Dec 11, 1985 - We cloned the wild-type allele of the spolID locus of Bacillus subtilis. This DNA region was shown to be transcribed beginning within an hour ...
Vol. 165, No. 3
JOURNAL OF BACTERIOLOGY, Mar. 1986, p. 771-779
0021-9193/86/030771-09$02.00/0 Copyright © 1986, American Society for Microbiology
Transcriptional Control of the Bacillus subtilis spoIlD Gene SING RONG, MARK S. ROSENKRANTZ,t AND ABRAHAM L. SONENSHEIN* Department of Molecular Biology and Microbiology, Tufts University Health Science Campus, Boston, Massachusetts 02111 Received 30 September 1985/Accepted 11 December 1985
We cloned the wild-type allele of the spolID locus of Bacillus subtilis. This DNA region was shown to be transcribed beginning within an hour after the onset of sporulation. The amount of spoIID mRNA present in ceUs at 1 h after the end of growth was more than 50-fold greater than it was in growing cells; the pool of this mRNA decreased steadily after 1.5 h after the end of growth. spoIlD mRNA was present in stationary-phase cells of sporulation mutants with lesions in the spoOJ and spolIB genes but was absent in cells carrying spoOB, spoOH, spoIA, spollE, spoliG, or spollIA mutations. In vitro runoff transcription with the Ef55, Ec37, Ea32, and Eu29 forms of RNA polymerase indicated that only the Ea29 form was able to transcribe the spoliD gene. This result is consistent with results of studies with the Spo- mutants, because only mutants that produced Ea29 were able to produce spollD mRNA in vivo. In the course of this work, two additional transcription units were discovered in the DNA region neighboring the spolID gene. One of these was expressed during vegetative growth; the other was expressed early during sporulation and corresponded to an in vitro transcript produced by the Eu29 form of RNA polymerase.
products nor their roles in sporulation, if any, are known. In addition, in at least some cases the time of appearance of the transcript of a gene does not correlate well with the time at which the gene product needs to function (32). We sought to test whether genes that have products which are required for sporulation (i.e., genes in which mutations cause blockage of sporulation) are transcribed at specific times during sporulation and, if so, whether their transcription is dependent on a sporulation-specific form of RNA polymerase. To do so, we isolated the wild-type allele of spoIID66 from the lambda library described by Ferrari et al. (11), and subcloned the spoIID gene in Escherichia coli. We show by measurements of transcription in vivo that the spoIID gene is first transcribed early after the onset of sporulation. This transcription is dependent on the functions of certain sporulation genes, all of which are known to be required for synthesis of a29, but not of other genes that have functions which are dispensable for a29 synthesis. By in vitro transcription studies we demonstrate that the spoIID promoter is recognized by the Ea29 form of RNA polymerase, but not by Eu55, Eu37, or Eu(32 forms. Thus, we show that a gene that has the product which is essential for sporulation is likely to be under the transcriptional control of a sporulation-specific u factor.
Temporal control of gene expression during sporulation of Bacillus subtilis is thought to occur by sequential replacement of the sigma factor component of RNA polymerase (17, 18). This mechanism can account for simultaneous activation and silencing of large groups of genes, even if they are scattered around the chromosome. In the last several years, this hypothesis has received strong experimental support. At least five forms of RNA polymerase (Ea55, Ea7, EJ32, Er29, Eu28) that differ only in their sigma factors are present in vegetative or sporulating cells or both. Each enzyme has specific promoter recognition sequences which permit it to transcribe only a certain group of genes (15). These genes are transcribed in vivo at characteristic times during growth or during sporulation or both. In vegetative cells, most of the RNA polymerase holoenzyme contains a sigma subunit designated {J55 (apparent molecular weight, 55,000). In an in vitro system, the purified form of this enzyme transcribes genes expressed in vivo during growth, such as the tms and veg genes (16, 20). Ear37 and E&2 are minor forms of RNA polymerase in vegetative cells. In vitro, these forms of RNA polymerase transcribe genes that are expressed at the end of the logarithmic growth phase or very early during sporulation (e.g., spoVG, ctc, and the subtilisin E gene) (15, 27, 31). Another minor form of vegetative cell RNA polymerase, Ea28, transcribes a small number of growth genes (13). The Ea29 form of RNA polymerase is found only in sporulating cells, and its appearance is developmentally regulated (30). It is most abundant about 3 h after sporulation begins; when it appears it seems to replace all known vegetative cell sigma factors (14, 30). Ea29 directs transcription of the L gene (14), as well as ctc (27) and, very weakly, the veg gene (14), in vitro. These results suggest that changes in RNA polymerase subunit composition alter transcriptional specificity and are responsible, at least in part, for sequential gene activation in vivo. For most of the genes studied, however, neither their *
MATERIALS AND METHODS Bacterial strains and growth. Bacterial strains used in this study are listed in Table 1. DSM and L media have been described previously (24), as have conditions for propagation of A Charon 4A derivatives (21). To detect expression of the lacZ gene in colonies, strains were plated on L agar
containing 5-bromo-4-chloro-3-indolyl-3-D-galactoside (40 ,ug/ml). Quantitation of P-galactosidase activity coded for by strains carrying lacZ fusions was done as described by Donnelly and Sonenshein (8). Plasmids and phage. Plasmids pBR322 (5), pBR325 (4), and pCED6 (8) were obtained from C. Banner, K. Dharmalingam, and C. E. Donnelly, respectively. Phage M13 mp8 was provided by M. Challberg. Transformation conditions. Methods for transformation of
Corresponding author.
t Present address: Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139. 771
772
RONG ET AL.
J. BACTERIOL.
TABLE 1. Bacterial strains used in this study Straina
Genotype
B. subtilis
SMY .......
Prototroph spo+ spoOB136 pheAl trpC2 spoOH81 trpC2 pheAl spoOJ87 trpC2 pheAl spoJJD66 trpC2 rpoB2 spoIIE64 trpC2 spoIIIA7 trpC2 ilvCI .S43b........ spoIID298 trpC2 1S49 ....... spoIIBi31 trpC2 1S60 ....... spoIIG41 leuA8 tal-i 1S71 ....... spoIIA4 trpC2
1S16 ....... 1S24 ....... 1S26 ....... 1S33 ....... 1S35 ....... 1S36 .......
E. coli MM294 ....... RV .......
thi pro endA hsdR AlIacX74 thi hsdS dapD8 lacY A(gal-uvrB) AthyA DPSOsupF ....... gyrA supE44 supF58 JM103 ........ A(lac-pro) supE thi rpsL sbcB15 endA hspR4 F' traD36 proAB laclqZAM5 a Strains SMY and MM294 were obtained from R. Losick, RV from M. Malamy, JM103 from M. Challberg, and DPSOsupF from J. Hoch. All other
strains were from the Bacillus Genetic Stock Center. b Strain 1S43, obtained from the Bacilius Genetic Stock Center, was onginally thought to carry the mutation spollC298. It actuafly carries a
mutation at the spolID locus (see text).
B. subtilis and E. coli have been described previously (6, 9). When transformation of a Spo- strain to Spo+ was being tested, competent cells that had been exposed to DNA for 30 min at 37°C were diluted into DSM broth and grown over-
night at 37°C. One-milliliter samples were sealed in glass ampoules, heated to 80°C for 10 min, and plated on DSM agar. Spo- mutants survive this treatment inefficiently and form white colonies on DSM agar; Spo+ transformants survive well and form brown colonies on the same medium. Isolation oDB. subili RNA. Unlabeled RNA was extracted from B. subtilis by a modification of the method of Zuber and Losick (32), as described by Fisher et al. (12). Each preparation of RNA was subjected to electrophoresis in agarose gels to verify that rRNA bands were intact. Pulse-labling. To label RNA in vivo, strain SMY was transferred in mid-logarithmic growth phase from DSM medium to a resuspension medium (25) in which cells sporulate. At various times after resuspension, 1- to 2-ml samples of cells were removed and incubated with 3 mCi of carrier-free 32PO4 for 5 min at 37°C. Vegetative cells were pulse-labeled in resuspension medium supplemented with glucose (0.5%). Pulse-labeled RNA was extracted from B. subtilis by the method of Ollington et al. (20), as modified by Bohannon et al. (3). Hybridizati conditions. DNA fragments were transferred to nitrocellulose and hybridized to radioactive RNA as described by Bohannon et al. (3). Dot blot hybridizations (28) were performed as described by Rosenkrantz et al. (21). DNA probes were internally labeled by the nick-translation reaction of DNA polymerase I. The Si nuclease method of Berk and Sharp (2), as modified by Rosenkrantz et al. (21), was used to find transcriptional start points. Probe DNA was labeled at its 5' ends by the action of T4 polynucleotide kinase. In vitro transcription. To measure the ability of a particular form of RNA polymerase to transcribe the spoIlD gene, plasmids carrying the spolID promoter were cleaved with a
1kb E S
pMR12 (TF+)
Pv Sc Sp
I-
II
I
I
PV
I~~~~~~~~~
I I
S HscPv I I I
I
l
spotl D H H-600bA PvA H E
VI
.
I
l
E350b
-21b
pMR16 (TF+)
pMR17(TF+) pMR18( TF+) pSR3 (TF )
E
-
-I E
Sp Hs
E
H
H
FIG. 1. Restriction maps of plasmids having spolID transforming activity. Various regions of pMR12 were isolated by subcloning or deletion. Vector DNA (pBR325 or pBR322) is not shown. Restriction maps are drawn to the scale indicated. Plasmids retaining transforming activity for strains 1S43 and 1S33 are designated (TF+). Restriction site abbreviations are as follows: E, EcoRI; S, Sall; Pv, PvuII; Sc, Sacl; Sp, SphI; H, HindIII; A, AvaI. The arrows indicate the start points and orientations of three transcripts identified by S1 nuclease mapping and in vitro transcription. V and S refer to transcripts found in vegetative and sporulating cells, respectively. kb, kilobase pairs.
restriction enzyme and used as templates for in vitro transcription. Unless indicated otherwise, reaction conditions were those described by LeGrice and Sonenshein (16). Reactions containing the Ecr39 form of RNA polymerase were adjusted to 50 mM dithiothreitol, a condition which stimulates transcription. The major vegetative (E&55) form of B. subtilis RNA polymerase was purified as described previously (23). The E&2 and E&37 forms of RNA polymerase were gifts of C. Binnie and R. Losick; the E(29 form was a gift of W. Haldenwang. DNA sequencing. DNA fragments cloned in M13 mp8 were sequenced by a chain termination method (19), using a universal primer obtained from Collaborative Research, Inc., Waltham, Mass., and the large fragment of DNA polymerase I obtained from New England Nuclear Corp., Boston, Mass. RESULTS Cloning of the spoliD gene. A recombinant X phage, called XCh3t-9, was isolated from the B. subtilis gene bank of Ferrari et al. (11) on the basis of its ability to transform strain 1S43 to Spo+. This strain is, in principle, identical to strain P9 (spoIIC298) described by Coote (7). However, it now appears that the sporulation mutation of strain 1S43 is at the spoIID locus (J. Mandelstam, personal communication). The XCh3t-9 phage carries four EcoRI fragments of B. subtilis DNA, comprising a total of 13 kilobase pairs (kbp). A single EcoRI fragment of 3.8 kbp was able to transform strains 1S43 and 1S33 (spoIID66) to Spo+. This fragment was subcloned in pBR325, creating pMR12 (Fig. 1). Marker rescue transformation experiments showed that pMR12 and certain subclones of pMR12 had Spo+transforming activity (Fig. 1). This same EcoRI fragment has apparently been cloned by Anaguchi et al. (1) and by J. Mandelstam and colleagues (see reference 10). The restriction map of the 3.8-kbp EcoRI fragment contained in pMR12 is consistent with that of the fragment obtained by Anaguchi et al. (1), which complemented the spo mutation of strain 1S43. The spolID locus cloned by Mandelstam and coworkers is nearly identical in sequence to that described here (S. Rong, unpublished data; S. Clarke and J. Mandelstam, personal communication). Because the smallest subclone that we created (pSR3) transformed both strains 1S33 and 1S43 to Spo+, it seemed likely that these strains are mutated at the same locus. Given that the spo marker is linked to hisA (a marker near spoIlD) and not to cysB (a marker near spoIIC; S. Clarke and J. Mandelstam, personal communication), it is apparent that both strains are mutated at the spoIID, rather than at the spoIIC, locus. Hybridization of pulse-labeled RNA to spoliD DNA. Regions of sporulation-specific transcription contained in these cloned DNAs were identified by hybridization of nitrocellulose blots of plasmid restriction fragments to RNA isolated from cells pulse-labeled with 32PO4 during growth (V) or sporulation (at 1.5 h [T1.], 3 h [T3], and 4 h [T4] after the end of growth). A region of DNA contained in pMR12 and pMR16 hybridized preferentially to RNA labeled for 5 min at various times after the onset of sporulation (Fig. 2). This region of DNA correlated well with the region needed for transformation of strain 1S33 to Spo+ (i.e., the B. subtilis DNA contained in pMR16). A second region of DNA contained in pMR12 was also transcribed preferentially during sporulation. We were unable to match this region of transcription to any known genetic marker. Transcription start point. To see whether any transcription start points could be identified in the region of sporulation-
773
TRANSCRIPTION OF THE spolID GENE
VOL. 165, 1986
Sp
IES
pMR12
0.7
0.2g
A B A
B
+ ,i Exp# 1 + SaIlI- Sphl T3 +
+
RNA v
+
+
T4,
A,B,C
H 0. 9
C
O.0D
.s.5H
Fragment C,D
09
E
G
F
E,F,G +
+
_ D, E
F
++
+
+
+
+4.
+
+
+
+4.
+
+
+
G
v
Exp #2 T, HindIlt T3 To
+~~~~~~~~ + ~ ~_ ~ ~~~~~ F2G
pMR16 RNA V
Fl eF2G
Expt3 '-' Avar T3 To +
+
+
+
V
Exp#4 T,., Hindu T3 T4
FIG. 2. Hybridization analysis. Strain SMY was pulse-labeled with [32P]phosphate during vegetative growth (V) or at T1.5, T3, or T4 after resuspension in S-M medium (25). 32P-labeled RNA was isolated and hybridized to restriction fragments of cloned spoIID region DNA which had been electrophoretically separated and blotted onto nitrocellulose (sizes are in kilobase pairs), The restriction enzymes used to generate fragments for each experiment are indicated. The columns indicate which fragments of which plasmids hybridized very strongly (++), strongly (+), moderately (±), weakly (_), or not detectably (-) with pulse-labeled RNA. The spolID locus is located within fragment F. Restriction site abbreviations are as follows: E, EcoRI; S, Sall; Sp, SphI; H, HindIll; A,
AvaI.
specific transcription, various plasmids were digested with restriction enzymes and end labeled. After hybridization to RNA isolated from growing or sporulating wild-type cells, samples were treated with S1 nuclease, electrophoresed in urea-polyacrylamide gels, and subjected to autoradiography. First, plasmid pMR16 was cleaved with HindIII and labeled at its 5' ends. This yielded radioactive fragments of 5.0, 0.9, and 0.1 kbp. From this mixture, a protected DNA band of about 210 bases (b) was obtained with RNA from vegetative and late sporulating cells, and a protected band of about 600 b was obtained with RNA from early sporulating
774
RONG ET AL.
J. BACTERIOL.
B
A Ma b c d e f .-A"
622. 527'
M
b
C c
b
c
d Me f
D g
M o b c d
h
527 _30W 404
622 527
_
309
309-
309 242
242*j, 217
_.
217 201
3
147W1
164 147
I
2171 201
21 01.
160 147
i
.:
404o
180 180
1
622 527
l
l
122-
122
110C
FIG. 3. Identification of transcripts by Si nuclease mapping. RNA was isolated from cells of B. subtilis SMY grown in DSM medium and harvested during vegetative growth (V), at the end of logarithmic growth phase (To), or up to 4 h thereafter. From each sample of RNA, 10 ,ug was hybridized with 32p_, 5'-end-labeled restriction fragments of various plasmids. Hybridized samples were treated with S1 nuclease, denatured, and electrophoresed on urea polyacrylamide gels with pBR322-HpaII size markers (M). (A) The probe was pMR16 cleaved with HindIll. RNAs used for hybridization corresponding to each lane were from vegetative cells (lane a), To cells (lane b), T1 cells (lane c), T2 cells (lane d), T3 cells (lane e), and T4 cells (lane f). Hybridization was at 50°C. The two bands that migrated more slowly than 622 b were undigested probe DNA. (B) In lane a, the probe was pMR17 cleaved with HindIII and the RNA was from cells harvested at T1. In lanes b and c, the probe DNA was treated with PvuII and Sal, respectively, after end labeling. Hybridization was at 50°C. This figure displays a short autoradiographic exposure; a longer exposure showed an additional protected band at approximately 210 b. (C) The probe for lanes a through d was pMR16 cleaved with HindIII. For lanes e through h, the probe was pMR16 cleaved with EcoRI. RNAs were from vegetative cells (lanes a and e), To.5 cells (lanes b and f), T1.5 cells (lanes c and g), and T2.5 cells (lanes d and h). Hybridization was at 45°C. (D) The probe was pMR16 cleaved with HindIII. In lanes b and c, the probe was hybridized at 50°C to RNA from vegetative and T1.5 cells, respectively. In lane d, the probe was hybridized at 50°C to RNA from Saccharomyces cerevisiae. In lane a the probe was cleaved with EcoRI and subjected to electrophoresis without hybridization. Numbers next to the gels are in bases.
cells (Fig. 3A). Because this latter band was likely to correspond to the spoIID transcript, we focused on determining its origin and orientation. Plasmid pMR17 was cut with HindIII, labeled at its 5' ends, and, in some cases, cut with a second restriction enzyme. Cleavage of pMR17 with HindIII generated four fragments of 0.1, 0.9, 1.1, and 5.8 kbp. RNA from early sporulating cells (T1) protected a fragment of 600 b from this mix (Fig. 3B). The fact that PvuII digestion, but not SalI digestion, reduced the size of the protected fragment and that the amount of the reduction was about 30 b (Fig. 3B) suggests that spoIID mRNA is transcribed from right to left, starting within the 0.9-kbp HindIII fragment (Fig. 1). A transcript of the same size was seen when pSR3, labeled at its HindIll sites, was used as a probe (see below). This proves that a 600-b RNA must begin within the 0.9-kbp HindIII fragment. The putative direction of transcription was confirmed when pMR16 was cut with AvaI, labeled at its 5' ends, and used as a probe. No protected fragment could be detected (data not shown). If the sporulation-specific transcript were transcribed from left to right, a protected fragment of approximately 300 b would have been seen. This indicates that the direction of transcription is from right to left, beginning very close to the AvaI and PvuII sites. The RNA from vegetative cells that protected a 210-b fragment of pMR16 labeled at its HindIIl ends was further mapped. It was not found when pSR3 labeled at its HindIIl ends was used as a probe (see below). This shows that this vegetative RNA originates outside of the 0.9-kbp HindIII
fragment. When pMR16 was labeled at its EcoRI site and used as a probe, no protection was seen with vegetative RNA (Fig. 3C). Moreover, the protected band that was seen with a HindIII-labeled probe was about 10 b longer than the HindIII-EcoRI interval at the far right end of the cloned DNA (Fig. 3D). This indicates that the vegetative RNA is unlikely to correspond to transcription in either direction within this interval. We conclude that the vegetative RNA probably originates to the left of the 0.9-kbp HindIIl segment, and is transcribed from left to right (V in Fig. 1). We have not determined whether the 210-b protected fragment seen with RNA from late sporulating cells is from this same region. In this experiment, an unexpected protected fragment appeared when RNA from early sporulating cells was used (Fig. 3C). The presence of this fragment indicates the existence of an early sporulation RNA that is transcribed from a point located about 350 b to the left of the only EcoRI site in pMR16. This transcript should originate within the 0.9-kbp HindIII segment, and this was indeed the case. When pSR3 labeled at its HindIII sites was used as a probe, a 150-b protected fragment was seen with RNA from cells harvested at T1.5 and T2.5. To see this protection, however, it was necessary to reduce the temperature of hybridization from 50 to 45°C (compare Fig. 3A and C). This may indicate that the region around the rightmost HindIII site is relatively rich in adenine-thymine base pairs or that a slight inhomology exists between the strain from which RNA was isolated (SMY) and the strain from which the X Charon 4A
TRANSCRIPTION OF THE spoIID GENE
VOL. 165, 1986
bank was made (168 trp). The origin and direction of this S transcript are indicated in Fig. 1. To determine which of the two sporulation-specific transcripts that initiate within the 0.9-kbp HindIII segment corresponds to the spoIID locus, we isolated from pMR18 the 1.1-kbp PvuII-SalI fragment, which encodes the leftward transcript, and a 0.6-kbp PvuII fragment, which encodes the upstream rightward transcript. Strains 1S33 and 1S43 both became Spo+ when transformed with the 1.1-kbp fragment, but not when transformed with the 0.6-kbp fragment. Thus the leftward transcript corresponds to the spolID gene. The 0.9-kbp HindIII fragment that contains the start point for spolID transcription was subcloned in pBR322, creating pSR3 (Fig. 1). This plasmid was cut with HindIII, labeled, and hybridized to increasing amounts of RNA from growing and sporulating cells (Fig. 4). In this experiment, some spoIID mRNA could be detected very soon after the end of the logarithmic growth phase. At T1 the pool of this mRNA was more than 50-fold greater than it was in growing cells; the pool decreased steadily after T1. The temperature of hybridization precluded analysis of the S transcript in this
775
spo[iG spofiB spo4
spoTl E spooJ I
M
I
- ---l -
iI
TI T2 Tl T2 Tl T2 Tl T2 V Tl
622
527
*
Y
-
404 309
experiment.
Appearance of spolID mRNA in various sporulation mutants. RNA isolated at T1 and T2 from each of several Spomutants was hybridized to pSR3 labeled at its HindlIl sites,
and the hybrids were exposed to S1 nuclease. The spoIID transcript could be found in wild-type cells, in strain 1S26 (spoOJ), and in strain 1S49 (spoIIB) but not in strains 1S35 (spoIIE) or 1S60 (spoIIG) (Fig. 5). Similar experiments showed the absence of the spoIID transcript in strains 1S16 (spoOB), 1S24 (spoOH), 1S71 (spoIIA), and 1S36 (spoIIIA7) (Table 2). These indicate that the appearance of spoIID mRNA is a sporulation-specific event that is dependent on the function of some sporulation genes but not others. To confirm the results of S1 nuclease mapping experiments in sporulation mutant strains, plasmid pSR3 was nick translated and used as a probe in hybridizations with RNA spotted on a nitrocellulose membrane. The same RNA preparations were used for these experiments as for the S1 nuclease mapping experiments. Only RNA from the wildtype strain and from strains carrying spoOJ, spolIA, and
V M 5
,
1S60 (spoIIG),
(spoIIE),
(spo')
T2 T3 T4 Y
T1
To .
spoID transcnption in Spo mutant strains. RNA was 1S49 (spoIIB), 1S26 (spoOj), 1S35 and SMY at T; and T2. Hybridization conditions were as descrbed in the legend to Fig. 3A. Y indicates S. cerevisiae RNA; M indicates size markers (pBR322 cleaved with HpaII). Numbers to the left of the gel are in bases. FIG. 5
isolated from strains
, ,
._
2
255255510-5255255
25 5 10
TABLE 2. Effect of various spo mutations on appearance of spoIID mRNAa Time after end of growth
spo mutation
622 527S 404 * 309 FIG. 4. Levels of spoIID transcript during sporulation. RNA isolated from B. subtilis strain SMY grown in DSM medium during vegetative growth (V) and at various times after the end of growth. The amount of RNA (in micrograms) used for each hybridization is indicated at the top of the lanes. Hybridization conditions were as described in the legend to Fig. 3A. Y indicates a control lane with S. cerevisiae RNA; M indicates size markers (pBR322 cleaved with HpaII). Numbers to the left of the gel are in bases. was
spo+ spoOB spoOH spoOJ spolIA spoIIB
T,
T2
+
+
+
+
+
+
spoIlE spoIIG spolIlA a RNA from cultures of each of the mutants indicated was extracted at T1 or T2 in DSM medium. This RNA was hybridized to pSR3 DNA that had been cleaved with HindIlI and labeled at its 5' ends by the action of polynucleotide kinase. After hybridization, the nucleic acid was treated with Si nuclease, denatured, and subjected to electrophoresis in a gel containing 6% acrylamide and 8 M urea. The presence of spoIID mRNA was indicated by the appearance of a protected band of 600 b.
776
RONG ET AL.
J. BACTERIOL.
I-
0 z
m
LLI
fin 200 Z I-
I7100
g
J
0 I-
50
a
0 LA (9
D
TIME (HRS.) FIG. 6. 1-Galactosidase activity of B. subtilis cells carrying a spoIID-lacZ fusion plasmid. Strain SMY was transformed with pSR5, a plasmid carrying a spolID-lacZ fusion, or with pCED6, the promoterless parent of pSR5.. The plasmid-carrying strains were grown in DSM medium containing kanamycin (5 Fg/ml). and harvested at the indicated times during growth and sporulation. I,-Galactosidase activity, measured as described in the text, is indicated for SMY(pSR5) (A) and SMY(pCED6) (A), The growth curves (0) for the two strains were identical.
spoIIB mutations hybridized to the probe (data not shown). These results correlate well with the results of Si nuclease mapping experiments, except for the case of the spoIlA mutant. Si nuclease mapping experiments showed clearly that no spollD mRNA could be detected in the spollA strain, but the dot blot experiment showed strong hybridization. Because Si nuclease mapping experiments also revealed that vegetative cells contain an RNA that originates outside of the 0.9-kbp HindIII fragment and proceeds toward the spoIID gene, it is possible that this transcript is still present at T1.5 in the spoIIA strain. This point,. however, remains unresolved. Fusion of the spolID promoter region to lacZ. To verify that spoIlD mRNA appears at an early time after the end of growth, the 0.9-kbp HindIII fragment containing the spoIID promoter was inserted into the promoterless lacZ fusion plasmid pCED6 (8), creating pSR5. Restriction analysis showed that the orientation was such that the spoIID promoter was directed toward IacZ. On L agar containing 5-bromo-4-chloro-3-indolyl-f3-D-galactoside, B. subtilis SMY that was transformed with the fusion plasniid formed colonies that became blue after overnight incubation at 370C. When the fusion plasmid pSRS was introduced into strains 1S31 (spoIIA) or 1S60 (spoIIG), only white colonies were
obtained.
Figure 6 shows ,B-galactosidase activity during growth and
sporulation of wild-type cells carrying pSR5. Enzyme activity appeared at T1 to T2, reached a peak, and then declined. This result confirms that the spoIlD promoter is utilized in vivo at an early time of sporulation. In vitro runoff transcription. The fact that spolID mRNA was found only in sporulating cells and that its appearance was blocked by certain spo mutations suggests the possibility that its transcription is dependent on a sporulationspecific form of RNA polymerase. To test this, the 0.9-kbp HindlIl fragment was isolated and used as a template for in vitro transcription by various forms of B. subtilis RNA polymerase. The Er29 form of RNA polymerase, a form found only in sporulating cells, gave two transcripts of about 600 and 150 b (Fig. 7A). This correlates well with the sizes of two early sporulation mRNAs found in in vivo experiments. Other forms of B. subtilis RNA polymerase (EoJ'5, E&7, and Ecr2) gave no 600-b transcript (Fig. 7A; data not shown). That those enzymes were active was shown by their ability to give the expected transcripts for the glnA and spoVG genes. A transcript- corresponding to the S gene was produced by the Eo29 form of RNA polymerase and by a mixture of E&32 and Ec37 (Fig. 7A), but not by E&55 (data not shown). Results of the in vivo experiments indicate that the spoIID transcript crosses a PvuII site within the first 30 b. This was confirmed in the in vitra experiment shown in Fig. 7B. Here the 900-base-pair HindIII fragment cloned in pSR3 was
A
B
Ma b c d
M e
6i22
k Imn opq r s
I
6Q22 527
-spoQ IID A -gIn - spoVG
3
777
C
4041
242
242
160 ; 404w
_S
147:2
34
* NI
4w-OK .
76
.~~
TRANSCRIPTION OF THE spoIID GENE
VOL. 165, 1986
-
147
-
...
121 110
...
........
...... ....
....
-i
FIG. 7. In vitro transcription of the spolID gene. Various template DNAs were transcribed in vitro as described in the text by using the templates and forms of RNA polymerase indicated. (A and B) Lane a, 0.9-kbp HindIII -fragment of pMR16 and Ecr2; lane b, 0.9-kbp HindIH fragment of pMR16 and a mixture of Ea3 and E37; lane c, EcoRI digest of pLS5-11ARI (a template that contains the first 320 b of the spo VG transcription -unit) and a mixture of E&32 and Ea3'; lane d, Sacl digest of pHJS10 (a template that contains the first -350 'b of the gInA transcription unit; H. J. Schreier, personal communication) and Eu35; lane e, 0.9-kbp Hindlll fragment of pMR16 cut with PvuII and transcribed by EuF29. Arrows indicate expected positions of specific transcripts. (ori refers to a transcript from the origin of replication of pBR322; S. F. J. LeGrice, personal communication). (C) Various dinucleotides were used -to prime transcription from the spoliD and S promoters. The reaction mixture was the same as described in the text, except that nucleoside triphosphate concentrations were reduced to 10 p.M and dinucleotides were present at 250 p.M. In anl cases, the E&39 form of-RN-A polymerase was used. In lane 5 the template -was the 0.9-kbp HindIII fragm'ent of pSR3. In lanes g and i through s, the template was the 0.9-kbp HindIll fragment cleaved with HpaIl. In lane h, the-template was the 0.9-kbp HindIII fragment cleaved with HaeIII. The primers were as follows: ApG (lanes f through h and m); none (lane i); ApC (lane j); 'CpU (lane k); UpA (lane 1); GpA (lane n); GpU (lane o); UpC (lane p). In lanes q through s, no pnmer was used. Instead, certain nucleoside triphosphates were added to 150 ,uM. They were ATP and GTP (lane q), ATP (lane r), and GTP (lane s). Numbers to the left of the gels are in bases.
purified and cut with PvuII. This DNA was then used as a temiplate for transcription by the EaO9 form of RNA polymerase. An RNA of approximately 27 b was obtained. The orientation of the in vitro transcript was verified by 120 I
5' -TCTGTATGTCACTCTGiGCATACTGGTITF
cleaving the 0.9-kbp HindIII fragment with HpaII or HaeIII before transcription. On the basis of DNA sequence, these sites are located 274 and 105 base pairs downstream from the PvuII site (S. Clarke and J. Mandelstam, personal commu155
'190
ATTTAI1TM[GTGTATTATCATCAT[ATfiCiEGTQATACAAAATAAGAAICTMAATG
3'-AGACTTACAGTGAGACCGTATACTACGCCAGTM1TATCGT1iTiFCTTATGCA1TTAC -10 .s 1{r-egion~l
210
-35
245
-10
-\
-3
region
280
. -region 9kregionI I ACitTN~AGf]TCTGICG ACG TCATATTAGiC1TGTCCCTGCCCATAG]AC mACAGGAGACAGC-3' CTA6ACiTAJGAATCMC TGWHAmICMAAGACAGG11TFGCICIC3TAIMICGACAG GGACGCAGTATCTGATCTGATCTGAGCTIAGGGCTCGTC CCGTCG-5' I
FIG. 8. DNA sequence of the spoIID promoter region. Arrows indicate the directions of transcription of the spoIID and S transcription units. The base of each arrow corresponds to the apparent start point of transcription. The presumptive -10 and -35 regions for the respective promoters are indicated. The numbers above the sequence indicate distance in base pairs from the Hindill site -located upstream of spofiD.
778
RONG ET AL.
nication). HpaII and HaeIII digestions of the template reduced the size of the transcript to about 290 and 125 b, respectively. DNA sequence of the spolID promoter region. A PvuIIHindlll fragment of 285 base pairs was isolated from pSR3, and the PvuII site was converted to a Hindlll site by the addition of a synthetic linker. This fragment was then inserted into the double-stranded form of phage M13 mp8 DNA that had been digested with HindIII. Both orientations of the insert were found and sequenced by the dideoxy method (19). Part of the DNA sequence obtained is shown in Fig. 8. The sequence is in close agreement with the sequence of this region determined previously by S. Clarke and J. Mandelstam (personal communication). Dinucleotide priming. The results of both in vivo and in vitro experiments suggest that the spoIID transcript begins about 25 b upstream of the PvuII site contained within the insert in pSR3. To know exactly which base is used as the start point for transcription, we used various dinucleotides as primers to initiate in vitro transcription by the Ecr29 form of RNA polymerase. Only UpA, ApG, and GpA could initiate spoIlD transcription, and, of these, ApG gave the strongest transcription (Fig. 7C). It seems likely that the guanine residue indicated in Fig. 8 is the initiating nucleotide, but the adenines at either side of the guanine are also possible candidates. Figure 7C also shows that ApC and UpA primed transcription of the upstream early sporulation gene. Combining this information with the size of the runoff transcript, we put the +1 position for transcription of this gene at the adenine residue indicated in Fig. 8. DISCUSSION The wild-type allele of the spoIID locus of B. subtilis displays a unique gene regulation pattern. Transcription of this gene is undetectable in vegetatively growing cells but is turned on after the end of growth, reaching a maximal rate at about 1 to 1.5 h after cells leave logarithmic growth phase (T1 to T1.5). That we could not detect spoIID transcription after the end of growth in certain nonsporulating mutants indicates that expression of this gene is a sporulation-specific event which is distinct from stationary-phase events. The fact that transcripts of the spoIID gene were most abundant at T1 correlates well with the blockage of sporulation at stage 11 (7) caused by mutations at this locus. This result leads to the simple conclusion that the spoIlD gene is transcribed at a time very close to that at which its product is needed to function. In another study, we have shown that the spollIC locus is transcribed preferentially at T3 (M. S. Rosenkrantz and A. L. Sonenshein, manuscript in preparation), and an analogous result has been obtained for the spolIA and spoVA genes (22), but this is not the case for all sporulation genes. The spoVG gene, for instance, is clearly transcribed at the end of the logarithmic growth phase, but the absence of its product leads to blockage at stage V (32). The in vivo spoIlD promoter detected by Si nuclease mapping experiments seems to be the same promoter used in vitro. This promoter can be utilized by the Eu29 form of RNA polymerase but not by certain other forms of the enzyme. This suggests that the spoIID promoter is used in vivo by the Ea29 form. This is the first case of a gene in which mutations block sporulation and which can only be transcribed by the ECJ29 form. According to the sigma cascade model (17), the sequential replacement of sigma factors is responsible for activation and repression of different groups of genes during sporula-
J. BACTERIOL.
tion. a" is the only sporulation-specific a factor found so far. The time of appearance of ca29 (14, 30) and the time of transcription of the spolID gene correlate well. Moreover, spoIID transcripts were only found in spo mutants that have been shown by Trempy et al. (30) to contain the E&r9 form of RNA polymerase. A mutant (spoIIE) which produces the apparent precursor of cr9, but not C29 itself (30), failed to synthesize spoIID mRNA. These results are consistent with the notion that synthesis and activity of EC29 are sufficient for activation of the spoIID gene. It is also true, however, that the pool of spoIID mRNA diminishes at a time (T4) when o-2 is very abundant. This may indicate that the spoIID gene is subject to additional levels of regulation. Among the mutations that blocked, the appearance of spoIID mRNA was spoIIG41. The wild-type allele of this gene has remarkable homology with the rpoD genes of B. subtilis and E. coli (26) and, when cloned in E. coli, codes for a polypeptide that reacts with monoclonal antibody prepared against o(J9 (29). It is thus a strong candidate for the o29 gene. The fact that its product is necessary for transcription of spoIID in vivo is consistent with the idea that spolG is the gene for a29. Examination of the sequence near the start points for the two early sporulation transcripts detected in this study reveals that they have substantial homology with a consensus sequence previously proposed for the -10 region of promoters recognized by the ECJ29 form of RNA polymerase (15). Homology with the consensus sequence for the -35 region of a29 promoters is less apparent. The relevant sequences (-35 region, spacer [bp], -10 region) were as follows: consensus sequence, A-TT-AAAA (14 to 17 bp) CATATT-T; spoHID sequence, GAGTCATAT (15 bp) CATAGACT; upstream transcript, CGTATTCTT (15 bp) CATAATGA. The upstream S transcript was also produced in vitro by Er32 or E37 or both. The sequence of this promoter does, in fact, have homology with the consensus for Ec32-dependent promoters. ACKNOWLEDGMENTS We thank W. Haldenwang for the gift of Ea29 RNA polymerase; C. Binnie and R. Losick for EU32 and EM' RNA polymerases; and W. Haldenwang, D. Savva, and M. Malamy for helpful criticism. We are indebted to J. Mandelstam and colleagues for making available to us their unpublished results, including their sequence of the spolID region. This work was supported by Public Health Service research grant R01-GM19168 from the National Institutes of Health. LITERATURE CITED 1. Anaguchi, H., S. Fukil, H. Shimotsu, F. Kawamura, H. Saito, and Y. Kobayashi. 1984. Cloning of sporulation gene spolIC in Bacillus subtilis. J. Gen. Microbiol. 130:757-760. 2. Berk, A., and P. A. Sharp. 1977. Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S1 endonucleasedigested hybrid. Cell 12:721-732. 3. Bohannon, D. E., M. S. Rosenkrantz, and A. L. Sonenshein. 1985. Regulation of Bacillus subtilis glutamate synthase genes by the nitrogen source. J. Bacteriol. 163:957-964. 4. Bolivar, F. 1978. Construction and characterization of new cloning vehicles. III. Derivatives of plasmid pBR322 carrying unique EcoRI sites for selection of EcoRI-generated recombinant DNA molecules. Gene 4:121-136. 5. Bolivar, F., R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heynecker, H. W. Boyer, J. H. Crosa, and S. Falkow. 1977. Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2:95-113.
VOL. 165, 1986 6. Cohen, S. N., A. C. Y. Chang, and L. Hsu. 1972. Nonchromosomal antibiotic resistance in bacteria: genetic transformation of E. coli by R-factor DNA. Proc. Natl. Acad. Sci. USA 69:2110-2114. 7. Coote, J. G. 1972. Sporulation in Bacillus subtilis. Genetic analysis of oligosporogenous mutants. J. Gen. Microbiol. 71:17-27. 8. Donnelly, C. E., and A. L. Sonenshein. 1984. Promoter-probe plasmid for Bacillus subtilis. J. Bacteriol. 157:965-967. 9. Dubnau, D., and R. Davidoff-Abelson. 1977. Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor-recipient complex. J. Mol. Biol. 56:209-221. 10. Emngton, J. 1984. Efficient Bacillus subtilis cloning system using bacteriophage vector 4i105J9. J. Gen. Microbiol. 130:2615-2628. 11. Ferrari, E., D. J. Henner, and J. A. Hoch. 1981. Isolation of Bacillus subtilis genes from a charon 4A library. J. Bacteriol. 146:430-432. 12. Fisher, S. H., M. S. Rosenkrantz, and A. L. Sonenshein. 1984. Glutamine synthetase gene of Bacillus subtilis. Gene 32:427-438. 13. Gilman, M. Z., and M. J. Chamberlin. 1983. Developmental and genetic regulation ofBacillus subtilis genes transcribed by sigma 28-RNA polymerase. Cell 35:285-293. 14. Haldenwang, W. G., N. Lang, and R. Losick. 1981. A sporulation-induced sigma-like regulatory protein from B. subtilis. Cell
23:615-624. 15. Johnson, W. C., C. P. Moran, Jr., and R. Losick. 1983. Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature (London) 302:800-804. 16. LeGrice, S. F. J., and A. L. Sonenshein. 1982. Interaction of B. subtilis RNA polymerase with a chromosomal promoter. J. Mol. Biol. 162:551-564. 17. Losick, R., and J. Pero. 1981. Cascades of sigma factors. Cell 25:582-584. 18. Losick, R., and A. L. Sonenshein. 1969. Changes in the template specificity of RNA polymerase during sporulation of Bacillus subtilis. Nature (London) 224:35-37. 19. Messing, J. 1983. New M13 vectors for cloning. Methods
Enzymol. 101:20-78. 20. Ollington, J. F., W. G. Haldenwang, T. V. Huynh, and R. Losick. 1981. Developmentally regulated transcription in a
TRANSCRIPTION OF THE spoIlD GENE
779
cloned segment of the Bacillus subtilis chromosome. J. Bacteriol. 147:434 442. 21. Rosenkrantz, M. S., D. W. Dingman, and A. L. Sonenshein. 1985. Bacillus subtilis citB gene is regulated synergistically by glucose and glutamine. J. Bacteriol. 164:155-164. 22. Savva, D., and J. Mandelstam. 1985. Use of cloned spoIIA and spoVA probes to study synthesis of mRNA in wild-type and asporogenous mutants of Bacillus subtilis, p. 55-59. In J. A. Hoch and P. Setlow (ed.), Molecular biology of microbial differentiation. American Society for Microbiology, Washington, D.C. 23. Sonenshein, A. L., and H. B. Alexander. 1979. Initiation of transcription in vitro is inhibited by lipiarmycin. J. Mol. Biol. 127:55-72. 24. Sonenshein, A. L., B. Cami, J. Brevet, and R. Cote. 1974. Isolation and characterization of rifampin-resistant and streptolydigin-resistant mutants of Bacillus subtilis with altered sporulation properties. J. Bacteriol. 120:253-265. 25. Sterlini, J. M., and J. Mandelstam. 1969. Commitment to sporulation in Bacillus subtilis and its relationship to development of actinomycin resistance. Biochem. J. 113:29-37. 26. Stragier, P., J. Bounier, C. Bonamy, and J. Szulmajster. 1984. A developmental gene product of Bacillus subtilis homologous to the sigma factor of E. coli. Nature (London) 312:376-378. 27. Tatti, K. M., and C. P. Moran, Jr. 1985. Utilization of one promoter by two forms of RNA polymerase from Bacillus subtilis. Nature (London) 314:190-192. 28. Thomas, P. T. 1980. Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77:5201-5205. 29. Trempy, J. E., C. Bonamy, J. Szulmajster, and W. G. Haldenwang. 1985. Bacillus subtilis v factor Ca29 is the product of the sporulation-essential gene spoIIG. Proc. Natl. Acad. Sci. USA 82:4189-4192. 30. Trempy, J. E., J. Morrison-Plummer, and W. G. Haldenwang. 1985. Synthesis of sigma 29, an RNA polymerase specificity determinant, is a developmentally regulated event in B. subtilis. J. Bacteriol. 161:340-346. 31. Wang, S.-L., C. W. Price, D. S. Goldfarb, and R. H. Doi. 1984. The subtilisin E gene of Bacillus subtilis is transcribed from a a' promoter in vivo. Proc. Natl. Acad. Sci. USA 81:1184-1188. 32. Zuber, P., and R. Losick. 1983. Use of a lacZ fusion to study the role of the spoO genes of Bacillus subtilis in developmental regulation. Cell 35:275-283.
