Oncogene (2005) 24, 1873–1881
& 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc
Transcriptional cross-regulation of RUNX1 by RUNX3 in human B cells Lindsay C Spender1,2,3, Hannah J Whiteman1,2, Claudio Elgueta Karstegl1 and Paul J Farrell*,1 1
Department of Virology, Ludwig Institute for Cancer Research, Imperial College Faculty of Medicine, Norfork Place, St Mary’s Campus, Norfolk Place, London W2 1PG, UK
RUNX transcription factors are important in development and in numerous types of human cancer. They act as either transcriptional activators or repressors and can be protooncogenes or tumour suppressors. Understanding their regulation and interaction may explain how RUNX factors contribute to such different and often opposing biological processes. We show that RUNX3 regulates RUNX1 expression, contributing to the mutually exclusive expression of RUNX3 and RUNX1 in human B lymphoid cell lines. RUNX3 repressed the RUNX1 P1 promoter by binding specifically to conserved RUNX sites near the transcription start of the promoter. siRNA inhibition of RUNX3 in lymphoblastoid cells resulted in increased RUNX1 expression, indicating that continuous expression of physiological levels of RUNX3 is required to maintain repression. Furthermore, expression of RUNX3 was required for efficient proliferation of B cells immortalized by Epstein–Barr virus. Cross-regulation between different RUNX family members is therefore a means of controlling RUNX protein expression and must now be considered in the interpretation of pathological changes due to loss of RUNX3 tumour suppressor function or following gene duplication or translocation events. Oncogene (2005) 24, 1873–1881. doi:10.1038/sj.onc.1208404 Published online 31 January 2005 Keywords: RUNX3/RUNX1/EBNA-2; Epstein–Barr virus; B cells
Introduction RUNX transcription factors are important in numerous developmental and differentiation pathways. There are three mammalian family members, RUNX1, RUNX2 and RUNX3 localized on chromosomes 21q22.12, 6p21 and 1p36.1, respectively (Levanon et al., 1994). RUNX1 (also called AML-1) is essential for definitive haematopoiesis (Okuda et al., 1996; Lacaud et al., 2002), maturation of adult megakaryocyte, T and B cell *Correspondence: P J Farrell; E-mail:
[email protected] 2 These authors contributed equally to the work 3 Current address: The Beatson Institute for Cancer Research, Garscube Estate, Switchback Road, Bearsden, Glasgow G61 1BD, UK Received 11 August 2004; revised 18 October 2004; accepted 26 November 2004; published online 31 January 2005
lineages (Ichikawa et al., 2004), and is a target for chromosomal translocation in acute myelogenous leukaemia (Miyoshi et al., 1991). RUNX2 (AML-3) is essential in osteogenesis (Komori et al., 1997; Fujita et al., 2004; Yoshida et al., 2004), whereas RUNX3 (AML-2) has important functions in neurogenesis (Inoue et al., 2002; Levanon et al., 2002), growth regulation of gastric epithelial cells (Li et al., 2002), TGF-b signalling (Shi and Stavnezer, 1998; Fainaru et al., 2004) and thymopoiesis (Taniuchi et al., 2002; Woolf et al., 2003). Recent studies have shown that loss of RUNX3 expression, usually through allelic loss and epigenetic changes, is associated with hepatocellular carcinoma, testicular yolk sac tumours, gastric and pancreatic cancers (Guo et al., 2002; Kato et al., 2003; Wada et al., 2004; Xiao and Liu, 2004), RUNX3, therefore, has important tumour suppressor function as an integral part of TGFb apoptotic signalling pathways. The a-subunit RUNX proteins form heterodimeric DNA binding complexes with a common b-subunit (CBFb), and are considered to bind to the same DNA recognition sequence, ACCACA. Despite this, RUNX heterodimers regulate a remarkably diverse array of biological functions including gene repression and activation and play a role in oncogenesis as well as in tumour suppression (reviewed in Cameron and Neil, 2004). The diverse functional outcomes of RUNX activity appear to be dependent on context. RUNX proteins are generally poor activators by themselves but known cofactors include C/EBPa (Zhang et al., 1996), ETS family members, SMADs (Zhang and Derynck, 2000), p300/ CBP and c-myb (Martensson et al., 2001), while interactions with the groucho homologue TLE (Aronson et al., 1997; Levanon et al., 1998; Javed et al., 2000) and mSin3A (Lutterbach et al., 2000) mediate repression of target genes (reviewed in Durst and Hiebert, 2004). Spatial and temporal expression patterns of RUNX1 and RUNX3 studied during embryogenesis also indicate nonredundant functions of the RUNX family members. In some tissues, expression of RUNX1 and RUNX3 overlap, for example, in haematopoietic cells in the liver and in the thymus. However, in other tissues, expression is confined to different compartments. These studies have suggested that crossregulation may play an important role in RUNX expression patterns (Levanon et al., 2001) although control at this level has not yet been demonstrated. Our previous studies identifying novel cell target genes of the Epstein–Barr virus transcription factor
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1874
EBNA-2 showed that RUNX3 is induced upon EBV infection of primary B cells. EBNA-2 is essential for B cell immortalization and partly resembles activated notch in function (Strobl et al., 1997, 2000; Hofelmayr et al., 1999, 2001). Induction of RUNX3 was associated with a rapid decrease in RUNX1 present in quiescent B cells. PMA stimulation of B cells had similar effects on RUNX3 and RUNX1 showing that this coordinate regulation is not dependent upon, or confined to, virally induced immortalization. RUNX protein expression is also tightly regulated in B cell lines, where RUNX1 is associated with the latency I phenotype in Burkitt’s Lymphoma (BL) cells but RUNX3 is highly expressed in lymphoblastoid cells and in BL Group III lines (Spender et al., 2002). Here we show that crossregulation occurs between RUNX3 and a RUNX1 promoter, accounting for the mutually exclusive expression of these proteins in specific human B cell types. The demonstration that RUNX transcription factors can be regulated by other members of the RUNX family may help explain their diverse functions and has important implications for the interpretation of pathologies associated with RUNX gene knockout or amplification.
Results We previously showed that proliferation of primary human B cells driven by PMA, or by EBV infection,
results in increased RUNX3 expression concurrent with a dramatic decrease in RUNX1 expression. This highly coordinated regulation of the two RUNX transcription factors was also observed in BL cell lines, where exclusive expression of either RUNX1 or RUNX3 is associated with different EBV latency phenotypes (Spender et al, 2002 and Table 1). We therefore investigated whether induction of RUNX3 might directly regulate RUNX1 expression. RUNX3 represses expression of RUNX1 To study potential regulation of RUNX1 by RUNX3, inducible RUNX3 expression was established in cells normally expressing high levels of endogenous RUNX1. Different RUNX3 isoforms are generated from two promoters, P1 and P2 (Figure 1a) (Bangsow et al., 2001; Rini and Calabi, 2001). We first used RUNX3 promoter Table 1 Cell line Primary B DG75 Akata 31 P3HR1 IB4 EREB2.5 (est) EREB2.5 (+est)
RUNX protein expression in human B cells EBV
Group
EBNA-2
RUNX1
RUNX3
+ + + +
BL BL BL II LCL LCL LCL
+ n.f. +
++ /+ ++ ++
+ /+ ++ /+ ++
BL ¼ Burkitt’s lymphoma; LCL ¼ lymphoblastoid cell line; nf ¼ nonfunctional (cytoplasmic) protein
Figure 1 RUNX3 P2 is activated in proliferating B cells. (a) Diagram of RUNX3 gene organization showing promoters P1 and P2. The positions of promoter specific RPA probes that span transcription start sites are shown as a solid bar. (b) RUNX3 P2 specific RPA of RNA from EREB2.5 cells. Cells were starved of oestrogen for 5 days and were then left unstimulated () or were activated ( þ ) by oestrogen addition for either 6 or 8 h. Duplicate experiments are shown. (c) RNA from freshly isolated primary B cells or cells mock infected (EBV) or EBV infected ( þ EBV) for 55 hours were analysed using a RUNX3 P2 specific RPA. (d) RUNX3 P2 transcripts detected by RPA in a panel of RUNX3 positive lymphoblastoid cell lines (LCL-C, LCL3, EREB2.5) and Group III Burkitt’s lymphoma (Mutu cl148) compared with RUNX3 negative Burkitt’s lymphoma cells (Akata 31, BL2, P3HR1 and Mutu cl179) Oncogene
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1875
specific RNase protection assays (RPA) to determine which RUNX3 isoforms are induced during B-cell stimulation. Activation of conditional EBNA-2 in EREB2.5 cells (Figure 1b) or infection of primary B cells with EBV (Figure 1c) resulted in increased RUNX3 proximal (P2) promoter activity. This result was confirmed by isoform specific RT–PCR (data not shown). RNA derived from a panel of lymphoblastoid cell lines (LCLs, Figure 1d) also contained abundant P2 transcripts. No RUNX3 RNA was detected in a panel of B cell lines using a P1 promoter specific RPA (data not shown). EBV-negative Akata 31 BL cells were therefore stably transfected with inducible expression plasmids containing RUNX3 cDNA derived from the P2 promoter. Cell extracts were analyzed by Western blotting for RUNX protein expression following induction with cadmium chloride (Figure 2a). The two inducible cell lines (pMEP4-RUNX3.A and pMEP4-RUNX3.B) expressed high levels of RUNX3 within 6 h, which was accompanied by a substantial decrease in RUNX1 protein level. Expression of the b-subunit CBFb was unaltered, indicating that the effect of RUNX3 on RUNX heterodimer components was specific for the a-subunit RUNX1 (Figure 2a). Similar reductions in RUNX1 protein levels were also observed after constitutive expression of RUNX3 in P3HR1 BL cells (data not shown). To test whether normal physiological levels of RUNX3 repress RUNX1 expression, we used siRNA to knock down RUNX3 expression in LCLs. To allow
Figure 2 RUNX3 expression regulates RUNX1 protein levels. (a) Akata 31 cells expressing endogenous RUNX1 were used to generate stable control cell lines containing empty vector (pMEP4.A) or lines containing inducible RUNX3 under the control of the metallothionine promoter (pMEP4-RUNX3.A and pMEP4RUNX3.B). RUNX3 was induced by the addition of cadmium chloride at 5 mM for the times indicated. RIPA extracts were prepared and 50 mg protein analysed by SDS–PAGE. Western blotting for RUNX3 was carried out, the membrane stripped and then reprobed for RUNX1 and CBFb. (b) EREB2.5 cells stably transfected with control plasmids (Super), plasmids expressing constitutive RUNX3 siRNA (30 and 118) and plasmids expressing constitutive siRNA for p53 (two lines are shown for each plasmid). Western blotting for RUNX3, RUNX1 and b-actin was carried out as described above
efficient siRNA expression in these EBV infected cell lines, the pSUPER vector was modified to include the relevant siRNA, EBV oriP and the hygromycin resistance marker and stably transfected lines were established. EREB2.5 cells constitutively expressing RUNX3 siRNA (30 and 118) showed reduced RUNX3 levels compared with control lines (Super and p53, Figure 2b). As the RUNX3 siRNA inhibited cell proliferation (see below), constitutive knockdown of RUNX3 could not be maintained for prolonged periods of time, but in lines showing a substantial reduction of RUNX3 (four such lines are shown in Figure 2b) increased expression of RUNX1 was observed. RUNX3 present at physiological levels therefore regulates RUNX1 protein expression. We next investigated whether RUNX3 repressed RUNX1 transcription. RUNX3 represses transcription from the RUNX1 P1 promoter The distal P1 promoter of RUNX1 controls expression of the AML-1c isoform (referred to in this study as RUNX1c), whereas the P2 promoter expresses AML-1a and AML-1b (Figure 3a) (Miyoshi et al., 1995). Western blots of BL and primary B cell extracts identified RUNX1c as the isoform expressed in B cells (Figure 3b). The RUNX1 was not recognized by an antibody specific for the unique N terminus of the P2 isoforms, but was recognized by an antibody raised against the Runt domain present in all RUNX1 proteins (an antibody specific only for the RUNX1c isoform is not available). The results were confirmed by RPA specific for P1 or P2 transcripts. The RNA transcripts shown in Figure 3c are P1 transcripts detected in total cell RNA extracts from BL and primary B cells. The numerous protected bands detected in this assay reflect the presence of several different start sites. No protected bands were observed in RPAs specific for P2 transcripts (data not shown). Having established that the RUNX1 P1 promoter was active in B cells, the pMEP4-RUNX3 inducible Akata31 cells were analysed using the P1 specific RPA. The abundance of RUNX1c transcripts decreased following RUNX3 induction (Figure 4a). RUNX1c transcripts were also detected in EREB2.5 cells (lines 30E and 30F) where endogenous RUNX3 was inhibited by the constitutive expression of RUNX3 siRNA (Figure 4b). These data show that RUNX3 regulates RUNX1 transcription controlled by the P1 promoter. Since P1 becomes transcriptionally active in the absence of normal levels of RUNX3, continued RUNX3 expression is required for maintenance of RUNX1 repression in lymphoblasts. RUNX3 binding sites in the P1 promoter mediate repression The mechanism of RUNX1 regulation was analysed by testing the RUNX1 P1 50 -UTR for sensitivity to RUNX3 mediated repression in transient transfection assays. The luciferase reporter construct pGL3-RUNX1 P1 containing nucleotides 151 to þ 100 relative to the transcripOncogene
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1876
Figure 3 RUNX1 isoform expression in human B cells (a) Schematic representation of the two promoters regulating RUNX1 expression. Arrows indicate the start of transcription and exons are numbered. The position of the runt domain is shown, P represents the region used as a probe in RPA and E1 and E2 are positions of the epitopes recognized by two anti-RUNX1 antibodies. (b) Western blot analysis of extracts from a panel of BL, LCL, primary B cells using anti-RUNX1 N-terminus and anti-RUNX1 runt domain antibodies recognizing E1 and E2 epitopes, respectively. Jurkat T cell and LCL C extracts are positive and negative controls respectively. (c) In total, 10 mg total cell RNA from primary B cells, BL and LCLs was analysed by RPA for transcription from the RUNX1 distal promoter (P1). M, P and Y indicate size markers, undigested probe and yeast negative control respectively
tion start was cotransfected with RUNX3 expression plasmids into DG75 cells. After 48 h samples were assayed for luciferase (and b-galactosidase to control for Oncogene
transfection efficiency). Activity of the RUNX1 P1 promoter was high in DG75 cells but co-expression of RUNX3 with the reporter construct resulted in a substantial dose-dependent decrease in its activity (Figure 5a). Similar results were obtained with two different RUNX3 expression plasmids (Figure 5a and 5e). We determined which elements in the 50 -UTR contribute to RUNX3 mediated repression. The RUNX1 P1 promoter has previously been assayed for basal activity in HEK cells and Jurkat T cells. Several transcription factor binding sites potentially involved in RUNX1 regulation were identified between 139 and 12 relative to the transcription start, including PU.1, CRE and a RUNX-like site upstream of an Myb binding site. However, previous mutational analysis of these sites showed that they are involved in RUNX1 transcription but they are not sufficient to mediate cell type specific expression (Ghozi et al., 1996). We tested two oligonucleotides containing putative RUNX binding sites in electromobility shift assays (EMSAs). An oligonucleotide (73 to 45) containing a partial match (TGTGGA) to the consensus RUNX site and an Myb site did not form complexes with RUNX proteins present in nuclear extracts from Akata 31 RUNX3 inducible cell lines (data not shown). We therefore focussed on the two RUNX sites (labelled site 1 and site 2) near the transcription start that are conserved in the P1 promoters of all human RUNX genes (Drissi et al., 2000). An oligonucleotide containing the two RUNX binding sites (shown in Figure 5b as an expanded sequence) bound to RUNX factors in nuclear extracts. The EMSA (Figure 5c) demonstrates that complexes formed with extracts from uninduced pMEP4.A and pMEP4-RUNX3.A cells both contained RUNX1, since they were supershifted in the presence of a RUNX1 specific antibody. Nonspecific antibodies and RUNX3 specific antibodies did not affect these complexes. In induced pMEP4-RUNX3.A cells, the complexes formed were more abundant and contained RUNX3, as demonstrated by a supershift with a RUNX3 specific antibody. We analysed which of the two RUNX sites mediated binding in the EMSA by competition assay (Figure 5d). Oligonucleotides containing single mutations in either site 1 or site 2 were able to compete as well as wild-type cold oligonucleotide. Hence, both sites appear capable of binding RUNX factors but oligonucleotides mutated at both RUNX sites 1 and 2 were unable to inhibit complex formation. Since mutation of both RUNX sites was required to completely inhibit RUNX binding, we mutated both RUNX sites in the luciferase reporter construct and assayed the construct for its basal activity and its responsiveness to RUNX3 repression (Figure 5e). Although the band shift data showed that RUNX1 P1 oligonucleotides can bind RUNX1 in the absence of RUNX3 induction, the activity of P1 in the context of the luciferase reporter construct was scarcely affected by the double RUNX site mutation. This suggests that RUNX1 does not significantly affect expression from the P1 promoter in these cells. In contrast, the ability of RUNX3 to repress P1 was severely affected by the
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1877
Figure 4 Transcription from the RUNX1 P1 promoter is regulated by RUNX3. (a) and (b) RUNX3 inducible cell lines described in Figure 2a EREB2.5 RUNX3 siRNA cells described in Figure 2b were analysed by RPA for the effect of RUNX3 levels on transcription from the RUNX1 distal promoter. In total, 10 mg and 1 mg total cell RNA was analysed for RUNX1 and GAPDH transcripts, respectively
double mutation. Repression of RUNX1 in human B cells is thus mediated by RUNX3 binding to RUNX sites present near the transcription start of the RUNX1 P1 promoter, but basal transcription of RUNX1c appears to be regulated by factors binding to other elements. These factors are likely to determine the differential Group I/Group III expression of RUNX1 and RUNX3 observed in BL cell lines. We initially identified RUNX3 in a screen to identify cell genes regulated by the essential EBV transcription factor EBNA-2. A key question, therefore, is whether RUNX3 is a significant mediator of the effects of EBV in B cell immortalization. Reducing the levels of RUNX3 in lymphoblastoid cells using RUNX3 RNAi and shifting the balance in favour of RUNX1 expression substantially reduced the ability of the lymphoblastoid cells to proliferate (Figure 6a). The effect on proliferation was not due to any gross changes in the level of expression of EBNA-2 or LMP1 (EBV genes essential for maintenance of continuously proliferating LCLs) (Figure 6b). Also, no changes were detected in the levels of Bcl-6, p14ARF, c-myc or cyclin D2 (data not shown). Relative expression levels of RUNX family members therefore have an important role to play in the proliferation of latency III EBV infected B cells, which are associated with posttransplant lymphoproliferative or AIDS related immunoblastic lymphomas.
Discussion In this study we analysed the highly regulated expression of RUNX proteins in human B cells and present data that account for the mutually exclusive expression of RUNX3 and RUNX1 in primary B cells and BL lines. RUNX1c appears to be the default RUNX protein expressed in quiescent B cells and in Group I BL cells. B cell activation, either by addition of PMA or initiation of the Epstein–Barr virus latency III (growth pro-
gramme), induced RUNX3 transcribed from the P2 promoter. The induced RUNX3 then repressed RUNX1c expression. RUNX3 was shown to regulate RUNX1 transcription via two RUNX binding sites near the transcription start of the P1 promoter. Mutation of these two sites inhibited RUNX3 mediated repression but did not appear to affect transcription from P1, suggesting that RUNX proteins are not important in basal RUNX1 P1 promoter activity. The transcriptional effects we demonstrated are sufficient to account for changes in expression of the RUNX proteins, but we cannot exclude that there might also be some contribution from RUNX protein stability effects. Previous studies have shown that heterodimerization of RUNX with CBFb stabilizes RUNX proteins by decreasing degradation rates (Huang et al., 2001). Since RUNX proteins all bind CBFb with approximately equal affinity, alterations in RUNX3 levels might affect RUNX1 turnover by competition for CBFb binding. There is however no evidence that this is quantitatively significant in our system and the changes in mRNA level are sufficient to account for the RUNX expression observed. Our data support earlier studies that implicate other factors in basal RUNX1 promoter activity including PU.1, CRE and CCAAT. However, deletion and mutational analysis of these binding sites suggested that they did not contribute to cell type specific expression of RUNX1 (Ghozi et al., 1996). The data presented here identifies RUNX3 as the determining factor for RUNX1 expression in certain B cell types. This conclusion is supported by the observation that re-expression of RUNX1 was detected in lymphoblastoid cells treated with RUNX3 siRNA. It is not yet known how RUNX3 is induced by PMA stimulation or by the EBV transcription factor EBNA-2. Since activated Notch can regulate many of the same genes as EBNA-2 (Hofelmayr et al., 1999; Strobl et al., 2000), it is possible that Notch would also induce RUNX3 transcription. There is evidence in Drosophila that RUNX proteins are involved in Notch signalling since the runt domain gene Lozenge is regulated by signalling Oncogene
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1878
Figure 5 RUNX3 represses the RUNX1c promoter. (a) At 48 h transient transfection assay in DG75 cells of a RUNX1c promoterluciferase reporter construct (pGL3-RUNX1 P1 -151 þ 100) co-transfected with a RUNX3 expression plasmid (pCMV-RUNX3). Results are representative of several independent assays and are expressed as the mean7s.d. of three transfections. Relative luciferase units were adjusted for transfection efficiency according to b-galactosidase levels. (b) Diagram of RUNX1 distal promoter region. An arrow shows the position of the published transcription start site ( þ 1) (Ghozi et al., 1996) and arrow heads show further start sites identified during the RPA analysis shown in Figure 3c. Putative transcription factor binding sites are annotated. The expanded sequence of the oligonucleotide near the transcription start of P1 contains two consensus RUNX sites (underlined) designated site 1 and site 2. (c) 32P-labelled wild-type oligonucleotide analysed by EMSA for binding of RUNX factors present in nuclear extracts from Akata 31 cells. Uninduced () and cadmium chloride induced control (pMEP4.A) and RUNX3 inducible cells (pMEP4-RUNX3.A) were analysed. 1 mg of antibodies recognizing RUNX1 or RUNX3 or a nonspecific (ns) control antibody were added in supershift reactions (d) Cold competitor oligonucleotides of wild-type sequence (wt) or mutated at RUNX site 1 (mut1), site 2 (mut2) or both sites (mut1 þ 2) were used to compete with 32P-labelled wt oligonucleotide in EMSAs of nuclear extract from uninduced or induced pMEP4RUNX3 cells. (e) Transient transfection assay of wild-type RUNX1 P1-luciferase reporter construct (pGL3-RUNX1 P1) or doublemutant RUNX1c P1-luciferase reporter construct (pGL3-mutRUNX1 P1) co-transfected with 5 mg RUNX3 expression plasmid (pBKRUNX3). Results are presented as described above
activated by the Notch ligand Serrate (Lebestky et al., 2003). As RUNX3 is a direct target of EBNA-2, Notch signalling via Jagged1 (the mammalian homologue of the ligand Serrate) may also regulate RUNX3. Oncogene
We have shown that one functional consequence of disrupting the balance between RUNX3 and RUNX1 in LCLs is a decrease in the ability of the cells to proliferate. A question arising from this data is whether it is the
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1879
demonstrated for RUNX2 (Drissi et al., 2000) using the effect of overexpression of RUNX2 on reporter constructs. We have clearly demonstrated that cross-regulation of the RUNX1 P1 promoter occurs by the isoform of the RUNX3 gene expressed from the P2 promoter in human B cells. The two RUNX binding sites in the RUNX1 P1 promoter are conserved in the P1 promoter sequences of RUNX2 and RUNX3 so it seems likely that this will also be a more general form of regulation. The crossregulation will be an important consideration in the interpretation of studies of RUNX gene function and the pathological mechanisms of diseases in which RUNX gene expression is altered. Figure 6 RUNX3 siRNA treatment of LCLs affects proliferation rate. (a) Cells were counted by trypan blue exclusion every 2 days for 6 days in total. The results presented show the average cell number7standard deviation of multiple determinations for each cell line. (b) SDS–PAGE analysis of 50 mg RIPA extract from RUNX3 siRNA treated (30 and 118) and control cell lines (Super and p53)
increase in RUNX1, the decrease in RUNX3, or the change in the levels of both proteins that affects proliferation. In our system the functional effects of individual RUNX proteins are difficult to assess since their expression is so inter-dependent. The RUNX1c protein is highly expressed in quiescent B cells, suggesting that it could have a role in maintaining cells in a resting state. The situation in BL cell lines may be different as these cells can proliferate efficiently expressing RUNX1 or RUNX3 (in Group I or Group III cells, respectively). All BL cells, regardless of their phenotype, have deregulation of c-Myc expression due to a chromosomal translocation that juxtaposes the c-myc gene to one of the immunoglobulin loci. Several studies show that RUNX proteins and c-Myc cooperate in tumour formation (Wotton et al., 2002), and that c-Myc can overcome cell cycle inhibition by dominant-negative inhibitors of RUNX function in AML cells (Bernardin et al., 2002). In retrovirus insertional mutagenesis experiments in CD2-MYC transgenic mice, deregulated RUNX1, RUNX2 or RUNX3 (expressed from P1) were found to contribute to the formation of T cell lymphomas. It is not known whether deregulated RUNX proteins would also behave as oncogenes in B cells, but it would be of interest to establish whether EBV mediated effects on RUNX protein expression cooperate in any way with c-myc translocation during the development of BL. It is interesting to consider whether cross-regulation of RUNX promoters by other family members could be used as a therapeutic approach to inhibit the expression of aberrant, mutated RUNX proteins or fusion proteins expressed in leukaemias. So far, our data have only demonstrated that this would be possible if the protein were expressed from the P1 promoter (such as the AML1USP25 fusion protein (NCBI Accession Number AAL16813) and if crossregulation occurred in the particular cell type relevant to the disease. Another consideration is whether autoregulation of the RUNX3 P1 promoter by RUNX3 occurs. This type of autoregulation has been
Materials and methods Plasmid construction pMEP4-RUNX3 was made by cutting pCMV-AML2 (kindly provided by Scott Hiebert) with BamH1 and HindIII and cloning RUNX3 (AML-2) cDNA into the BamH1/HindIII site of pMEP4 (Invitrogen). pBK-RUNX3 was made by cutting pCMV-AML-2 with Pst1 and BamH1 and cloning RUNX3 cDNA into pBK-CMV (Stratagene). pGL3-RUNX1 P1 was made by PCR amplification of 151 þ 100 relative to the published transcription start of the RUNX1 P1 promoter (Ghozi et al., 1996) using the primers described for the RUNX1 P1 RPA probe. The PCR product was then subcloned into pCR-BluntII-TOPO (Invitrogen) and following XhoI and HindIII digestion was cloned into pGL3-basic (Promega). The promoter regions of all reporter plasmids were sequenced. Mutation of pGL3-RUNX1 P1 was carried out using Quikchange Site-directed mutagenesis kit (Stratagene) as recommended by the manufacturer. pHEBoSUPER was constructed as follows: the HindIII site was removed from pHEBo by cutting with HindIII, filling the overhanging ends with Klenow DNA polymerase and religating the blunt ends. The BamHI to XhoI portion of pSUPER containing the H1 promoter and polylinker was cloned between the BamHI and SalI sites of pHEBo (lacking HindIII site). The siRNA oligonucleotides were then cloned between the unique HindIII and BglII sites of the polylinker as described for p53 (Brummelkamp et al., 2002). The RUNX3 sequences targeted were TGACGAGAACTACTCCGCT using the oligonucleotides RUNX3-2F; GATCCCCTGACGAGAACTACTCC GCTTTCAAGAGAAGCGGAGTAGTTCTCGTCATTTTT GGAAA and RUNX3-2R; AGCTTTTCCAAAAATGACGA GAACTACTCCGCTTCTCTTGAAAGCGGAGTAGTTCT CGTCAGGG. Primary B cell isolation and EBV infection Peripheral blood B cells were isolated by CD19 positive selection and were infected with Epstein–Barr virus as described previously (Spender et al., 1999). Cell lines DG75 (Ben-Bassat et al., 1977) and Akata 31 are EBV negative BL cell lines. IB4 is an EBV-immortalized LCL generated by infection of cord blood and LCL-C was generated using peripheral blood B cells infected with B95-8 virus. Other B cell lines are as described previously (Spender et al., 2002). The cell lines were maintained in RPMI-1640 media (Gibco-BRL) supplemented with 10–20% (v/v) heat-inactivated foetal calf serum (FCS), glutamine and antibiotics. EREB2.5 cells Oncogene
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1880 (Kempkes et al., 1995) contain a conditional EBNA-2 regulated by oestrogen and were maintained in RPMI-1640 without phenol red (Gibco-BRL) supplemented with 10% heat-inactivated FCS, antibiotics and 1 mM b-oestradiol. Akata cell lines stably transfected with pMEP4-RUNX3 were maintained in RPMI-1640 supplemented with 10% FCS, glutamine, antibiotics and 300 mg/ml hygromycin. EREB2.5 cells stably transfected with pHEBoSuper siRNA constructs were maintained in RPMI-1640 without phenol red supplemented with 20% FCS, antibiotics, 1 mM b-oestradiol and 125 mg/ml hygromycin. Immunoblotting and antibodies RIPA lysates were prepared, quantitated and immunoblotting performed as described previously (Brimmell et al., 1998). Proteins were fractionated by SDS–polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes. After blocking with 10% milk powder in PBS/0.05% Tween 20, membranes were probed with the following antibodies: antiEBNA-2, anti-LMP-1 (S12) as described (Mann et al., 1985; Spender et al., 2002), 1/40 dilutions of rabbit polyclonals (Oncogene research products) anti-AML-1 (RUNX1) RHD (Ab-2), anti-AML-2 (RUNX3) (Ab-1), CBF-b (Ab-1) and 1/25 dilution of anti-AML-1 (RUNX1) N-terminus (Ab-1, raised against the peptide MRIPVDASTSRRFTPP). In total, 1/5000 dilution of mouse monoclonal anti b-actin (AC-15, Sigma). In total, 1/1000 dilution of anti-PCNA (PC-10). Secondary antibodies were horseradish peroxidase HRP-conjugated goat antirabbit immunoglobulin (Ig) (Dako) and HRP-conjugated sheep anti-mouse Ig (Amersham). Bound immunocomplexes were detected by enhanced chemiluminescence (ECL; Amersham). RNase protection assay (RPA) Total cell RNA was extracted using RNAzol B and quantified by its absorbance at 260 nm. Probes for use in RPAs were generated by PCR of genomic DNA derived from DG75 B cells using the following primers: RUNX1 P1 (distal) forward 50 -AAGGAAGGGCATTGCTCAGA-30 and reverse 50 -ACCCTGTGGTTTGCATTCAG-30 (252 bp) and RUNX1 P2 (proximal) forward 50 -ATACCGGAAAGGCCTGTGAT-30 and reverse 50 -AGAGGTTGACTTCCTTCTGG-30 (249 bp). RUNX3 P1 forward 50 -AAGAGAGGCAGCCACAAGAT-30 and reverse 50 -TGAGGCTTACCCTTGACAGA-30 and RUNX3 P2 forward 50 -GGGACCCGGACGTTCTAAGC-30 and reverse 50 -TCGTGGCTGTCCCGGCTGCCT-30 . PCR products were cloned into pCR2.1-TOPO, sequenced and the plasmid linearized at the 50 end of the PCR product. RPAs were carried out as recommended by the manufacturer’s of the RPA III RNase protection assay kit (Ambion). Briefly, 1 mg of linearized plasmid was used to generate 32P-labelled antisense RNA probes. Cellular RNA was hybridized overnight at 421C with 50 000 CPM of the probe. An equivalent amount of yeast RNA was included in a hybridisation reaction as a negative control. Single-strand RNA was digested with an RNase A/T1 mixture for 30 min at 371C. Protected fragments were precipitated, separated on an acrylamide gel and the gel analysed on a phosphoimager.
Transient transfection assays Exponentially growing cells (8 106) were electroporated at 250 mV, 960 mF in 0.4 cm. cuvettes (Bio-rad). Each transfection contained 0.5 mg pCMV-bgal and 1 mg reporter construct. The total amount of DNA transfected was approximately 10 mg and was normalized by addition of empty vector (either pCMV or pBK). Following electroporation, cells were resuspended in 10 ml conditioned medium and incubated for 48 h. Cell pellets were harvested and lysed in 60 ml luciferase reporter lysis buffer (Promega). In total, 20 ml of lysate was analysed for luciferase activity and an additional 20 ml assayed for b-galactosidase activity using chlorophenolred-b-D-galactopyranoside as a substrate. Cell proliferation Cell proliferation rate was measured by counting viable cells using trypan blue exclusion. Briefly, 2.5 105 cells were seeded into 24-well plates and incubated at 371C for 6 days. Cells were counted and subcultured 1 in 3 (v/v) every 2 days to prevent density saturation. Electrophoretic mobility shift assay Nuclear extracts were prepared by washing cells in PBS, followed by Buffer A (10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF and protease inhibitor cocktail (Boehringer Mannheim)). Nuclei were isolated by lysing cells in Buffer A containing 0.1% (v/v) NP40, on ice for 5 min and centrifugation at 5800 g for 30 s. Nuclei were then lysed in Buffer B (20 mM HEPES pH 7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 25% glycerol (v/v), 1 mM DTT, 0.5 mM PMSF and 1 protease inhibitor cocktail (Boehringer Mannheim)) at 41C for 15 min. Cell debris was removed by centrifugation at 11 600 g for 10 min at 41C and the protein concentration determined (Bio-Rad). Aliquots of extract were stored at 701C. Wild type and mutant double-stranded oligonucleotides used for analysis of the RUNX1 distal (P1) promoter were as follows: wild type, AAACAACCACAGAACCACAAGTT; site 1 mutant (mut 1), AAACACTAACAGAACCACAA GTT; Site 2 mutant (mut 2), AAACAACCACAGACTAACAAGTT; and double mutant of site 1 and 2 (mut 1 þ 2), AAACACTAACAGACTAACAAGTT. Oligonucleotides were end labelled with [a32-P] dGTP using Klenow DNA polymerase. Reactions were carried out in a total reaction volume of 14 ml containing 10 mg nuclear extract, 20 mM HEPES pH 7.9, 0.1 M KCl, 0.2 mM EDTA, 20% glycerol (v/v), 0.5 mM PMSF, 10.5 mM DTT, 1 protease inhibitor cocktail, 5 mg BSA and 2 mg poly (dI-dC) (Sigma) and preincubated with cold competitor oligonucleotides or antibodies at 251C for 5 min if required. In total, 250 000 counts (approximately 100 ng) of 32P-labelled probe was added and the reaction mixture incubated at 251C for 30 min. Complexes were separated on a nondenaturing 4% acrylamide gel that was then fixed in 10% acetic acid, 45% ethanol (v/v), dried and analysed by phosphorimager.
References Aronson BD, Fisher AL, Blechman K, Caudy M and Gergen JP. (1997). Mol. Cell Biol., 17, 5581–5587. Bangsow C, Rubins N, Glusman G, Bernstein Y, Negreanu V, Goldenberg D, Lotem J, Ben-Asher E, Lancet D, Levanon D and Groner Y. (2001). Gene, 279, 221–232. Oncogene
Ben-Bassat H, Goldblum N, Mitrani S, Goldblum T, Yoffey JM, Cohen MM, Bentwich Z, Ramot B, Klein E and Klein G. (1977). Int. J. Cancer, 19, 27–33. Bernardin F, Yang Y, Civin CI and Friedman AD. (2002). Cancer Biol. Ther., 1, 492–496.
Cross-regulation of RUNX1 by RUNX3 LC Spender et al
1881 Brimmell M, Mendiola R, Mangion J and Packham G. (1998). Oncogene, 16, 1803–1812. Brummelkamp TR, Bernards R and Agami R. (2002). Science, 296, 550–553. Cameron ER and Neil JC. (2004). Oncogene, 23, 4308–4314. Drissi H, Luc Q, Shakoori R, Chuva De Sousa Lopes S, Choi JY, Terry A, Hu M, Jones S, Neil JC, Lian JB, Stein JL, Van Wijnen AJ and Stein GS. (2000). J. Cell Physiol., 184, 341–350. Durst KL and Hiebert SW. (2004). Oncogene, 23, 4220–4224. Fainaru O, Woolf E, Lotem J, Yarmus M, Brenner O, Goldenberg D, Negreanu V, Bernstein Y, Levanon D, Jung S and Groner Y. (2004). EMBO J., 23, 969–979. Fujita T, Azuma Y, Fukuyama R, Hattori Y, Yoshida C, Koida M, Ogita K and Komori T. (2004). J. Cell Biol., 166, 85–95. Ghozi MC, Bernstein Y, Negreanu V, Levanon D and Groner Y. (1996). Proc. Natl. Acad. Sci. USA, 93, 1935–1940. Guo WH, Weng LQ, Ito K, Chen LF, Nakanishi H, Tatematsu M and Ito Y. (2002). Oncogene, 21, 8351–8355. Hofelmayr H, Strobl LJ, Marschall G, Bornkamm GW and Zimber-Strobl U. (2001). J. Virol., 75, 2033–2040. Hofelmayr H, Strobl LJ, Stein C, Laux G, Marschall G, Bornkamm GW and Zimber-Strobl U. (1999). J. Virol., 73, 2770–2780. Huang G, Shigesada K, Ito K, Wee HJ, Yokomizo T and Ito Y. (2001). EMBO J., 20, 723–733. Ichikawa M, Asai T, Saito T, Yamamoto G, Seo S, Yamazaki I, Yamagata T, Mitani K, Chiba S, Hirai H, Ogawa S and Kurokawa M. (2004). Nat. Med., 10, 299–304. Inoue K, Ozaki S, Shiga T, Ito K, Masuda T, Okado N, Iseda T, Kawaguchi S, Ogawa M, Bae SC, Yamashita N, Itohara S, Kudo N and Ito Y. (2002). Nat. Neurosci., 5, 946–954. Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA, Stifani S, Stein JL, Lian JB, van Wijnen AJ and Stein GS. (2000). J. Cell Sci., 113 (Part 12), 2221–2231. Kato N, Tamura G, Fukase M, Shibuya H and Motoyama T. (2003). Am. J. Pathol., 163, 387–391. Kempkes B, Spitkovsky D, Jansen-Durr P, Ellwart JW, Kremmer E, Delecluse HJ, Rottenberger C, Bornkamm GW and Hammerschmidt W. (1995). EMBO J., 14, 88–96. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S and Kishimoto T. (1997). Cell, 89, 755–764. Lacaud G, Gore L, Kennedy M, Kouskoff V, Kingsley P, Hogan C, Carlsson L, Speck N, Palis J and Keller G. (2002). Blood, 100, 458–466. Lebestky T, Jung SH and Banerjee U. (2003). Genes Dev., 17, 348–353. Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R, Bernstein Y, Goldenberg D, Xiao C, Fliegauf M, Kremer E, Otto F, Brenner O, Lev-Tov A and Groner Y. (2002). EMBO J., 21, 3454–3463. Levanon D, Brenner O, Negreanu V, Bettoun D, Woolf E, Eilam R, Lotem J, Gat U, Otto F, Speck N and Groner Y. (2001). Mech. Dev., 109, 413–417. Levanon D, Goldstein RE, Bernstein Y, Tang H, Goldenberg D, Stifani S, Paroush Z and Groner Y. (1998). Proc. Natl. Acad. Sci. USA, 95, 11590–11595.
Levanon D, Negreanu V, Bernstein Y, Bar-Am I, Avivi L and Groner Y. (1994). Genomics, 23, 425–432. Li QL, Ito K, Sakakura C, Fukamachi H, Inoue K, Chi XZ, Lee KY, Nomura S, Lee CW, Han SB, Kim HM, Kim WJ, Yamamoto H, Yamashita N, Yano T, Ikeda T, Itohara S, Inazawa J, Abe T, Hagiwara A, Yamagishi H, Ooe A, Kaneda A, Sugimura T, Ushijima T, Bae SC and Ito Y. (2002). Cell, 109, 113–124. Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E and Hiebert SW. (2000). J. Biol. Chem., 275, 651–656. Mann KP, Staunton D and Thorley-Lawson DA. (1985). J. Virol., 55, 710–720. Martensson A, Xie XQ, Persson C, Holm M, Grundstrom T and Martensson IL. (2001). Eur. J. Immunol., 31, 3165–3174. Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, Yokoyama K, Soeda E and Ohki M. (1995). Nucleic Acids Res., 23, 2762–2769. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y and Ohki M. (1991). Proc. Natl. Acad. Sci. USA, 88, 10431–10434. Okuda T, van Deursen J, Hiebert SW, Grosveld G and Downing JR. (1996). Cell, 84, 321–330. Rini D and Calabi F. (2001). Gene, 273, 13–22. Shi MJ and Stavnezer J. (1998). J. Immunol., 161, 6751–6760. Spender L, Cannell E, Hollyoake M, Wensing B, Gawn J, Brimmell M, Packham G and Farrell P. (1999). J. Virol., 73, 4678–4688. Spender LC, Cornish GH, Sullivan A and Farrell PJ. (2002). J. Virol., 76, 4919–4927. Strobl LJ, Hofelmayr H, Marschall G, Brielmeier M, Bornkamm GW and Zimber-Strobl U. (2000). J. Virol., 74, 1727–1735. Strobl LJ, Hofelmayr H, Stein C, Marschall G, Brielmeier M, Laux G, Bornkamm GW and Zimber-Strobl U. (1997). Immunobiology, 198, 299–306. Taniuchi I, Osato M, Egawa T, Sunshine MJ, Bae SC, Komori T, Ito Y and Littman DR. (2002). Cell, 111, 621–633. Wada M, Yazumi S, Takaishi S, Hasegawa K, Sawada M, Tanaka H, Ida H, Sakakura C, Ito K, Ito Y and Chiba T. (2004). Oncogene, 23, 2401–2407. Woolf E, Xiao C, Fainaru O, Lotem J, Rosen D, Negreanu V, Bernstein Y, Goldenberg D, Brenner O, Berke G, Levanon D and Groner Y. (2003). Proc. Natl. Acad. Sci. USA, 100, 7731–7736. Wotton S, Stewart M, Blyth K, Vaillant F, Kilbey A, Neil JC and Cameron ER. (2002). Cancer Res., 62, 7181–7185. Xiao WH and Liu WW. (2004). World J Gastroenterol., 10, 376–380. Yoshida CA, Yamamoto H, Fujita T, Furuichi T, Ito K, Inoue K, Yamana K, Zanma A, Takada K, Ito Y and Komori T. (2004). Genes Dev., 18, 952–963. Zhang DE, Hetherington CJ, Meyers S, Rhoades KL, Larson CJ, Chen HM, Hiebert SW and Tenen DG. (1996). Mol. Cell Biol., 16, 1231–1240. Zhang Y and Derynck R. (2000). J. Biol. Chem., 275, 16979–16985.
Oncogene
