Transcription of a Bacteriophage X DNA Site Blocks Growth of ...

JOURNAL OF BACTERIOLOGY, Feb. 1990, p. 1030-1034 0021-9193/90/021030-05$02.00/0 Copyright C) 1990, American Society for Microbiology

Vol. 172, No. 2

Transcription of a Bacteriophage X DNA Site Blocks Growth of Escherichia coli PLINIO GUZMAN,lt BLANCA E. RIVERA CHAVIRA,1 DONALD L. COURT,2 MAX E. GOTTESMAN,3 AND GABRIEL GUARNEROSl* Centro de Investigaci6n y de Estudios Avanzados del IPN, Apartado Postal 14-740 Mexico D.F. 07000, Mexico'; Laboratory of Chromosome Biology, BRI-Basic Research Program, National Cancer Institute-Frederick Cancer Research Facility, Frederick, Maryland 217012; and Institute of Cancer Research, Columbia University, New York, New York 100323 Received 7 August 1989/Accepted 11 November 1989

The rap mutation in Escherichia coli prevents the growth of bacteriophage X. Phage mutations that overcome inhibition (bar) have been mapped to loci in the PL operon. We cloned and sequenced three mutations in two of these loci: barla to the left arm of the X attachment site (attP) and barll in the ssb (ealO) gene. The mutations represent single base-pair changes within nearly identical 16-base-pair DNA segments. Each mutation disrupts a sequence of dyad symmetry within the segment. Plasmids carrying a bar' sequence downstream to an active promoter are lethal to rap, but not rap+, bacteria. The bar sequences isolated from the X bar mutants are not lethal. We synthesized a minimal A barIa+ sequence, 5'-TATATTGATATTTATAT CATT, and cloned it downstream to an inducible promoter. When transcribed, this sequence is sufficient to kill a rap strain.

rap

Bacteriophages, like all viruses, utilize host proteins in their own development. By isolating host mutants defective for the growth of phage, i.e., phage-resistant mutants, not only have many host-virus interactions been defined, but important Escherichia coli functions have also been detected. E. coli mutations conferring X resistance have implicated genes involved in host DNA replication, transcription termination and antitermination, and recombination (6). In this report, we describe a X-resistant E. coli mutant that appears to be affected in mRNA translation. The E. coli rap mutation prevents the growth of bacteriophage K (9). The rap locus is tightly linked to the pth gene at min 26 of the E. coli map and may be identical to it (7; D. Perez-Morga and G. Guarneros, submitted for publication). Peptidyl-tRNA-hydrolase, the enzyme encoded by pth, is essential for protein synthesis (2). Phage A mutations (named bar) that permit A growth on rap strains have been isolated and mapped genetically to three loci in the k genome: barn at the k attachment site attP; barIl in the cIII-ssb region; barIII within, or very near to the right of, the imm434 substitution region (8). The left boundary of barn has been located by deletion mapping within a 90-base-pair (bp) (coordinate 27641) segment to the left of the central base of the attP common core (position zero; A coordinate 27731); some aspect of barn extends at least 40 bp to the right of this core nucleotide (coordinate 27772) (8). Similarly, int-promoted att site recombinants which lack K DNA adjacent to either side of the core are Bar- (9). We refer to the bar sequences which lie to the left of the core as barla and those to the right as barIb. The barII region lies, at least in part, within a 254-bp DNA segment bound by the Sall (K coordinate 33244) and XhoI (A coordinate 33498) restriction sites in the cIII-ssb region (5-8). The magnitude of transcription through barn and barlI

correlates with the degree of Rap inhibition. For example, phage K mutants defective in the PL promoter or in antitermination of the PL transcript exhibit a Bar- phenotype. In contrast, constitutive leftward transcription from the PL or PI promoters produces a more severe inhibition of phage growth on rap strains (8). To determine whether expression of the K bar sequences inhibited host metabolism as well as phage development, we constructed plasmid clones in which bar DNA segments were inserted downstream to an active promoter. These constructs also permitted us to analyze the DNA sequence of barIa and barIl point mutations and to define the minimal barIa functional sequence. This report presents the results of these experiments. MATERIALS AND METHODS Bacteria and phage. The E. coli K-12 strains used here were C600 (thr-l leuB6 thi-i lacYl supE44 tonA21) (1); DH173, a rap lacYJ4(Am) derivative of C600 (9); and N5960 (SA500 his ilv lacZXA2J [K (int-cIII)ABAM Nam7 Nam53 c1857 (cro-bio-uvrB)AHI] cysH::TnS). The rap derivatives of C600 and N5960 were made by P1 cotransduction of rap and zch: :TnJO (7). Phage were X lacW205 redll4 imm434 (A bar') and its derivatives barIlOl barI102, barI103 and barII205

(8). General procedures. Plasmid and phage DNA extraction, transformation, DNA electrophoresis, restriction analysis, and cloning procedures were by conventional methods (12). For bacterial growth, Luria broth (LB), L-agar, and the same media containing ampicillin (Amp) (50 ,ug/ml) or tetracycline (Tet) (12.5 ,ug/ml) were used (7). To cross bar mutations onto A from plasmid clones, K lysates were made on C600 carrying either the barI (pPG100, pPG101, pPG102, or pPG103) or barIl (pPG200C or pPG205C) plasmids (8). C600 was then infected with phage from the lysate, and Ampr lysogens were selected to isolate the barn and barIl recombinant phasmids (phage-plasmid recombinants). These Ampr lysogens were induced with

* Corresponding author. t Present address: Department of Biology, Plant Sciences Insti-

tute, University of Pennsylvania, Philadelphia, PA 19104-6076.

1030

A X TRANSCRIPT BLOCKS E. COLI GROWTH

VOL. 172, 1990

bcff

o,b

35

3

f200 Rc

ohtP int pi II

1031

cZ ssb

at

\

/~~~ IH

205C

DA D

B

s

x

IC

c

B

II

fi010 Oil

H

200c

ATATATTGATATTTATATCATTTTAC

jo/

A7

P.oI

H1 \5ll

R

700

I

FIG. 1. Plasmid constructions harboring barl and barll regions. The plasmids (not drawn to scale) were constructed as described in Materials and Methods. Only relevant regions are marked. Symbols: O, segments containing pgal or PL promoter regions; *, barI or barIl regions. The clockwise arrows near the promoters indicate the direction of transcription. The counterclockwise arrow indicates the size and direction of the transcripts for 1-lactamase. Abbreviations for the endonuclease restriction sites: E, EcoRI; H, Hindlll; B, BamHI; C, ClaI; S, Sal:; P, PstI; R, EcoRV.

mitomycin C at 5 p,g/ml, and the number of Bar- phage in the induced lysates was scored by determining the efficiency of plating on DH173 as normalized to that on C600. Plasmid construction. The plasmids used in this report and their relevant markers and restriction sites are diagrammed in Fig. 1. pPG100, pPG101, pPG102, and pPG103 were constructed by cloning the HindIII-BamHI attP fragment from XA, K barIlOl, X barI102, and k barI103 DNAs, respectively (Fig. 2), between the HindIII and BamHI sites of pBR322 (3). The 130-bp DdeI-DdeI fragments from pPG100 and pPG101 containing the barla regions (Fig. 2) were repaired with Klenow enzyme and cloned to the SmaI site of the promoter probe vehicle pKO1 (14) to generate pPGO10 and pPGO11, respectively. Constructions pPG110 and pPG111, in which barla transcription is under OLPL operator-promoter control, were obtained by cloning the HindIII-EcoRV fragments harboring the barla regions from pPGO10 and pPGO11 between the Hindlll and EcoRV sites of the OLPL vector pDH520 (a gift from R. Weisberg, National Institutes of Health, Bethesda, Md.). pPG200 and pPG205 were created by ligating the barll 1,255-bp SallBamHI restriction fragment from K bar' or k barII205 (Fig. 2) into the BamHI and Sall sites of pBR322. Elimination of the fragments flanked by the ClaI sites in pPG200 and pPG205 yielded plasmids pPG200C and pPG205C, respectively. In pPG230 and pPG235, the E. coli pgal promoter controls the barII+ and barII205 regions, respectively. These plasmids were pieced together from the EcoRIEcoRV pgal fragment of pKG1800 (14) and the EcoRI-

baIOl

I.

CGGCCTTGATAGTCATATCATCTGAA bor205

FIG. 2. Location of barl and barlI regions in the A map and nucleotide sequence of bar mutations. The double line (top) shows a segment of DNA with various A genetic markers. The scale on the top line represents distance in kilobases starting at the left cohesive end of the molecule (5). The vertical broken line indicates the center of the core of attP which divides barl into a and b. An expansion of the barl and barIl regions (middle) shows the restriction sites used for subcloning. The positions of the sites in the A DNA sequence for the barI fragment are Hindlll (H), 27479; DdeI (D), 27605 and 27735; AluI (A), 27479 (not shown) (and 27724; and BamHI (B), 27972. The positions of the sites in the DNA sequence for the barll fragment are Sall (S), 33244; XhoI (X), 33498; ClaI (C), 33585; EcoRV (R), 33591 (not shown); and BamHI (B), 34499. The changes in the sequence determined for the barl and barll mutants (see Materials and Methods) are indicated (bottom). The positions of the bar mutations are barIlOl and barI102, 27703; barI103, 27699; and barII205, 33556. Homologous nucleotides in barl and barll sequences are marked in boldface. The convergent arrows indicate regions of dyad symmetry.

EcoRV barlI fragments of pPG200 or pPG205. pPG510 and pPG511 harbor the pgal promoter upstream to the X barl regions; pPG510 and pPG511 were constructed by ligation of the pgal EcoRI-HindlIl fragment of pKG1800 and the barla EcoRI-Hindlll fragments of pPGO10 and pPGO11, respectively. The four wild-type and mutant combinations (see Table 2) of barla and barlI in the various pPG700s were generated from the barIl EcoRI-EcoRV fragments of pPG200 and the pgal-barla EcoRI-EcoRV fragments of pPG510. Delimitation of the barla region. Plasmid pPG110 DNA (Fig. 1) was restricted at the HindIII site between the PL promoter and the barla regions and was digested for variable periods of time with Bal 31 exonuclease (11). The resected DNA was repaired with the Klenow fragment of DNA polymerase I, and the HindIII site was replaced by ligation with a synthetic linker. To obtain plasmids with intact OLPL regions, but with deletions in the barla region, HindIII-PstI fragments resected in the barla direction were ligated to the PstI-HindIII promoter fragment from untreated pPG110 DNA. Plasmids which carry X barla region sequences cloned downstream to PL were constructed by direct ligation of synthetic single-stranded oligonucleotides to pDH520 DNA cleaved with HindIII and SphI restriction endonucleases (16). These sites are downstream to the OLPL region in the plasmid. The large fragment of pDH520 (4,333 bp), which harbors the OLPL region, was ligated to single-stranded phosphorylated oligonucleotides flanked by four-nucleotidelong sequences complementary to the HindIII and SphI protruding ends (The Midland Certified Reagent Co., Midland, Tex.). The orientation of the cloned barla sequences in

1032

GUZMAN ET AL.

the synthetic oligonucleotides relative to PL was the same as that of the natural barIa region to PL in the X genome. The deletion and synthetic oligonucleotide plasmids were transformed into a rap derivative of strain N5960 at 32°C and 42°C. Plasmid constructs which remain Bar+ reduce transformant recovery on LB-Amp agar medium at least 1,000fold at 42°C relative to that obtained at 32°C. Bar- plasmids did not affect transformant viability under these conditions. DNA sequence analysis. The DdeI-AluI restriction fragments containing the barla region (Fig. 2) from X barIlo0, A barI102, A barI103, and wild-type phage were sequenced by the chemical modification procedure (13). The barll region was directly sequenced on DNAs from pPG200C and pPG205C by the chain termination procedure with the EcoRI primer for pBR322 (New England BioLabs, Inc., Beverly, Mass.) (18). Sequence analyses of the barla deletions generated on pPG110 and the barIa reconstruction plasmids obtained from synthetic oligonucleotides were also done by the chain termination procedure on the plasmid DNAs with a synthetic primer complementary to the A PL region sequence (The Midland Certified Reagent Co.). RESULTS DNA sequence of the barl and barIl mutations. Data obtained from phage-by-phage (or phage-by-X DNA fragment) crosses (8) suggested that the phage A (HindIIIBamHI) attP fragment and the (SalI-CIaI) cIII-ssb fragment contained the banI and barll regions, respectively (Fig. 2). To confirm this mapping, marker rescue experiments were performed with a set of bar plasmid constructs. Strain C600 was transformed with pPG101, pPG102, or pPG103, which carry attP fragments from k barI mutants, or with pPG205C, which carries the cIII-ssb fragment from A barII205. The transformants were infected with A bar+ phage, and the lysates were plated on rap+ or rap hosts. The frequency of A bar mutant phage in lysates from bar mutant plasmid strains was approximately 1,000-fold higher than the frequency (approximately 3 x 10-5) in phage lysates grown on strains bearing barI+ (pPG100) or barII+ (pPG200C) wildtype plasmids (data not shown). These results confirm the location of the bar mutations in the cloned fragments. Previous experiments placed the barla region within 90 bp to the left of nucleotide 0 of attP (8). The 130-bp DdeI(- 125)DdeI(+4) DNA restriction fragment (Fig. 2, middle), which includes the barIa region, was isolated from each of the three barI mutants. The 380-bp SaIl-ClaI fragment (Fig. 2, middle) from A barII205 was also isolated. The nucleotide sequences of all four clones were determined (see Materials and Methods). Each mutation was found to be a single base-pair transition (Fig. 2, bottom). Mutations barIlOl and barI102 are identical C-to-T transitions at nucleotide -27 (A coordinate 27703), barI103 is an A-to-G transition at nucleotide -31 (A coordinate 27699), and barII205 is a T-to-C transition at A coordinate 33556. Comparison of the nucleotide sequences at the sites of the barn and barll mutations revealed nearly identical 16-bp tracts, which include inverted repeats (Fig. 2, bottom). The barla 16-bp sequence partly overlaps the integration host factor binding site, H2, at attP (4). The barll 16-bp tract is located near the 3' end of the ssb coding sequence. Exclusion of bar plasmids by rap bacteria. The exclusion of A on rap bacteria depends on transcription of the A bar regions (8). To test whether other replicons that express bar might likewise be excluded, we constructed pBR322 derivative plasmids containing the barla region placed down-

J. BACTERIOL. TABLE 1. Transformation of E. coli rap with bar plasmids Plasmid

Promoter

barla region

Transformationa

pPGO10 pPGO11 pPG510 pPG511

None None

+ +

pgal pgal

Wild type barIlOl Wild type barIlOl

pMSBc

pgal pgal

Wild type Wild type

pUS6b

+

+

a Competent C600 rap bacteria were transformed with 50 to 200 ng of plasmid DNA prepared in C600 rap' cells. The transformed cells were plated on LB-Amp agar medium at 37°C. Symbols: +, about 104 transformants per microgram of DNA; -, about 10 transformants per microgram of DNA. b pUS6 (17) is a pKG1800 derivative which harbors the AIuI-AluI fragment containing barla in the same orientation as it is transcribed in X. pMSB carries the AluI fragment inserted in the opposite orientation (15). Thus, pMSB is identical to pUS6 except for the orientation of the X DNA insert.

stream of the constitutive pgal promoter (Fig. 1). These plasmids were tested for their ability to transform rap bacteria (Table 1). Plasmids pPG510 and pUS6, which express barIa, could not be propagated in rap hosts. The exclusion of plasmids harboring barla was limited to rap mutant hosts (data not shown) and required the expression of the barla segment. Plasmids pPGO10, which does not contain the pgal promoter, and pMSB, which carries barla in an inverted orientation relative to pgal, could be transformed readily into rap bacteria. Plasmid pPG511, which expresses the barIlOl mutant sequence, was not excluded in rap strains. Analogous results were obtained with the barll derivative plasmids (data not shown). These results suggest that plasmids that express bar cannot be established in rap bacteria. In X, inactivation of either barn or barIl regions permits phage growth in rap bacteria (8). This result contrasts with the plasmid experiments just described, where the expression of a single bar region blocks plasmid maintenance. This point is further demonstrated in the results (Table 2) of the following experiments. We constructed a plasmid which expressed both the barla and barlI regions from the pgal promoter (pPG700; Fig. 1). As expected, pPG700 could not be transformed into the rap strain. Derivatives of pPG700 carrying the barIlOl or the barII205 mutation were also excluded. Only inactivation of both bar loci permitted transformation of the rap mutant. Kinetics of cell killing by bar. To investigate the mechanism of bar exclusion, we constructed a plasmid in which the expression of bar could be controlled. In plasmid pPG110, the barIa region is cloned downstream to the A PL promoter (Fig. 1). This plasmid was introduced into defective X c1857 lysogens at 32°C. At 32°C, PL is repressed; shifting the TABLE 2. Transformation of E. coli rap with plasmids which harbor barn and barIl bar alleles

Plasmid

pPG700

pPG702 pPG710 pPG712

barla

barll

Wild type Wild type 101 101

Wild type 205 Wild type 205

Transformationa

+

a Plasmid DNA (Fig. 1) harboring the indicated combinations of barI+, barIlOl, barII+, and barII205 regions under pgal control was transformed into C600 rap mutants, and the result was scored as described in the footnotes to Table 1.

A A TRANSCRIPT BLOCKS E. COLI GROWTH

VOL. 172, 1990

the transformants survived 30 min of induction. Strains carrying the barIlOl sequence were unaffected by thermal induction (Fig. 3), as were rap' strains harboring plasmid pPG110 (data not shown). In the absence of ampicillin selection, plasmid-cured cells present in the culture prior to induction eventually predominated (Fig. 3). These results are entirely consistent with those for the pgal-bar fusion plasmids and indicate additionally that transcription of bar is bacteriocidal in rap hosts. Demarcation of the barla region. The right boundary of the K barla region was delineated by in vitro DNA resection from the Hindlll site in pPG110 (Fig. 1). A set of PL plasmids carrying a nested set of barla deletions was generated and maintained in rap' bacteria. To score for the Bar phenotype, each plasmid was then transformed into A c1857 rap lysogens at 32°C or 42°C. The results (Fig. 4, top) show that all deletions entering the A DNA from the Hindlll site to position -20 relative to common core nucleotide 0 were Bar'. Deletions removing DNA through position -24 and beyond were Bar-. The right limit of barIa thus lies between positions -20 and -25; no A DNA sequences to the right of position -20 are essential for plasmid exclusion. We proceeded to define further the minimal functional barla region. Oligonucleotides containing varying lengths of barla sequence were synthesized and inserted downstream to PL in vector pDH520. The synthetic barla constructs were introduced into A c1857 rap lysogens at 32°C and were tested for their Bar phenotype at 42°C. Clones carrying barIa DNA from positions -20 to -31 (pRC200), positions -20 to -33 (pRC220), and positions -20 to -40 (pRC291) were all Bar(Fig. 4). Note that pRC291 carries the 16-bp sequence homologous to barII. However, a clone harboring barIa DNA from nucleotides -24 to -44 (pRC290) was Bar'. Our reconstruction results define the left boundary of the barla region between positions -44 and -41 and locate the right end at position -24.

\

E109 N%

4..

0

=m-

0

0

30

60

90

Induction, min FIG. 3. Time course of rap cell viability after induction of PL transcription on bar plasmids. Transformants N5960 rap carrying the bar' plasmid pPG110 (0, 0) or the barIlOl plasmid pPG111 (A, A) were grown overnight in LB-Amp medium at 32°C. Fresh cultures were started by a 1:50 dilution into LB medium and shaken until the optical density at 600 nm reached 1.0. The cultures were then induced for PL expression at 42°C for the indicated times; samples were then withdrawn and cell titers were determined by colony counting at 32°C. Symbols: 0 and A, colony count on LB-Amp agar; 0 and A, colony count on LB agar.

DISCUSSION Bacteriophage A fails to propagate in E. coli rap mutants. Lambda variants capable of growth in rap strains carry mutations in one of several loci, termed bar. A comparison of the K barla and barll regions, as defined by the location of bar point mutations, revealed a nearly identical (14 of 16 bp) sequence. The sequence includes inverted repeats of 6 bp

culture to 42°C denatures the c1857 repressor and activates PL. Stable transformants of rap lysogens were obtained at 32°C, as expected. These lysogens were shifted to 42°C for varying periods and then were plated at 32°C. An immediate loss of colony formers occurred at 42°C (Fig. 3); only 1% of

FE,

CN

In

CJ Xf)

CM N

I

I

I I

Cu

5AAT

1033

8jfISO 8 o in+

_

toUi)

I I I

in

I I

AT ATAT GAT AT TTA T ATCAT TT T ACGTT TCT

CGTT3'

TTATATAACTA TAAATATAGTAAAA TGCAAAGAAGCAA 20

40

pRC200

,

,

pRC220 pRC29 1 + pRC290 FIG. 4. Demarcation of the barla region. The results of two types of experiments are summarized. The barla DNA in pPG110 was resected from the HindIIl site located to the right (not shown; see Materials and Methods and Fig. 1). The end points of the generated deletions and the corresponding plasmid designations are indicated (top; short vertical arrows). Symbols, + and -, bar' and bar mutant plasmids, respectively. Plasmids 500 to 505 were phenotypically Bar+; plasmids 520 to 523 were Bar-. Synthetic oligonucleotides mimicking barla DNA were cloned downstream to the A PL promoter in pDH520 (see Materials and Methods). Plasmids RC200, RC220 and RC291 were Bar-; pRC290 was Bar'. The extent of the lines under the nucleotide sequence indicates the length of the oligonucleotides (bottom). The sequence shown is a segment of X attP DNA from positions 27685 to 27721 (5). The nucleotide positions relative to the center of the common core (zero) are indicated. The convergent arrows indicate inverted repeats.

1034

GUZMAN ET AL.

(barIa) and 5 bp (barII) (Fig. 2). The 14 invariable positions may be essential for bar activity, since the three different bar mutations which we have sequenced, barIlOl, barI103, and barII205, represent transitions at one of these positions. All three mutations lie in an inverted repeat. We do not yet know which other positions within the consensus are critical to the Bar phenotype. We have determined a minimal functional bar sequence by constructing a set of oligonucleotides encompassing portions of the barla sequence. An oligonucleotide carrying the 16-bp homologous region and five additional nucleotides to the right was Bar-. A second oligonucleotide carrying these 16 bp as well as 4 bp to the left and 1 bp to the right was Bar'. Thus, the inverted repeat alone is not sufficient for bar activity; asymmetric nucleotides are also important. This latter result is consistent with the observation that the activity of barla depends on its orientation with respect to an upstream promoter. By the use of multicopy plasmid clones, we demonstrated that transcription of the barIa or barlI sequence is bacteriocidal in rap strains. This case differs from the exclusion of X, where both barIa and barIl must be transcribed to block phage development (8). We believe that the bar' transcript level necessary to block phage growth is attained only when all bar sites are expressed. Consistent with this idea is the fact that A variants which carry a single, but constitutively transcribed, bar site are Bar' (8). To explain our observations, we propose that bar sequences encode transcripts which inhibit or deplete an essential host function, Rap, or a function controlled by Rap. In rap cells containing bar' plasmids, the bar transcripts reduce Rap activity to levels incompatible with bacterial survival or phage A propagation. In wild-type cells, the interaction between bar and Rap may optimize A growth. In analogy to the sequestering by Qt replicase of host translation factors, EF-Tu, EF-Ts, and the 30S ribosomal protein, Si (10), the bar transcripts might divert Rap function towards phage development. However, A bar mutants grow as well as A bar' in wild-type cells, which suggests that the role of Rap in A physiology could be subtle. The available evidence suggests that the essential host function affected by the rap mutation is peptidyl-tRNAhydrolase, an enzyme required for protein synthesis (2). First, pth and rap are linked in a 1.5-kilobase bacterial DNA segment (7). Second, a pth(Ts) mutant exhibits the Rapphenotype at an intermediate temperature. As does the rap strain, the pth mutant also excludes stringently the phages which express constitutively PL or PI promoters (F. de la Vega and G. Guarneros, unpublished observations). Third, bar expression from plasmids inhibits protein synthesis in rap cells (D. Perez-Morga, submitted). The identities of pth and rap and the mechanism of action of bar are currently under active examination. ACKNOWLEDGMENTS We thank Rosy Cruces for typing the manuscript and Jackie Plumbridge for critically reading the manuscript. This work was supported by research grants from the Consejo Nacional de Ciencia y Tecnologia, Mexico, and the Fundaci6n Zevada, Mexico, and by Public Health Service grant GM36554 to M.E.G. from the National Institutes of Health. During the develop-

J. BACTERIOL. ment of part of these experiments, G.G. was a Fellow of the John Simon Guggenheim Foundation. LITERATURE CITED 1. Appleyard, R. K. 1954. Segregation of new lysogenic types during growth of a double lysogenic strain derived from Escherichia coli K12. Genetics 39:440-452. 2. Atherly, A. G., and J. R. Menninger. 1972. Mutant E. coli strain with temperature sensitive peptidyl-transfer RNA hydrolase. Nature (London) New Biol. 240:245-246. 3. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, J. L. Heyneker, H. W. Boyer, J. H. Crosa, and S. Falkow. 1977. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113. 4. Craig, N., and H. Nash. 1984. E. coli integration host factor binds to specific sites in DNA. Cell 39:707-716. 5. Daniels, D. L., J. L. Schroeder, W. Szybalski, F. Sanger, A. R. Coulson, F. H. Guo, D. F. Hill, G. B. Petersen, and F. R. Blattner. 1983. Complete annotated lambda sequence, p. 519676. In R. W. Hendrix, J. W. Roberts, F. W. Stahl, and R. A. Weisberg (ed.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 6. Friedman, D. I., E. R. Olson, C. Georgopoulos, K. Tilly, I. Herskowitz, and F. Banuett. 1984. Interactions of bacteriophage and host macromolecules in the growth of bacteriophage X. Microbiol. Rev. 48:299-325. 7. Guarneros, G., G. Machado, P. Guzmin, and E. Garay. 1987. Genetic and physical location of the Escherichia coli rap locus, which is essential for growth of bacteriophage lambda. J. Bacteriol. 169:5188-5192. 8. Guzman, P., and G. Guarneros. 1989. Phage genetic sites involved in X growth inhibition by the Escherichia coli rap mutant. Genetics 121:401-410. 9. Henderson, D., and J. Weil. 1976. A mutant of Escherichia coli that prevents growth of phage X and is bypassed by X mutants in a nonessential region of the genome. Virology 71:546-559. 10. Kamen, R. I. 1972. A new method for the purification of Q,3 RNA-dependent RNA polymerase. Biochim. Biophys. Acta 262:88-100. 11. Legersky, R. J., L. Hodnett, and H. B. Gray, Jr. 1978. Extracellular nucleases of pseudomonas Bal 31. III. Use of the double-strand deoxyriboexonuclease activity as the basis of a convenient method for the mapping of fragments of DNA produced by cleavage with restriction enzymes. Nucleic Acids Res. 5:1445-1464. 12. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 13. Maxam, A., and W. Gilbert. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. USA 74:560-564. 14. McKenney, K., H. Shimatake, D. Court, U. Schmeissner, C. Brady, and M. Rosenberg. 1981. Analysis of nucleic acids by enzymatic methods, p. 383-415. In J. C. Chirikjian and T. S. Papas (ed.), Structural analysis of nucleic acids. Elsevier/ North-Holland Publishing Co., New York. 15. Montanez, C., J. Bueno, U. Schmeissner, D. L. Court, and G. Guarneros. 1986. Mutations of bacteriophage X that define independent but overlapping RNA processing and transcription termination sites. J. Mol. Biol. 191:29-37. 16. Oliphant, A. R., A. L. Nussbaum, and K. Struhl. 1986. Cloning of random sequence oligodeoxynucleotides. Gene 44:177-183. 17. Schmeissner, U., K. McKenney, M. Rosenberg, and D. Court. 1984. Transcription terminator involved in the expression of the int gene of phage X. Gene 28:343-350. 18. Zagursky, R. J., K. Baumeister, N. Lomax, and M. Berman. 1985. Rapid and easy sequencing of large linear double stranded DNA and supercoiled plasmid DNA. Gene Anal. Tech. 2:89-97.