Brief notes Table 1 Results for genes assigned to porcine chromosome 1 (SSC1).
Gene symbol
GenBank accession no.1
Forward primer (5¢ fi 3¢)
Reverse primer (5¢ fi 3¢)
Amplicon size (bp)
Map2
SMPDL3A RPL24 NTRK3 TMEM2 CREB3 AMBP PAPPA PTGS1 CIZ1 SLC27A4 GFI1B AGPAT2
DQ092608 BV102946 BV103067 DQ092607 BV103209 BV103453 DQ092606 DQ092609 BV103601 BV103614 DQ092610 BV102613
tgtataaatgacaatttcaacaagag cagtttcagcgggtacaaga ctctattgcatcagtgccga gtgggggatacagtgctaagtc cagaatctggagctacagaac aagaggaaggatcaggagctg cagtgccctgaatcacaactac ctttcttccacttcctgctgac aaaggctcggagacctacagtc gctggtccgtgtcaacgaggac ggaccaggtcctgagcaacagc acgtgggcgagcgcatg
ccagtgtaacttgtgatgagaca gagcagaaaccttcacaggc gtccagtgacgatccagtcc ttcctacagaaacggcaaactt accaagatgcaggtgctgctg tccttctccgagacgaagttat cgttcatagttgcagtccatgt gccgcatctgcaacctacacca tgatggcacaccggcggctcac gtccttctggacgatggtgccc gtgagtcggaagatggcgagtc cgtgctgatgccagaagggagt
450 400 850 500 1000 1200 600 360 800 850 700 150
L R,L R R L L L R,L R R,L R R
Human position3 6:123 9:70 15:83 9:72 9:36 9:112 9:116 9:121 9:126 9:127 9:131 9:135
Most significant marker
2-pt LOD
SSC1 position (cM)4
SW2130 SW781 SW1431 S0155 SW1092 S0354 SW1957 S0112 SW705 S0056 SSC10D08 SSC10D08
11.35 32.21 8.90 7.67 27.29 31.71 18.66 21.97 7.59 8.13 11.64 9.92
48 56 82 94 96 107 110 121 122 125 136 136
1
GenBank accession numbers refer to sequences obtained during the study and the single nucleotide polymorphisms are identified in those entries. Markers placed on the INRA-University of Minnesota porcine radiation hybrid7000 radiation hybrid map are designated with an R and those assigned on the Meat Animal Research Center (MARC) linkage map with an L. 3 Chromosome:megabase position. 4 Marker positions mapped on the radiation hybrid panel are estimated from microsatellite positions on the MARC linkage map. 2
Acknowledgements: The authors thank Bree Quigley, Sue
Hauver, Kris Simmerman and Linda Flathman for expert technical assistance and Sherry Kluver for manuscript preparation. Mention of trade names or commercial products is solely for the purpose of providing information and does not imply recommendation, endorsement or exclusion of other suitable products by the US Department of Agriculture. References 1 Yerle M. et al. (1998) Cytogenet Cell Genet 82, 182–6. 2 Rohrer G. A. et al. (1996) Genome Res 6, 371–91. 3 Rohrer G. A. (2000) J Anim Sci 78, 2547–53. 4 Bidanel J. P. et al. (2001) Genet Sel Evol 33, 289–309. 5 Cassady J. P. et al. (2001) J Anim Sci 79, 623–33. 6 Rohrer G. A. et al. (1999) J Anim Sci 77, 1385–91. 7 Goureau A. et al. (1996) Genomics 36, 252–62. 8 Mikawa S. et al. (2004) Anim Genet 35, 445–50. 9 Rink A. et al. (2002) Mamm Genome 13, 578–87. Correspondence: D. Nonneman (
[email protected]. usda.gov)
doi:10.1111/j.1365-2052.2005.01383.x
TLR4 variation in Yellowstone bison S. N. White*, N. D. Halbert†, K. H. Taylor‡, J. N. Derr and J. E. Womack Department of Veterinary Pathobiology, Texas A&M University, College Station, TX 77843, USA *Present Address: US Meat Animal Research Center, USDA, ARS, Clay Center, NE 68933, USA.
†
Present Address: Department of Large Animal Medicine and Surgery, Texas A&M University, College Station, TX 77843, USA. ‡ Present Address: Department of Pathology and Anatomical Sciences, University of Missouri, Columbia, MO 65212, USA. Accepted for publication 28 August 2005
Source/description: Toll-like receptor 4 (TLR4) is a cell-surface receptor that activates innate and adaptive immune responses. Because it recognizes a broad class of pathogenassociated molecular patterns, including lipopolysaccharides, TLR4 is a candidate gene for resistance to a large number of pathogens. Important examples are Gramnegative Salmonella,1 Pasteurella,2 and Brucella, as well as Mycobacteria,3 which include the causative agents of tuberculosis and Johne’s disease. Primer sequences: Primer sets originally designed for cattle TLR44 were used to amplify and sequence bison TLR4, with the exception of one substitute forward primer (5¢-CATTTTGGTTTCCTATTCAGCAG-3¢) that was used to sequence the 5¢-end of exon 3. Samples and sequencing: Genomic DNA samples were obtained from seven bison that wandered from Yellowstone National Park in different years and/or localities to minimize the possibility of sampling closely related individuals. Additionally, a portion of TLR4 exon 3 was sequenced in 28 Yellowstone bison collected in 2002 to better estimate allele frequencies for two single nucleotide polymorphisms (SNPs). Each exon was amplified twice for every individual. The separate replicates of each polymerase chain reaction (PCR) were used for sequencing in the forward and reverse directions, respectively, so as to reduce the risk of reporting
2005 The Authors, Journal Compilation 2005 International Society for Animal Genetics, Animal Genetics, 36, 511–542
533
534
Brief notes Table 1 Bison bison TLR4 single nucleotide polymorphism (SNP) summary data. SNP position (common/rare allele)
Adjacent sequence
SNP type
Rare allele frequency among observed chromosomes (%)
Bos taurus reference allele
E1–50 (T/C) E1–24(C/A) 561(A/C) 800 (A/G) 2424(C/T) 2502(G/C)
CTGGCACAGA[T/C]AGAGGGTCAT CACAGAGCCA[C/A]TTCTGGTCAC ACAACAAAAT[A/C]CAAAATATTT AAAAATGAAA[A/G]GAAGTTGCAA GGCATGTCTT[C/T]TGGAGAAGAC AAACCAACCC[G/C]CAAGAAGCGA
Non-coding Non-coding Silent K267R Silent Silent
C 1/14 (7.1) A 1/14 (7.1) C 28/70 (40.0) G 28/70 (40.0) T 1/14 (7.1) C 1/14 (7.1)
C C C G (R) C G
Putative ligand-binding region
TIR domain
Figure 1 Locations of bison TLR4 SNPs by domain. Positions of SNPs are marked by arrows. A nonsynonymous SNP (K267R) is marked by an asterisk under the arrow. Domains shown left to right, with included amino acid residues4: signal sequence (1–23), putative co-receptor binding region (24– 273), putative ligand-binding domain (274–368), putative coreceptor-binding region 2 (369–632), transmembrane region (633-653), proximal cytoplasmic region (654–672), Toll/IL-1 receptor (TIR) domain (673–819), and distal cytoplasmic region (820–841).
PCR artifacts as polymorphisms. PCR and sequencing were performed using protocols described elsewhere.4 Sequence, polymorphisms and allele frequencies: Bison TLR4 has a genomic structure similar to cattle, with exon 1 including coding 1–93 base pairs (bp), exon 2 94–260 bp and exon 3 261–2526 bp. Sequence for each exon, along with flanking sequences, was submitted to GenBank (accession nos AY994161–AY994163). Six segregating SNPs were observed in bison TLR4 (Table 1; dbSNP accession nos 21784720–21784725). These SNPs were named relative to coding positions in the predicted mRNA sequence, which is highly similar to the cattle sequence (GenBank accession no. AY297040). Two SNPs were observed in the 5¢-untranslated region, and four were found in exon 3 (Fig. 1). The only observed non-synonymous SNP, 800(A/G), resulted in the replacement of lysine with arginine at position 267 of the predicted amino acid sequence. Observed frequencies in this sample indicate that non-synonymous SNP 800(A/G) and silent SNP 561(A/C) occur at high frequency in the Yellowstone bison population (40.0%), while all other SNPs appear to be lower frequency variants (Table 1). Comments: These are the first reported sequences of bison TLR4. At each of 29 SNPs segregating in cattle TLR4,4 bison have alleles present in indicine cattle and appear to be fixed for indicine-specific cattle alleles at nine of these SNP sites. A synonymous substitution at coding position
1603 in exon 3 appears to be the only fixed difference between bison and indicine cattle TLR4. These results confirm the existence of a closer evolutionary link for bison to indicine cattle than to taurine cattle.5 The only non-synonymous SNP observed in bison TLR4 is segregating at a relatively high frequency (Table 1), and in the corresponding amino acid sequence, it is positioned in the extracellular domain near the putative ligand-binding domain4 (Fig. 1). This K267R SNP, as well as the other polymorphisms, will be valuable markers for future disease-association studies in bison. Acknowledgements: The authors thank Stephanie Krenek, Jan Elliott, Elaine Owens and Christie Fickey for technical assistance. We also thank Drs Bhanu Chowdhary, Terje Raudsepp and Avni Santani for helpful discussions and studies underpinning our work. We gratefully acknowledge the support of the US National Park Service and the US Department of the Interior (JND). References 1 O’Brien A. D. et al. (1980) J Immunol 124, 20–4. 2 Chapes S. K. et al. (2001) J Leukoc Biol 69, 381–6. 3 Abel B. et al. (2002) J Immunol 169, 3155–62. 4 White S. N. et al. (2003) Proc Natl Acad Sci USA 100, 10364–9. 5 MacHugh D. E. et al. (1997) Genetics 146, 1071–86. Correspondence: James E. Womack (
[email protected])
2005 The Authors, Journal Compilation 2005 International Society for Animal Genetics, Animal Genetics, 36, 511–542
