiments. Computer analysis of the promoter region revealed features typical of housekeeping genes, such as the lack of TATA and CCAAT elements. However, in its low GC content and lack of a CpG island, the region resembles promoters of tissue-specific genes. Northern (RNA) analysis revealed that the expression of the DBI gene occurred from the larval stage onwards throughout the adult stage. In adult flies, DBI mRNA and immunoreactivity were detected in the cardia, part of the Malpighian tubules, the fat body, and gametes of both sexes. Developmentally regulated expression, disappearing during metamorphosis, was detected in the larval and pupal brains. No expression was detected in the adult nervous system. On the basis of the expression of DBI in some but not all tissues with high energy consumption, we propose that in D. melanogaster, DBI is involved in energy metabolism in a manner that depends on the substrate used for energy production.

have shown that DBI is able to reduce the response of cultured to GABA (7). Altered DBI concentrations in cerebrospinal fluid have been found in several mental disorders, such as hepatic encephalopathy (49, 50) and severe endogenous depression (62, 63). Taken together, these data indicate that DBI may act as an endogenous modulator for the GABAA receptor complex. Further, DBI enhances steroidogenesis (11, 52, 53, 76) by stimulating cholesterol delivery to the inner mitochondrial membrane (76). Recently, antisense oligonucleotides for DBI were shown to inhibit hormone-stimulated steroid production in Leydig cells (8). One of the DBI metabolites (DBI33-87) has been shown to have antibacterial properties (1). Furthermore, a 10-kDa peptide, able to bind and induce synthesis of the acetyl coenzyme A (acetyl-CoA) fatty acid esters (acyl coenzyme A [acyl-CoA]), was found to be identical with DBI (44) and was named acyl-CoA-binding protein (ACBP). It has been shown that ACBP is able to prevent inhibition of acetyl-CoA carboxylase and mitochondrial adenine nucleotide translocase by acyl-CoA (57). Further, ACBP was shown to be able to extract acyl-CoA from phosphatidylcholine membranes immobilized to nitrocellulose and to transport acyl-CoA to mitochondria or microsomes in suspension (or immobilized microsomes) and donate them to ,B oxidation or glycerolipid synthesis, respectively (56). Evidence that acyl-CoA is bound to ACBP in vivo was obtained when overexpression of recombinant bovine ACBP in yeast cells resulted in a significant increase in cellular acyl-CoA content (42). Given these results, ACBP was proposed to act as pool former and/or transporter of acyl-CoA. DBI also inhibits

The diazepam-binding inhibitor (DBI) is a 10-kDa polypeptide that was first purified from rat brain on the basis of its ability to displace diazepam from the -y-aminobutyric acid receptor type A (GABAA)/benzodiazepine receptor (24). More recently DBI has also been purified from several peripheral organs such as pig intestine (14) and from bovine and rat liver (34, 44, 47). DBI has been shown to be expressed in several rat tissues (3, 9). The highest expression has been observed in the adrenal gland, liver, and somatic tissue of the testes, while the lowest levels have been detected in spleen, lung, and muscle (34, 45, 68). Nevertheless, DBI expression is restricted to certain cell types. In the rat brain, DBI is localized in selected neuronal populations, ependymal and glial cells (2, 3). DBIlike peptides have also been found in the central nervous systems of trout (Salmo gairdneri) (39) and frogs (Rana ridibunda) (40). In the adrenal gland, DBI is expressed in cortical cells, whereas chromaffin cells of the medulla are immunonegative (9). DBI and its metabolites octadecaneuropeptide (DBI33_50) and triakontatetraneuropeptide (DBI17-50) are involved in the regulation of multiple biological processes. In rats, intracerebroventricular injection of DBI or one of its metabolites has been shown to elicit proconflict behavior, which can be reverted by either central or mitochondrial benzodiazepine receptor antagonists (19, 20, 69). Electrophysiological studies

neurons

* Corresponding author. Mailing address: Department of Biomedical Sciences, University of Tampere, P.O. Box 607, FIN-33101 Tampere, Finland. Phone: 358 31 2157323. Fax: 358 31 2156170. Electronic mail address: [email protected].

6983

6984

KOLMER ET AL.

glucose-mediated insulin secretion from pancreatic islets (6, 14, 50a). DBI cDNA clones have been isolated from humans (23, 75), rats (46), mice (51), and oxen (75). Recently, the structures of the yeast (Saccharomyces cerevisiae) ACBP/DBI gene (61) and tobacco hornworm (Manduca sexta) DBI cDNA have been described (70). Protein sequences have been reported for human (43), rat (34), bovine (43, 44), pig (14), and duck (74) DBI. Recently genomic sequences of the rat DBI functional gene and five processed pseudogenes have been reported (36, 41). The functional promoter region of the rat DBI gene has also been characterized (36). On the basis of its broad range of distribution throughout the organism and its extreme structural conservation in phylogenesis, DBI could be classified as a housekeeping protein (41). This view is supported by an analysis of the rat DBI promoter region, which possesses features typical of housekeeping genes (i.e., high GC content, presence of a CpG island, and lack of TATA and CCAAT boxes) (36, 41). Further evidence in support of this suggestion is provided by the presence of the DBI protein in S. cerevisiae, a unicellular organism expressing mainly basic metabolic functions (61). However, the cell-type-specific expression of DBI in several mammalian tissues suggests the existence of specific regulatory mechanisms for DBI gene expression. Taken together, these findings seem to indicate that DBI represents a protein with a dual nature: it serves as a housekeeping protein in certain cell types and as a tissue-specific protein in other cell types or under certain physiological conditions. Even in S. cerevisiae, DBI might have multiple functions. To further extend our knowledge about the biology of DBI, we describe here the localization, cloning, and sequence analysis of the Drosophila melanogaster DBI gene and cDNA. The expression of DBI in different tissues and developmental stages was studied by immunohistochemical techniques and mRNA in situ hybridization.

MATERIALS AND METHODS Flies. All experiments were performed on the Oregon R wild-type strain of D. melanogaster. Flies were maintained in uncrowded conditions at 25°C on standard medium (malt, cornmeal, yeast, agar, propionic acid, Nipagin). Library screenings and nucleotide sequencing. A D. melanogaster (strain Oregon R) cosmid genomic library (25) was screened with a 32P-labeled probe generated by PCR as described earlier (36), using a rat DBI cDNA (46) as the template. Hybridization was performed at low stringency in 37% formamide-5x SSC (lx SSC is 0.15 M NaCl plus 0.015 sodium citrate)-5x Denhardt's solution-0.1% sodium dodecyl sulfate (SDS) containing 0.1 mg of denaturated salmon sperm DNA per ml for 16 h at 37°C. After hybridization, the filter was washed twice for 10 min in 2x SSC-0.1% SDS at room temperature and twice for 15 min in the same solution at 50°C. Positive cosmid clones were further characterized by Southern hybridization technique at low stringency as described above. Restriction fragments giving positive hybridization signals were subcloned into the pBluescript II KS- vector (Stratagene). To obtain appropriate subclones for nucleotide sequencing, exonuclease III deletion libraries were generated with the Exo III nested deletion kit (Pharmacia). A D. melanogaster cDNA library (strain Canton S, adult female, in XgtlO) (55) was screened at high stringency with a 1.9-kb EcoRI-HindIII genomic DNA fragment isolated from cosmid clone, labeled by random priming with [x-32P]dCTP. The cDNA clones were subjected to nucleotide sequencing

MOL. CELL. BIOL.

after subcloning of the inserts into the pBluescript II KSvector. Sequencing was carried out by the chain termination method (65) with an AutoRead sequencing kit (Pharmacia), and reaction products were analyzed with an ALF automated DNA sequencer (Pharmacia) and assembled with the XDAP program (17). DNA sequence data were analyzed with the Genetics Computer Group software package (18). All molecular cloning procedures were carried out essentially as described previously (64). Restriction enzymes were from Promega, New England Biolabs, and Boehringer Mannheim; T4 DNA ligase and Taq DNA polymerase were purchased from Promega; [o-32P]dCTP and [a-32P]dATP were from Amersham. RNA isolation, Northern (RNA) analysis, and RNase protection assays. RNA was prepared as described earlier (4). Formaldehyde agarose gel electrophoresis and Northern blotting were carried out as described previously (64). Filters were hybridized with the 32P-labeled Drosophila cDNA. For mRNA transcriptional start site determination, a 212-bp HindIII-PstI fragment of the DBI gene containing the first untranslated exon and 104 bp from intron 1 (nucleotides from positions -868 to -656 in Fig. 1B) was cloned into pBluescript II KS-. The cRNA probe was synthesized by using T7 RNA polymerase (Promega) and [a-32P]UTP (Amersham) on a plasmid template linearized with XhoI. RNase protection assays were carried out with the RPA II Ribonuclease Protection Assay kit (Ambion). Protected RNA fragments were analyzed by electrophoresis on an 8% polyacrylamide gel containing 8 M urea. Primer extension experiments were carried out with the fluorescein isothiocyanate-labeled oligonucleotide primer 5'TGTTGTGTGTTG1T1lGCCAC3', covering part of the first untranslated exon, from positions -760 to -779, exactly as described earlier (48). The reaction products were analyzed on an ALF automated DNA sequencer. In situ mRNA hybridizations. In situ hybridizations to whole gametes were performed by the method of Tautz and Pfeifle (73), with modifications of fixation as described by Suter and Steward (72) and Serano and Cohen (67a). The first fixation of dissected tissue was performed by adding 1 volume of 4% paraformaldehyde (in 80 mM N-2-hydroxyethylpiperazine-N'2-ethanesulfonic acid [HEPES; pH 6.9]-2 mM MgSO4-1 mM EGTA) and 4 volumes of heptane to the tissue in an Eppendorf tube and incubating the mixture for 20 min with vigorous shaking. After incubation, most of the solution was replaced with an equal amount of methanol, and shaking was continued for 3 min. The tissue was rinsed with methanol (once) and ethanol (twice) and then stored in absolute ethanol for at least 2 h at -20°C. The second fixation and permeabilization procedure was performed as follows: the ethanol was replaced by methanol, and the tissue was incubated at room temperature for 5 min. Then the tissue was rinsed for 5 min in a 1:1 mixture of methanol and PF/PBST (PF/PBST is 4% paraformaldehyde in phosphate-buffered saline [PBS] with 0.1% Tween 20) and fixed for 20 min in a 9:1 mixture of PF/PBST and dimethyl sulfoxide at room temperature. Following several rinses in PBST (PBS, 0.1% Tween 20), the tissue was treated with proteinase K (50 ,ug/ml in PBST) for 5 min. Proteinase K treatment was stopped by three consecutive washes with a solution of PBST containing 2 mg of glycine per ml. The third fixation was performed for 20 min in PF/PBST, and the samples were then rinsed for 15 min in five changes of PBST. Hybridization and washing were performed as described by Tautz and Pfeifle (73). A 1.9-kb EcoRI-HindIII genomic

VOL. 14, 1994

fragment including all three exons was labeled with digoxigenin-dCTP and used as a probe. In situ hybridizations to sections were carried out as follows. The adult flies were fixed (first fixation) and placed in ethanol as described above. Samples were then embedded in paraffin wax, and 8-,um sections were cut and mounted on glass slides. After removal of the wax with xylene, sections were rehydrated, fixed in 3:1, 2:2, and 1:3 (3 min each) mixtures of ethanol and PF/PBST, and then fixed 10 min in PF/PBST and dimethyl sulfoxide (9:1). The sections were treated with proteinase K for 3 min after several rinses in PBST (see above). The third fixation was performed as stated above, and the slides were dehydrated in an ethanol series. Hybridization was performed as described by Tautz and Pfeifle (73) with the same probe as specified above. Immunohistochemical techniques. For immunohistochemistry on tissue sections, larvae, pupae, and adult flies were fixed in Bouin fixative (70% ethanol, 20% chloroform, 10% acetic acid) overnight at 4°C, then transferred to 90% ethanol (in water) for 30 min at room temperature, dehydrated in absolute ethanol, and embedded in paraffin wax by the standard histological procedure. The sample blocks were serially cut into 6-,um sections. After deparaffinization, the sections were further processed for immunohistochemical antigen visualization by using a specific rabbit polyclonal rat-DBI antiserum (2). Briefly, the immunostaining was carried out by incubating the sections for 20 min in 5% blocking serum (normal goat serum) in PBS at room temperature and then incubating them overnight at 4°C with an antiserum against rat DBI (diluted 1:4,000) in PBS with 1% normal goat serum. The antigenantibody complexes were visualized with a goat anti-rabbit biotin-avidin system (ABC Elite Vectastain kit; Vector) as instructed by the manufacturer, using hydrogen peroxide (0.001% for 5 min) and diaminobenzidine (0.2 mg/ml) for visualization. For whole-gamete immunohistochemistry, the ovaries and testes were dissected in PBS and ovarioles were slightly torn apart, and the samples were then fixed in Bouin fixative for 20 min at room temperature and washed in PBS. To enhance antigen penetration, an ultrasound-amplified immunostaining method was used (54). Briefly, after incubation of the samples with normal blocking serum, ultrasound irradiation was carried out with the primary antiserum (1:3,000 in PBS-1% normal goat serum) in an ultrasound bath for 20 s, thereafter incubated with the same solution overnight at 4°C, and further processed for antigen visualization as described above. The unmounted tissues were photographed under a dissection microscope. Immunohistochemical specificity was tested either by incubating the sections with preimmune serum instead of primary antiserum or by preabsorbing the antisera with purified rat liver DBI at concentrations of 1, 5, and 10 ,uM. Chromosomal localization. Chromosomal localization in situ experiments were performed on polytene chromosomes exactly as described earlier (27). The probe was the same as for the mRNA in situ hybridization. Nucleotide sequence accession numbers. Accession numbers for the DBI gene and cDNA in the EMBL/GenBank/DDBJ database are U04822 and U04823, respectively. RESULTS Cloning, localization, and structure of the DBI gene and cDNA. Southern hybridization analyses of Drosophila genomic DNA with a rat DBI cDNA as a probe revealed the presence of sequences homologous to a rat DBI gene (data not shown).

DROSOPHILA DIAZEPAM-BINDING INHIBITOR

6985

The Drosophila genomic library was screened with the rat DBI cDNA probe at low stringency, and two positive cosmid clones (cgdDBIl and cgdDBI2) were isolated. The cosmid clones were characterized by restriction fragment analysis and subsequent Southern hybridization with the rat DBI cDNA probe, and positive restriction enzyme fragments were subcloned into a plasmid vector. Two cDNA clones (pcdDBIl and pcdDBI2) were isolated from an adult Drosophila cDNA library by using a Drosophila DBI genomic DNA probe. Sequencing of both genomic and cDNA clones showed that the gene encoding DBI consists of three exons (Fig. 1). The 5' end of the DBI cDNA clone corresponds to position -775 (Fig. 1B). An open reading frame starting from the middle of the second exon and extending halfway through the third exon was found to code for an 86-amino-acid polypeptide with a high similarity to known DBI protein sequences from other species. Drosophila DBI protein shares a 50 to 54% identity with known mammalian DBI proteins, 51 % with avian DBI protein, 54% with yeast DBI protein, and 56% with tobacco hornworm DBI proteins. The comparison of Drosophila DBI protein with known sequences from other species is shown in Fig. 2. Nuclear magnetic resonance spectroscopic studies of the three-dimensional structure of the recombinant bovine DBI and acyl-CoA complex have shown that amino acids Ala-10, Lys-14 (conservative replacements by Asn in the yeast sequence and by Arg in the human and tobacco hornworm sequences), Tyr-29, Lys-33, Lys-55, and Tyr-74 (starting from the initiator Met) contribute to the ligand binding of DBI (37). All of these amino acids are also conserved in Drosophila DBI

(Fig. 2).

All splicing sites of the DBI gene follow the GT-AG rule. A canonical polyadenylation signal, AATAAA, was found 68 bp downstream from the translational stop codon, at position +770. The cDNA sequence suggests that the poly(A) addition site is located 28 bp downstream from the polyadenylation signal at position +803 (Fig. 1B). The Drosophila DBI gene was cytologically localized to map position 65E by in situ chromosomal localization experiments to the polytene chromosomes of the larval salivary gland (Fig. 3). Mapping of the transcription initiation sites. Transcriptional start sites were mapped by RNase protection assay and primer extension techniques. An RNase protection assay (Fig. 4A) and primer extension experiments (Fig. 4B) revealed multiple cap sites. Comparing the data obtained by the two techniques, we conclude that the major cap site is located at position -798. Minor cap sites are at positions -773, -775, -782, -786, -791, -796, -797, -799, and -802 (Fig. 1B). However, there remains the possibility that some of the cap sites are located within the region covered by the oligonucleotide primer used in the primer extension assays. In addition, fragments shorter than 20 nucleotides could easily remain undetected by the RNase protection assay under standard conditions. Multiple cap sites were also detected in the rat DBI gene (36, 41) and are typical of TATA-less genes. Computer-assisted analysis of the promoter region. Computer-assisted analysis of the sequence upstream from the transcriptional start sites revealed no canonical TATA or CCAAT boxes. The promoter region contains multiple putative recognition sites for known transcription factors. Several putative recognition sites were found for the ubiquitous transcription factors Spl (30) and ETF (31), which are involved in the regulation of housekeeping genes. There is evidence of the involvement of Spl in the regulation of the rat DBI promoter

6986

MOL. CELL. BIOL.

KOLMER ET AL.

A

.%~

Hindill

PstI

BamHI EcoRI

I

exonl (46 bp)

0.5 kb

exon2 (29 bp)

exon3 (347 bp)

B -1749 ggatccttgttcaactcagtatttaattgggattattaccttcaaattttc aacattaccaacaag atcctat

ABF1-

-1675

actagcaacatggtgtcggtgagtattctacactttggatataacgtcaatttagtgaaagattgcataagaE

-1601 aaattcc atttttcacacttttatggtgttatataagtacaaagtttcctgactgcgactttcctttgctgaa -1527

NFicB.rev

cagttcgaggaagccactgaactcgccaagaagttcaccaagaagCccacggatgCcgagttCttggaattCta

-1453 cggtctcttcaagcaggccaccgttggcgatgtgaacatcgagaagcccggcgctctggctctcaaggaciagg -1379 ccaagtac a

cctggagctccaacaagggtctctccaaggaggctgccaaggaggcctacgtaaaggtgtac

ABF1l

-1305 gagaagt&c aagtacgcctaagccggcaaccgatcaaatccgatccaatccgattccgattgcggacc

ccatgcaEtct

tcaccactatagtacttagttggacaataaagattaccagatatatgagcaataatca -1231 Spl1.rev__ -1157 ggtgtttgtccggctgagcggcattttattggagct tc tacattat qgctaaaatggagatggagatttE

Sp1

ABF.rev

Sp1 SP1-

gggpccctcgaactttgatccgaacgagattacgtgtcttgacagtggtgtttEgztgaat

-1083 gag -1009 tatcaggga tcgaaatcggagct ttatcagtaggcctgcattatcagcaa cgcgaatgE c

Ccttc

-935

Spl.rev agcgaaagcttcccgatccactgagaatcggagtggagcttaaccgctcattttgCtcactgaga aagcttt

-861

ltct q

ABF.rev

craat:cgtgcgatatgg ABF.reve ABF.rev* Sple V

tgacttaaattgaaagtcaccattgGAAIX GACACTGT Sple

-787 -713 -639 -565 -491 -417 -343

T'AGTTCTGTGGCAAACAACACACAACAgtaagtgtttagtttaaattcaattacccagctgctaatgggtggt

-269 -195 -121 -47

ttcccagttctactcgaattatgtatttcagccgggagaaagtcgaacaaacatctatccattagcaaacattc gtagggtcttcaagatcgcctcacggggCcaaaggtcatttccagctggctctgtttggCacaCgCcagCctct tcactcggaactggttttacttattatgctaataaacattaagctgaccacttcataaacatgactaattaaac attttttttttacaattccactacttacAGATAAAATCTAACCCAGAATGGTTTCCGAGgtaagtactttccca

28 102 176 250 324 398

aaagattatgcactgatagcaacagtctaccaacatttagggcgtgatagCcttgCtgCtaatcacctgttCga ttgctatacactgagcgaaatctattcataagcgattgacttttcaatcttaaaattgtaatcgtaatatgaga taagattgtgattccgctgaagcaaggacagctgttcaaatacgattttgtCttgaagtaataaccgttttCgg ttgaaatcgataattataattttttgtagtttccagagaatatttttatCtcgcacaactatttttgttagttt taatgacagtttgttagtagatattgttgcaactaatattccaaaccttttttataataccactttcaatagat tttacgatcccacttgatagattttccactaataaatcatcccgtctatcttcagCAATTCAACGCCGCCGCCG

aatatcagtgctggtgacacataaagtggacatttcgtgcgagtttatacacctgCagaactcaattatggaaa ttcgccaggcaacaggcactgatgaaaataaagtacaaaaaaatcgcttttgaaaCgCatattCtggaacatgc taaacgaaacttgtcaccttgaccttttgcaattttccacgcccataaactaaatgagtgccttttaaatgatt acttattttagaactgcaagatggcgtggccataactaagcatgaccatatgtatgtgCcagatattttgctca

gtgctagacacgtacaaagcccacgtccgtatccaaattggtcgaaattcgcCggCcaaaagCggCcgctaaCg gttgcccgctcgctccctttcaaaaatctcgcagtcgagacaaatatttgcgtCtgctgtttccgCagcataat

MetValSerGlu

GlnPheAsnAlaAlaAlaG 472 AGAAGGTGAAGAGCCTAACCAAGCGTCCCAGTGATGACGAGTTCCTGCAGCTGTACGCCCTGTTCAAGCAGGCC

1uLysValLysSerLeuThrLysArgProSerAspAspGluPheLeuGlnLeuTyrAlaLeuPheLysGlnAla 546 AGCGTTGGTGACAACGACACCGCCAAGCCGGGTCTCCTGGACCTGAAGGGCAAGGCCAAGTGGGAGGCCTGGAA

SerValGlyAspAsnAspThrAlaLysProGlyLeuLeuAspLeuLysGlyLysAlaLysTrpGluAlaTrpAs 620 CAAGCAGAAGGGCAAGAGCAGCGAGGCCGCCCAGCAGGAGTACATCACCTTTGTGGAGGGCCTGGTGGCCAAGT

nLysGlnLysGlyLysSerSerGluAlaAlaGlnGlnGluTyrIleThrPheValGluGlyLeuValAlaLyST 694 ATGCCTAAAAACCCAATCCCAGCAATTAGCGATCTTAAACCAGCTAGAGACTATTGTAATGTTACCTTTAATGC

yrAla*** 768 842 916 990 1064

GGAIACTTCGTATGTTAATTTTGTACTAAAagatattgacccggtgactcaagaggtgcatacgcctggcc

tggggctatttaactggcaaatagaggaagtggctggctgcaccgCtttgcagtactttgaaccgccagtggCg cttgttagcggtgcatcgttaatggatcttcgagtgtgtttgtccaaacCgcgCttcgaaCggggttcaaagtc gaggggaagatttcctaaaacttcgaccttgagccatccatctatcctgtttgacgtacgtagtttaacttaac gaaaagctt 1072

FIG. 1. (A) Structure of the Drosophila genomic loci encoding for DBI. The exon structure of the DBI transcript is shown beneath the genomic map, with the open reading frame indicated by filled boxes. (B) Nucleotide sequence of the Drosophila DBI gene. Exons are represented by uppercase letters. The first A nucleotide of the initiation codon is + 1. Stop codon TAA is designated by asterisks. Transcription initiation sites are marked by arrows. The 5' end of the cDNA clone is marked by an open triangle. Selected putative transcription factor recognition sites in the promoter region are shown and are marked with dots (in the case of one allowed mismatch). Transcription factor ETF recognition sites are underlined. The polyadenylation signal is doubly underlined. rev, putative transcription factor recognition sites in reverse orientation.

(36). Several putative binding sites were found for the transcription factor ABF1 (12, 26), which has also been found in the promoter regions of genes involved in fatty acid metabolism in S. cerevisiae (66). ABF1 consensus sites were also detected in the promoter of the yeast DBI gene (61). In addition, consensus sites for NFKB and CTF/CBP were found. Selected putative transcription factor recognition sites are depicted in Fig. 1B. The GC content of the promoter region 500 bp upstream

from the first exon is 42%, and the frequency of the dinucleotide CpG is 1.38. Hence, the promoter region of the Drosophila DBI gene does not meet the criteria used for defining CpG islands (GC content at least 50% and CpG frequency over 0.6) usually found in promoter regions of housekeeping genes (22). The values for the rat promoter -500 region are 58% and 0.7, respectively. The GC content of the yeast promoter was found to be 42% in the -500 region, and the CpG dinucleotide frequency was 1.09. Thus, with respect to the CpG island, the

.aS
.

50

FIG. 8. Expression of DBI immunoreactivity in tissue of the third larval instar. Anterior is up. (A) Larval brain (Lb) and midgut (Mg) show a distinct signal, while the cardia (Ca) is almost void of staining. (B) Whole view of the larva from which the sections mounted in panel A were taken. (C) Male gamete showing a gradient of DBI immunoreactivity, fainter in early stages (right) and stronger in maturing germ cells (left). Bars equal 50 ,urm.


VOL. 14, 1994

A ... on

..

x 'i.

*

.

y

18

v

;: .

rx .,

*

,=.

t

:j

.:.

?2

t . *,-

:t

>I

...

a ! -.

,

.7.

?I

1.

7..

1,

i."

6991

important role in insect energy metabolism and is expressed mainly in cell types catabolizing fatty acids as a primary substrate for energy production. We will examine the results from the viewpoint of our hypothesis. In the Drosophila excretory system, DBI was detected in the distal part of the anterior Malpighian tubules. These parts of the tubules are the main site of primary urine secretion and hemolymph filtration, whereas the proximal parts exhibit mainly resorptive functions. The mammalian excretory system has also been shown to express DBI. In the rat kidney, DBI is expressed in the convoluted tubules, in the collecting ducts, and in the thick ascending limb of Henle's loop (9). In mammals, primary urine is formed by a mechanism based on hydrostatic pressure. In a second step, resorption of water and electrolytes is achieved by the active generation of an ionic gradient. In insects, these processes are reversed; primary urine is formed by the generation of an osmotic pressure

gradient by active K+ ion transport from the hemolymph to the N i4Ay. I M4. G ; lumen of the Malpighian tubules. In both mammals and D. 7 . 7. high DBI levels were detected at the site of ion V4 -2x .t,, ,..s ~melanogaster, 7 The ~gradient formation, ain process requiring much energy. tEB"j,.) g i;{ involvement of DBI cellular energy production is further _9 >S98 substantiated by the fact that DBI and mitochondria have similar distributions in the epithelial cells of the Malpighian and are enriched in microvilli. Such a concentration of n PX tFffi %gtubules DBI around the mitochondria has also been shown by immuz M ZX > noelectron microscopic studies of rat testis Leydig cells with highly specialized steroidogenic function and secretory activity

(67).

In the digestive system of adult flies, DBI was found to be expressed at high levels in the outer vacuolate epithelium of the stomodeal valve of the cardia. The cardia is located at the

*W%{¢ |g a¢a Xn ( FIG. 9. Expression of DBI immiunoreactivity in a sagittal section of a pupal head. (A) The signal is mainly detected in the peripheral region of the neuropile (arrow). (B,) Phase-contrast micrograph of the same section. The bar equals 50 pim.

DBI suggest that DBI is invol ved in acyl-CoA metabolism in the fruit fly as well. To inve stigate this possibility and to characterize other potential jroles of Drosophila DBI, we analyzed its expression. Since INorthern analysis revealed the presence of a DBI mRNA from the larval stage onwards to the imago, we analyzed sections of whole larvae, pupae, and adults of both sexes by in situ mRNA hybridization and immunohistochemistry. DBI was detected in four different organ systems: the digestive, excretory, reprodluctive, and nervous systems. In addition, DBI was observed in the fat body. DBI is highly expressed in specialized tissues, with high energy consumption using fatty acids as a primary energy substrate. Expression of DBI iin the fat body and developing egg chambers supports the protposed role of DBI in acyl-CoA metabolism. The fat body (a functional equivalent of the vertebrate liver) is the principa]I tissue for intermediary metabolism and a primary storage siite for triacylglycerol in insects (32). During oogenesis, subsitantial amounts of lipids are known to be deposited in the oc)cyte (15). However, our results show that the most intense DBI immunoreactivity was detected not in the fat body or ovaries but in certain structures of the cardia and Malpighian tubules and in the testes. This result is surprising since none of these ttissues have so far been characterized as prominent sites for the storage or metabolism of fatty acids. However, one com mon feature of these tissues is high energy consumption. Wre propose that DBI has an

junction between the esophagus and the intestine, and one of

its functions is the synthesis of the peritrophic membrane, a porous sleeve that lines the intestine and separates gut contents from intestinal epithelium. The continuous process of peritrophic membrane synthesis and secretion is thought to require much energy. A remarkable difference between the expression pattern of DBI in D. melanogaster and vertebrates is observed in the germ line cells. In D. melanogaster, DBI was found to be expressed in germ line cells of both sexes during gametogenesis. In rat testes, DBI is expressed in Leydig cells and at very low levels in Sertoli cells, whereas germinal cells are completely immunonegative (9, 59, 67). Rat oocytes also lack DBI immunoreactivity (la). In D. melanogaster, differentiation of gonial cells to spermatocytes is characterized by a huge increase in size and a rapid formation of the tail. Oogenesis is also characterized by a tremendous increase in cell size and activity due to the deposition of large quantities of lipids, storage proteins, and RNA. Large amounts of energy are required for these processes. DBI was no longer detected in late oogenic stages and mature eggs, which could be explained by a low level of metabolic activity. The involvement of DBI in energy production through fatty acid catabolism is further supported by our observation of a relatively low expression of DBI in the fat body. Although serving as a main storage and metabolic site for fatty acids in insects, the fat body has been shown most frequently to use carbohydrates as a source of energy production (32). The absence of DBI from the flight muscles, tissues with very high energy consumption in which carbohydrates have been shown to be virtually the exclusive energy source (13), also supports our

hypothesis.

It is of interest that we detected no DBI mRNA during early embryogenesis, despite the fact that fatty acids have been

MOL. CELL. ML EL BIOL. IL

KOLMER ET AL.

6992

A N /

(.

Fb.

( £

M.Mp

B,.

%-

10

C :..:. 1:

-:.:..:

No......

FIG. 10. Expression of DBI immunoreactivity in longitudinal sections of an adult fly. (A) Overall view of whole male fly. Signal is seen in the cardia (thorax), fat body, Malpighian tubes (anterior end of abdomen), and testes (posterior end of the abdomen). (B) Longitudinal section of the cardia. DBI immunoreactivity is detected in the outer vacuolate epithelium of the stomodeal valve. (C) Female abdomen with section through egg chambers at stages 4 to 8. The signal is detected both in the polyploid nurse cells (Nc; characterized by large nuclei) and in the surrounding follicular cells (Fc). (D) Anterior end of abdomen showing DBI immunoreactivity in the Malpighian tubules (Mp) and the fat body (Fb). (E) One of the Malpighian tubules (visible in panel D) under higher magnification. DBI is concentrated in the apical part of the cell, which forms microvilli. (F) Transversal section through the testis tube winding in the posterior part of the abdomen. The staining is uneven and seems to accumulate in the cell body, and it is less intense in the elongating spermatid tails. Bars equal 50 p.m (A to D and F) and 10 p.m (E). shown to be a major source of energy during insect embryogenesis (see reference 5 for a review). One possible explanation could be that the early embryo is a huge cell and intracellular transport of a acyl-CoA would probably require a mechanism different from that involving DBI used in normalsize cells. Among the possible candidates for such carrier molecules are the yolk proteins, which have been shown to contain structural homology with the triacylglycerol binding site of vertebrate lipases (see reference 10 for a review).

Could DBI have other functions in D. melanogaster? One

question remains open: could DBI be a protein with a dual nature? Could it be on the one hand a housekeeping protein involved in the metabolism of acyl-CoA and on the other hand a protein with specific functions in certain cell types or under certain physiological or environmental conditions? (i) GABA receptor modulation. DBI

was discovered and

purified from the rat brain by its ability to displace diazepam from its central binding site, the GABAA receptor, and there is


VOL. 14, 1994

ample evidence of DBI's involvement in the modulation of the GABAA/benzodiazepine receptor complex (see reference 16 for a review). In insects, most GABA receptors described to date resemble the GABAA receptor subtype of vertebrates, nevertheless differing with respect to certain pharmacological characteristics, including those for benzodiazepines (see reference 58 for a review). In D. melanogaster, GABA receptors have been characterized (60) and cloned (21). We detected DBI in the larval and pupal central nervous system, while no staining was detected in the brain or ventral ganglion of adult flies. Our data suggest that DBI is more likely related to the energy-consuming events of cellular differentiation in developing brain than to the modulation of the GABAA receptor complex in D. melanogaster; otherwise, one would expect expression in adult brain as well. (ii) Steroidogenesis. In mammals, DBI is highly enriched in steroidogenic tissues such as the adrenal cortex and Leydig cells in the testes. It has been suggested that DBI is involved in steroidogenesis (8, 11, 52, 53, 76). In insects, the steroid hormone ecdysone plays a key role in morphogenetic changes associated with molting and metamorphosis. Ecdysone is a prohormone synthesized in the prothoracic gland and is converted by the target tissues into the active hormone 20hydroxyecdysone (molting hormone). DBI mRNA expression has been detected by PCR amplification in the prothoracic glands of the tobacco hornworm (70). In adult flies, ecdysone is produced by follicular cells surrounding the egg chambers. We observed DBI expression in the follicular cells and also certain cell types in the larval prothoracic gland. Whether DBI has a role in the steroidogenesis of D. melanogaster, for example by facilitating cholesterol delivery into the inner membrane of the mitochondria as has been shown in the case of mammalian mitochondria (76), remains to be investigated. (iii) Antibacterial defense. In mammals, DBI expression has also been shown in the epithelial cells of the digestive system (9, 14, 71). Recently one of the DBI metabolites (DBI33 87) was purified from the pig intestine on the basis of its antibacterial properties (1). In insects, short polypeptides called defensins have been shown to play an essential role in antibacterial defense (see references 28 and 29 for reviews). Promoters of defensin genes in

insects contain sequence motifs

resembling consensus sequences for transcription factor NFKB, a regulator of acute-phase and immune responses in mammals (see reference 38 for a review). NFKB consensus sites were also found in the promoter region of the Drosophila DBI gene. It could therefore be speculated that DBI expression in the Drosophila digestive system is related to antibacterial defense. However, all known defensins in insects are usually characterized by inducibility in response to infection or mechanical damage, and their expression is restricted to the fat body and certain blood cell types, while Drosophila DBI is normally expressed in other tissues as well. Nevertheless, the existence of antibacterial polypeptides with an expression pattern different from that in known defensins cannot be excluded. Also, there is no evidence of DBI being metabolized into shorter peptides in D. melanogaster. However, it is interesting that the putative Drosophila DBI3386 shows a homology to the porcine DBI3, 87 higher than the overall homology between Drosophila and porcine DBI. The possible involvement of DBI (or its processing products) in the immune reactions of D. melanogaster remains to be investigated. Conclusions. Our results clearly show that the DBI gene is expressed in a tissue-specific manner in D. melanogaster, although it possesses several features of the housekeeping genes. The Drosophila DBI protein sequence shows a high degree of identity with previously described DBI protein

6993

sequences from other species ranging from S. cerevisiae to mammals. The conservation of the amino acids involved in the binding of acyl-CoA and the expression of DBI in certain but not all tissues with high energy consumption suggest an involvement of DBI in a specific type of energy metabolism. We propose that the presence of DBI in a particular cell type reflects the use of fatty acids as a primary energy source in D. melanogaster. Other possible functions of DBI in the fruit fly remain to be investigated. ACKNOWLEDGMENTS We acknowledge the help of Lars Paulin (Institute of Biotechnology, University of Helsinki) with part of the sequencing and Tapio Heino (Departmnent of Genetics, University of Helsinki) with performing the polytene chromosome in situ hybridization, U.-M. Jukarainen for technical assistance, and Ismo Ulmanen (Orion Corporation, OrionPharmos, Helsinki, Finland) for critical reading of the manuscript. C.R. and M.T. thank Mart Saarma, the director of the Institute of Biotechnology (University of Helsinki), for encouraging support. We acknowledge the help of David Kivinen for language revision. M.K. and H.A. were financed by the Academy of Finland and the S. Juselius Foundation.

REFERENCES 1. Agerberth, B., A. Boman, H. Jornvall, V. Mutt, and H. G. Boman. 1993. Isolation of three antibacterial peptides from pig intestine:

gastric inhibitory polypeptide(7-42), diazepam-binding inhibitor(32-86) and a novel factor, peptide 3910. Eur. J. Biochem. 216:623-629.

la.Alho, H. Unpublished data. 2. Alho, H., E. Costa, P. Ferrero, M. Fujimoto, D. Cosenza-Murphy, and A. Guidotti. 1985. Diazepam-binding inhibitor: a neuropeptide located in selected neuronal populations of rat brain. Science 229:179-182. 3. Alho, H., R Fremeau, H. Tiedge, J. Wilcox, P. Bovolin, J. Brosius, J. Roberts, and E. Costa. 1988. Diazepam binding inhibitor gene expression: localization in brain and peripheral tissues of rat. Proc. Natl. Acad. Sci. USA 85:7018-7022. 4. Auffray, C., and F. Rougeon. 1980. Purification of mouse immunoglobulin heavy chain messenger RNAs from total myeloma tumor RNA. Eur. J. Biochem. 107:303-314. 5. Beenakkers, A. M. T., D. J. Van der Host, and W. J. A. Van MarrewiJk 1981. Role of lipids in energy metabolism, p. 53-100. In R. G. H. Downer (ed.) Energy metabolism in insects. Plenum Press, New York. 6. Borboni, P., L. Condorelli, P. De Stefanis, G. Sesti, and R. Lauro. 1991. Modulation of insulin secretion by diazepam binding inhibitor and its processing products. Neuropharmacology 30:13991403. 7. Borman, J. 1991. Electrophysiological characterization of diazepam binding inhibitor (DBI) on GABAA receptors. Neuropharmacology 30:1387-1389. 8. Boujrad, N., J. R Hudson, and V. Papadopoulos. 1993. Inhibition of hormone-stimulated steroidogenesis in cultured Leydig tumor cells by a cholesterol-linked phosphorothiolate oligodeoxynucleotide antisense to diazepam-binding inhibitor. Proc. Natl. Acad. Sci. USA 90:5728-5731. 9. Bovolin, P., J. Schlichting, M. Miyata, C. Ferrarese, A. Guidotti, and H. Alho. 1990. Distribution and characterization of diazepam binding inhibitor (DBI) in peripheral tissues of rat. Regul. Pept. 29:267-281. 10. gownes, M. 1992. Why is there sequence similarity between insect yolk proteins and vertebrate lipases. J. Lipid Res. 33:777-790. 11. Brown, A. S., and P. F. Hall. 1991. Stimulation by endozepine of the side-chain cleavage of cholesterol in a reconstituted enzyme system. Biochem. Biophys. Res. Commun. 180:609-614. 12. Buchman, A. R, W. Kimmerly, J. Rine, and R. D. Kornberg. 1988. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating se-

6994

13.

14.

15. 16. 17. 18. 19.

20.

21.

22. 23.

24.

25.

26.

27. 28. 29. 30.

31. 32.

KOLMER ET AL.

quences, and telomeres in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:210-225. Chadwick, L. E. 1947. The respiratory quotient of Drosophila in flight. Biol. Bull. Woods Hole 93:229-239. Chen, Z.-W., B. Agerberth, K. Gell, M. Andersson, V. Mutt, C.-G. Ostenson, S. Efendic, J. Barros-Soderling, B. Persson, and H. Jornvall. 1988. Isolation and characterization of porcine diazepam-binding inhibitor, a polypeptide not only of cerebral occurrence but also common in intestinal tissues and with effects on regulation of insulin release. Eur. J. Biochem. 174:239-245. Chino, H., R. G. H. Downer, and K. Takahashi. 1977. The role of diacylglycerol-carrying-lipoprotein I in lipid transport during insect vitellogenesis. Biochim. Biophys. Acta 487:508-516. Costa, E., and A. Guidotti. 1991. Minireview-diazepam binding inhibitor (DBI)-a peptide with multiple biological actions. Life Sci. 49:325-344. Dear, S., and R. A. Staden. 1991. A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res. 19:3907-3911. Devereux, J., P. Haeberli, and 0. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 10:387-395. Ferrero, P., A. Guidotti, B. Conti-Tronconi, and E. Costa. 1984. A brain octadecaneuropeptide generated by tryptic digestion of DBI (diazepam binding inhibitor) functions as a proconflict ligand of benzodiazepine recognition site. Neuropharmacology 23:13591362. Ferrero, P., M. Santi, B. Conti-Tronconi, E. Costa, and A. Guidotti. 1986. Study of an octadecaneuropeptide derived from diazepam binding inhibitor (DBI): biological activity and presence in rat brain. Proc. Natl. Acad. Sci. USA 83:827-831. ffrench-Constant, R. H., D. P. Mortlock, C. D. Shaffer, R. J. Maclntyre, and R. T. Roush. 1991. Molecular cloning and transformation of cyclodiene resistance in Drosophila: an invertebrate ,y-aminobutyric acid subtype A receptor locus. Proc. Natl. Acad. Sci. USA 88:7209-7213. Gardiner-Garden, M., and M. Frommer. 1987. CpG islands in vertebrate genomes. J. Mol. Biol. 196:261-282. Gray, P., D. Glaister, P. Seeburg, A. Guidotti, and E. Costa. 1986. Cloning and expression of cDNA for human diazepam binding inhibitor, a natural ligand of an allosteric regulatory site of the ,y-aminobutyric acid type A receptor. Proc. Natl. Acad. Sci. USA 83:7547-7551. Guidotti, A., C. Forchetti, M. Corda, D. Konkel, C. Bennett, and E. Costa. 1983. Isolation, characterization, and purification to homogeneity of an endogenous polypeptide with agonistic action on benzodiazepine receptors. Proc. Natl. Acad. Sci. USA 80:35313535. Haenlin, H., H. Steller, V. Pirrotta, and E. Mohier. 1985. A 43 kilobase cosmid P transposon rescues the fs(1)K1O morphogenetic locus and three adjacent Drosophila developmental mutants. Cell 40:827-837. Halfter, H., U. Muller, E.-L. Winnaker, and D. Gallwitz. 1989. Isolation and DNA-binding characteristics of a protein involved in transcription activation of two divergently transcribed, essential yeast genes. EMBO J. 8:3029-3037. Heino, T. 1994. Polytene chromosomes from ovarian pseudonurse cells of the Drosophila melanogaster otu mutant. II. Photographic map of the X-chromosome. Chromosoma 103:4-15. Hoffmann, J. A., and C. Hetru. 1992. Insect defensins: inducible antibacterial peptides. Immunol. Today 13:411-415. Hultmark, D. 1993. Immune reactions in Drosophila and other insects: a model for innate immunity. Trends Genet. 9:178-183. Janson, L., C. Bark, and U. Petterson. 1987. Identification of proteins interacting with the enhancer of human U2 small nuclear RNA genes. Nucleic Acids Res. 15:4997-5016. Kageyama, R., G. T. Merlino, and I. Pastan. 1989. Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box. J. Biol. Chem. 264:15508-15514. Keeley, L. L. 1985. Physiology and biochemistry of the fat body, p. 211-248. In G. A. Kerkut and L. I. Gilbert (ed.), Comprehensive insect physiology, biochemistry and pharmacology. Pergamon Press, New York.

MOL. CELL. BIOL.

33. King, R. C. 1970. Ovarian development in Drosophila melanogaster. Academic Press, New York. 34. Knudsen, J., P. H0jrup, H. 0. Hansen, H. F. Hansen, and P. Roepstorff. 1989. Acyl-CoA-binding protein in the rat. Biochem. J. 262:513-519. 35. Knudsen, J., S. Mandrup, J. T. Rasmussen, P. H. Andreasen, F. Poulsen, and K. Kristiansen. 1993. The function of acyl-CoAbinding protein (ACBP)/diazepam binding inhibitor (DBI). Mol. Cell. Biochem. 123:129-138. 36. Kolmer, M., H. Alho, E. Costa, and L. Pani. 1993. Cloning and tissue-specific functional characterization of the promoter of the rat diazepam binding inhibitor, a peptide with multiple biological actions. Proc. Natl. Acad. Sci. USA 90:8439-8443. 37. Kragelund, B. B., K. V. Andersen, J. C. Madsen, J. Knudsen, and F. M. Poulsen. 1993. Three-dimensional structure of the complex between acyl-coenzyme A binding protein and palmitoyl-coenzyme A. J. Mol. Biol. 230:1260-1277. 38. Leonardo, M. J., and D. Baltimore. 1989. NF-KB: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58: 227-229. 39. Malagon, M., M. Vallarino, M. C. Tonon, and H. Vaudry. 1992. Localization and characterization of diazepam-binding inhibitor (DBI)-like peptides in the brain and pituitary of the trout (Salmo gairdneri). Brain Res. 576:208-214. 40. Malagon, M., H. Vaudry, M. Vallarino, F. Gracia-Navarro, and M. C. Tonon. 1992. Distribution and characterization of endozepine-like immunoreactivity in the central nervous system of the frog Rana ridibunda. Peptides 13:99-107. 41. Mandrup, S., R. Hummel, S. Ravn, G. Jensen, P. H. Andreasen, N. Gregersen, J. Knudsen, and K. Kristiansen. 1992. Acyl-CoAbinding protein/diazepam binding inhibitor gene and pseudogenes. A typical housekeeping gene family. J. Mol. Biol. 228:101 11022. 42. Mandrup, S., R. Jepsen, H. Sk0tt, J. Rosendal, P. H0jrup, K. Kristiansen, and J. Knudsen. 1993. Effect of heterologous expression of acyl-CoA-binding protein on acyl-CoA level and composition in yeast. Biochem. J. 290:369-374. 43. Marquardt, H., G. Todaro, and M. Shoyab. 1986. Complete amino acid sequences of bovine and human endozepines. J. Biol. Chem. 261:9727-9731. 44. Mikkelsen, J., P. Hojrup, P. F. Nielsen, P. Roepstorff, and J. Knudsen. 1987. Amino acid sequence of acyl-CoA-binding protein from cow liver. Biochem. J. 245:857-861. 45. Mikkelsen, J., and J. Knudsen. 1987. Acyl-CoA-binding protein from cow. Biochem. J. 248:709-714. 46. Mocchetti, I., R. Einstein, and J. Brosius. 1986. Putative diazepam binding inhibitor peptide: cDNA clones from rat. Proc. Natl. Acad. Sci. USA 83:7221-7225. 47. Mogensen, I. B., H. Schulenberg, H. 0. Hansen, F. Spener, and J. Knudsen. 1987. A novel acyl-CoA-binding protein from bovine liver. Biochem. J. 241:189-192. 48. Myohanen, S., and J. Wahlfors. 1993. Automated fluorescent primer extension. BioTechniques 14:16-17. 49. Olasmaa, M., A. Guidotti, E. Costa, J. Rothstein, M. Goldman, R. Weber, and S. Paul. 1989. Endogenous benzodiazepines in hepatic encephalopathy. Lancet i:491-492. 50. Olasmaa, M., J. Rothstein, A. Guidotti, R. Weber, S. Paul, S. Spector, M. Zeneroli, M. Baraldi, and E. Costa. 1990. Endogenous benzodiazepine receptor ligands in human and animal hepatic encephalopathy. J. Neurochem. 55:2015-2023. 50a.0stenson, C.-G., B. Ahren, S. Karlsson, E. Sandberg, and S. Efendic. 1990. Effects of porcine diazepam-binding inhibitor on insulin and glucagon secretion in vitro from the rat endocrine pancreas. Regul. Pept. 29:143-151. 51. Owens, G., A. Sinha, J. Sikela, and W. Hahn. 1989. Sequence and expression of the murine diazepam binding inhibitor. Mol. Brain Res. 6:101-108. 52. Papadopoulos, V., A. Berkovich, K. E. Krueger, E. Costa, and A. Guidotti. 1991. Diazepam binding inhibitor and its processing products stimulate mitochondrial steroid biosynthesis via an interaction with mitochondrial benzodiazepine receptors. Endocrinology 129:1481-1488. 53. Papadopoulos, V., P. Guarneri, K. E. Krueger, A. Guidotti, and E.

VOL. 14, 1994

54.

55.

56.

57.

58. 59.

60.

61.

62. 63. 64.

65.

Costa. 1992. Pregnenolone biosynthesis in C6-2B glioma cell mitochondria: regulation by a mitochondrial diazepam binding inhibitor receptor. Proc. Natl. Acad. Sci. USA 89:5113-5117. Podkletnova, I., and H. Alho. 1993. Ultrasound-amplified immunohistochemistry. J. Histochem. Cytochem. 41:51-56. Poole, S., L. M. Kauvar, B. Drees, and T. Kornberg. 1985. The engrailed locus of the Drosophila: structural analysis of an embryonic transcript. Cell 40:37-43. Rasmussen, J. T., N. J. Fergeman, K. Kristiansen, and J. Knudsen. 1994. Acyl-CoA-binding protein (ACBP) can mediate intermembrane acyl-CoA transport and donate acyl-CoA for 13-oxidation and glycerolipid synthesis. Biochem. J. 299:165-170. Rasmussen, J. T., J. Rosendal, and J. Knudsen. 1993. Interaction of acyl-CoA-binding protein (ACBP) on processes for which acyl-CoA is a substrate, product or inhibitor. Biochem. J. 292:907913. Rauh, J. J., S. C. R. Lummis, and D. B. Sattelle. 1990. Pharmacological and biochemical properties of insect GABA receptors. Trends Pharmacol. Sci. 11:325-329. Rheaume, E., M.-C. Tonon, F. Smith, J. Simard, L. Desy, H. Vaudry, and G. Pelletier. 1990. Localization of the endogenous benzodiazepine ligand octadecaneuropeptide in the rat testis. Endocrinology 127:1986-1994. Rosario, P., A. Barat, and G. Ramirez. 1989. Characterization of binding sites for [3H]GABA in Drosophila melanogaster CNS membranes. Neurochem. Int. 15:115-120. Rose, T. M., E. R. Schultz, and G. J. Todaro. 1992. Molecular cloning of the gene for the yeast homolog (ACB) of diazepam binding inhibitor/endozepine/acyl-CoA-binding protein. Proc. Natl. Acad. Sci. USA 89:11827-11291. Roy, A. 1991. Cerebrospinal fluid diazepam binding inhibitor in depressed patients and normal controls. Neuropharmacology 30: 1441-1444. Roy, A., J. Dejong, D. Lamparski, T. George, and M. Linnoila. 1991. Depression among alcoholics-relationship to clinical and cerebrospinal fluid variables. Arch. Gen. Psychiatry 48:428-432. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467.


6995

66. Schuller, H.-J., A. Hahn, F. Troster, A. Schutz, and E. Schweizer. 1992. Coordinate genetic control of yeast fatty acid synthase genes FASI and FAS2 by an upstream activation site common to genes involved in membrane lipid biosynthesis. EMBO J. 11:107-114. 67. Schultz, R., M. Pelto-Huikko, and H. Alho. 1992. Expression of diazepam binding inhibitor-like immunoreactivity in rat testis is dependent on pituitary hormones. Endocrinology 130:3200-3206. 67a.Serano, T., and R Cohen. Personal communication. 68. Shoyab, M., L Gentry, H. Marquardt, and J. Todaro. 1986. Isolation and characterization of a putative endogenous benzodiazepineoid (endozepine) from bovine and human brain. J. Biol. Chem. 261:11968-11973. 69. Slobodyansky, E., A. Guidotti, C. Wambebe, A. Berkovich, and E. Costa. 1989. Isolation and characterization of a rat brain triakontatetraneuropeptide, a posttranslational product of diazepam binding inhibitor: specific action at the Ro 5-4864 recognition site. J. Neurochem. 53:1276-1284. 70. Snyder, M. J., and R. Feyereisen. 1993. A diazepam binding inhibitor (DBI) homolog from the tobacco hornworm Manduca sexta. Mol. Cell. Endocrinol. 94:R1-R4. 71. Steyaert, H., M. C. Tonon, Y. A. Tong, F. Smihrouet, J. Testart, G. Pelletier, and H. Vaudry. 1991. Distribution and characterization of endogenous benzodiazepine receptor ligand (endozepine)-like peptides in the rat gastrointestinal tract. Endocrinology 129:21012109. 72. Suter, B., and R Steward. 1991. Requirement for phosphorylation and localization of the bicaudal-D protein in Drosophila oocyte differentiation. Cell 67:917-926. 73. Tautz, D., and C. Pfeifle. 1989. A nonradioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98:81-85. 74. Todaro, G. J., T. M. Rose, and M. Shoyab. 1991. Human DBI (endozepine): relationship to a homologous membrane associated protein (MA-DBI). Neuropharmacology 30:1373-1380. 75. Webb, N. R, T. M. Rose, N. Malik, H. Marquardt, M. Shoyab, and G. J. Todaro. 1987. Bovine and human cDNA sequences encoding a putative benzodiazepine receptor ligand. DNA 6:71-79. 76. Yanagibashi, K., Y. Ohno, M. Kawamura, and P. F. Hall. 1988. The regulation of intracellular transport of cholesterol in bovine adrenal cells: purification of a novel protein. Endocrinology 123:2075-2082.