Transcriptional regulation and induction of apoptosis - Nature

Gene Therapy (1998) 5, 1631–1641  1998 Stockton Press All rights reserved 0969-7128/98 $12.00 http://www.stockton-press.co.uk/gt

Transcriptional regulation and induction of apoptosis: implications for the use of monomeric p53 variants in gene therapy C Merkle, M Fritsche, M Mundt, R Ja¨hne and B Groner Institute for Experimental Cancer Research, Tumor Biology Center Freiburg, Breisacher Strasse 117, D-79106 Freiburg, Germany

The p53 tumour suppressor protein is a transcriptional activator, which can induce cell cycle arrest and apoptosis. p53 Gene mutations occur in more than 50% of all human tumours. Reintroduction of wild-type p53 but also of oligomerisation-independent p53 variants into tumour cells by gene transfer methods has been considered. We have investigated the biological properties of two carboxy-terminal deletion mutants of p53, p53⌬300 (comprising amino acids 1–300) and p53⌬326 (amino acids 1–326), to evaluate their potential deployment in gene therapy. Transactivation was measured in transiently transfected HeLa and SKBR3 cells. Both monomeric variants showed reduced activities compared with wild-type p53. Individual promoters were differently affected. In contrast to wild-type

p53, monomeric variants were not able to induce apoptosis. We also provided wild-type p53 and p53⌬326 with tetracycline-regulated promoters and stably introduced these constructs into Saos2 and SKBR3 cells. Upon induction, wild-type p53 expressing cells, but not p53⌬326 expressing cells underwent apoptosis. Consistently, only wild-type p53 expressing cells accumulated p21/waf1/cip1 mRNA and protein and showed increased bax, Gadd45 and mdm2 mRNA. Neither wild-type p53 nor p53⌬326 repressed the transcription of the IGF-1R gene in these cell lines. We conclude that the transactivation potential of monomeric, carboxy-terminally truncated p53 is not sufficient to cause induction of the endogenous target genes which trigger apoptosis.

Keywords: p53; carboxy-terminal deletions; oligomerisation; transactivation; induction of apoptosis

Introduction The p53 tumour suppressor gene is one of the most important targets for mutations in human malignancies. Upon cellular stress, such as DNA damage or hypoxia, p53 protein accumulates1,2 and arrests the cell cycle or triggers programmed cell death, apoptosis. This mechanism is thought to prevent the acquisition and propagation of genetic aberrations.3 p53 is a transcription factor and its domain structure has been well defined. The molecule consists of an amino-terminal transactivation domain, a central DNA binding domain and a carboxyterminal oligomerisation domain.4–6 Wild-type p53 transactivates target genes by binding to specific DNA response elements.7–9 Response elements have been found in the p21/waf1/cip1,10–12 mdm2,13,14 Gadd45,15 cyclin G,16 bax17 and IGFBP-318 genes. Mutant p53 variants have been described which discriminate in their transactivation between individual p53 response elements.19–21 Distinct classes of p53-responsive promoters may exist which differ in extent of induction and their sensitivity towards p53 mutants. Regulation of p53 function is often mediated by the carboxy-terminal domain of the protein. Several phosphorylation sites have been detected in this region22,23 and small peptides or antibodies which bind to this

Correspondence: B Groner Received 17 March 1998; accepted 2 July 1998

domain can regulate p53 activity.24,25 Recently, acetylation of a peptide consisting of the amino acids 364–393 from wt p53 was shown.26 Deletion of the last 30 amino acids strongly stimulates p53 to bind to its DNA response element, suggesting the removal of a negatively regulating function. The redox/repair protein Ref-1 was shown to activate p53 by both redox-dependent and independent means acting through the carboxy-terminal region of p53.27 These observations support the model of allosteric activation of p5328,29 in response to genotoxic stress situations. In addition to its sequence-specific transactivation function, p53 can also suppress transcription from cellular and viral promoters,30,31 in particular those containing TATA elements.32 Although transcriptional repression might contribute to some p53-mediated phenotypes,33 it is the transcriptional activation of target genes, in particular of p21/Waf1/Cip1, which is closely correlated with the growth-inhibitory effect of p53.34–36 Under special conditions p53 can induce apoptosis in the absence of transcriptional activation of target genes,37–39 but many cellular systems require transcriptionally active, wildtype p53 for a full apoptotic response.40,41 The divergent observations suggest that transcription-dependent and -independent mechanisms exist, and that their relative importance varies between cell types and is dependent upon experimental conditions. It has been suggested that the heterodimerisation between mutant and wild-type p53 is responsible for the dominant-negative effect which is exerted by the mutant

Monomeric p53 variants and gene therapy C Merkle et al

1632

form over the wild-type.42 For this reason strategies have been devised which aim at the reactivation of wild-type p53 through interference with the oligomerisation process and the release of wild-type from mutant p53.43 We have focused our attention on the function of monomeric p53 variants which lack the oligomerisation domain and which are unable to complex with mutant forms. These variants should elude the dominant-negative influence of mutant p53 and might be useful in a gene therapeutic setting. We investigated the effects of p53 truncation mutants on the transactivation of transfected reporter gene constructs and on endogenous genes and have measured the induction of apoptosis in HeLa and SKBR3 cells. We found that the variant p53⌬326 retains a diminished transactivation potential when measured on PG13 or mdm2 promoter luciferase constructs; the further truncated variant p53⌬300 was mostly inactive. In contrast to wild-type p53, p53⌬326 was unable to induce apoptosis in the transiently transfected cells which might be correlated with its inability to induce the bax gene. We also derived SKBR3 and Saos2 cell clones in which the expression of p53 or p53⌬326 were subjected to tetracycline control. Consistent with the results obtained in the transiently transfected cells, p53⌬326 did not induce apoptosis.

Results Transactivation potential of p53, p53⌬326 and p53⌬300 in transiently transfected HeLa and SKBR3 cells We derived p53 variants in which the carboxy-terminal 67 amino acids, p53⌬326, or 93 amino acids, p53⌬300, were deleted (Figure 1a). p53⌬326 retains the main nuclear localisation sequences,44 p53⌬300 does not. Transactivation potentials of the constructs were tested in transiently transfected HeLa, human cervical carcinoma cells and SKBR3, human mammary carcinoma cells. HeLa cells are transformed by HPV, leading to a rapid degradation of endogenous wt p53 by the HPV E6 protein. SKBR3 cells express the p53His175 mutant. Three reporter plasmids with p53 response elements in their promoter regions were employed. PG13-luc is a construct in which multimerised p53 binding sites have been assembled into an artificial promoter region;7 mdm2-luc utilises the promoter region of the mouse mdm2 gene45 and bax-luc the promoter region of the human bax gene17 to direct the transcription of the luciferase gene. We also investigated the dose–response and compared the luciferase activities obtained upon transfection of 1 or 5 ␮g of the p53 expression plasmids. The luciferase values obtained in the absence and presence of cotransfected p53 expression plasmids are shown in Figure 1. p53⌬326 retains specific transactivation activity, although it is less active than wild-type p53. p53⌬326 induces the PG13-luc gene about 20-fold in SKBR3 cells, as compared with a 40-fold induction by wild-type p53 (Figure 1b, left panel). A 20-fold induction by p53⌬326 was also observed in HeLa cells, where wild-type p53 caused an about 150-fold induction (Figure 1b, right panel). p53⌬300 was unable to induce transcription of PG13-luc significantly in both cell lines. The situation was similar in SKBR3 cells transfected with the mdm2-luc gene. Wild-type p53 caused a strong induction (45-fold),

p53⌬326 a weak induction (10-fold) and p53⌬300 no induction (Figure 1c, left panel). In contrast to these results, p53⌬300 was able to induce mdm2-luc about fivefold in HeLa cells (Figure 1c, right panel). The bax-luc reporter gene was induced three- to five-fold by wildtype p53 in SKBR3 or in HeLa cells, the two deletion mutants had no activity (Figure 1d). The induction of luciferase activity was p53 dose dependent. Higher levels of the deletion mutants result in higher luciferase activity. Higher levels of wild-type p53 in SKBR3 cells were less efficient to activate transcription when compared with lower levels. This dose–response effect was observed with all three reporter genes used although the overall transactivation efficiency among them varied widely.

The DNA binding efficiency of p53⌬326 is reduced when compared with wild-type p53 We compared the in vitro DNA binding efficiency of wild-type p53 and the monomeric p53⌬326 in mobility shift assays (Figure 2). The p53 DNA binding sequence BC28 was used as a radioactive probe. Nuclear extracts were prepared from SKBR3 cells transiently transfected with the wild-type p53 gene. Strong, specific DNA-binding of wild-type p53 was observed (Figure 2a, lane 3). The presence of the monoclonal antibody PAb1801 resulted in a supershifted complex (lane 4). No or only weak specific DNA binding was observed when nuclear extracts from SKBR3 cells transfected with p53⌬326 were introduced into the bandshift assay (lane 5). A specific protein DNA complex, however, was detected when the monoclonal antibody PAb1801 was added to the binding reaction (lane 6). Specificity of p53 binding was shown by oligonucleotide competition with a 50-fold molar excess of unlabeled DNA (lane 7). The low efficiency of p53⌬326 DNA binding when compared with wild-type p53 is not attributable to expression levels. Western blot analysis showed that higher levels of p53⌬326 than wildtype p53 are expressed in the transfected SKBR3 cells. In contrast to p53⌬326, we were not able to detect specific DNA binding by p53⌬300 (data not shown). SKBR3 cells express the mutant p53His175. This p53 variant is unable to bind specifically to DNA in the absence or presence of PAb1801 (Figure 2a, lanes 1 and 2). The DNA binding activity of transfected wild-type p53 was not inhibited by the endogenously expressed mutant p53His175 (Figure 2a, lane 3). The DNA binding efficiency of p53⌬326 and the influence of the antibody PAb1801 were further analysed using bacterially expressed, recombinant p53 protein (Figure 2b). Equal amounts of recombinant protein were incubated with the radioactive oligonucleotide BC in the absence (Figure 2b, lanes 1–3) or in the presence (lanes 4–6) of the monoclonal antibody. After 30 min an aliquot containing 100 ng of the recombinant protein of the binding reactions was loaded on to the acrylamide gel (Figure 2b, lanes 1 and 4). A 200-fold excess of unlabeled DNA probe was added to the binding reactions. After incubation for 1 min (Figure 2b, lanes 2 and 5) or 5 min (lanes 3 and 6) aliquots of the binding reactions were loaded on to the gel. Addition of the monoclonal antibody resulted in a stabilisation of protein–DNA complexes of p53⌬326. In the absence of the antibody the labeled DNA probe was displaced rapidly by the competing nonradioactive probe (Figure 2b, lanes 2 and 3). In the presence of PAb1801 the dissociation from the labeled


1633

Figure 1 Transactivation of p53-responsive reporter gene constructs in transiently transfected SKBR3 and HeLa cells. (a) Domain structure of wildtype p53 and two carboxy-terminal deletion mutants, p53⌬326 (amino acids 1–326) and p53⌬300 (amino acids 1–300). (b-d) The transactivation potentials of the p53 variants were analysed in SKBR3 (left) and HeLa (right) cells. 1 × 106 cells were plated in 10 cm dishes and transfected 24 h later by the calcium-phosphate method. Five or 1 ␮g of p53 expression plasmid and 5 ␮g of the luciferase reporter plasmid were used. Cellular extracts were prepared and luciferase assays were performed. Reporter plasmids: (b) pGL2-PG13; (c) pGL2-mdm2; (d) pGL3-bax. White bars, wild-type p53; hatched bars, p53⌬326; black bars, p53⌬300. DNA of the parental plasmid pCMX-pL1 was included to keep the total amount of expression vector constant. Luciferase activity is represented as fold transactivation relative to cultures transfected with reporter constructs only. Three independent experiments were carried out.

DNA was delayed. In contrast to the p53⌬326 derived from nuclear extracts of the transfected cells, recombinant p53⌬326 bound to the DNA probe efficiently even in the absence of the antibody. This is possibly due to the higher protein concentration present in the binding reaction. The in vitro DNA binding efficiency of p53⌬326 is reduced when compared with wild-type p53, but can be increased by addition of the monoclonal antibody PAb1801 to the binding reactions. We suggest that the decreased DNA binding potential of p53⌬326 is probably responsible for the decreased transactivation potential of this monomeric variant.

Wild-type p53, but not p53⌬326 induces apoptosis in transiently transfected HeLa or SKBR3 cells We studied the effects of wild-type p53 on the survival of transiently transfected HeLa or SKBR3 cells and compared them with those of p53⌬326. For this purpose, the cells were transfected, fixed after different intervals following transfection and incubated with the monoclonal p53-specific antibody PAb1801 and a FITC-conjugated secondary antibody (Figure 3, a–d). Immunofluorescence microscopy of HeLa cells transfected with wild-type p53 40 h after transfection showed strong expression of p53 restricted to nuclei (Figure 3a,


1634

Figure 2 Comparison of the in vitro DNA binding efficiency of wild-type p53 and p53⌬326. (a) Nuclear extracts of transiently transfected SKBR3 cells were prepared. Eight ␮g of nuclear proteins were introduced into bandshift assays in the absence or presence of monoclonal antibody PAb1801 (100 ng). Nuclear extracts from nontransfected SKBR3 cells (lanes 1 and 2); cells transfected with wild-type p53 (lanes 3 and 4); cells transfected with p53⌬326 (lanes 5–7). A 50 times excess of nonradioactive DNA probe was added as competitor (comp) (lane 7) to show specificity of DNA binding. (b) Analysis of the stability of the p53⌬326–DNA complex. Recombinant p53⌬326 was reacted with the labeled DNA probe and a 200 times molar excess of unlabeled DNA was added (comp). Aliquots of the binding reaction were loaded on to gel at 0 min (lanes 1 and 4), 1 min (lanes 2 and 5) or 5 min (lanes 3 and 6) after addition of the nonradioactive competitor. PAb1801 was added to the reactions in lanes 4–6. The strength of the bandshift signal is proportional to the stability of the protein–DNA complex.

Figure 3 p53 expression and induction of apoptosis in transiently transfected HeLa cells. HeLa cells were seeded on to glass coverslips 24 h before transfection with 50 ng/cm2 of p53 expression plasmids and the same amount of RcCMV-bcl-2 (b) or RcCMV (a, c, d). Forty hours after transfection, cells were washed, fixed and stained for p53 with the monoclonal antibody PAb1801 and a FITC-conjugated secondary antibody. Arrows indicate p53-positive cells, showing characteristic apoptotic nuclei. (e) Time-course of p53-induced cell death in transiently transfected HeLa and SKBR3 cells. Cells were fixed 24, 38, 48 and 64 h after transfection and stained for p53 expression and for DNA using propidium iodide. Viable and apoptotic cells were counted (at least 50–100 p53-positive cells). The data were derived from three independent experiments.

green color). About 50% of the nuclei exhibit the characteristic morphology of apoptosis (arrows). The induction of apoptosis by wild-type p53 was counteracted by the cotransfection of the bcl-2 gene (Figure 3b). p53⌬326 and, as a control, mutant p53His175 were not able to induce apoptosis in HeLa cells (Figure 3c and d). Cotransfection

of the bcl-2 gene did not affect the viability of transfected cells (not shown). Induction of apoptosis by wild-type p53, but not by p53⌬326 was also observed in transiently transfected SKBR3 cells (data not shown). We quantified the appearance of apoptotic cells as a function of time after transfection with the p53 variants


1635

(Figure 3e). No apoptotic cells were detected within the p53 expressing cells for 24 h. Forty-eight hours after transfection, about 50% of the wild-type p53-expressing cells were apoptotic. Almost all cells were dead within 64 h. Only a few dead cells were found in the populations transfected with and expressing p53⌬326 or p53His175. The same is true for cells transfected with p53⌬300 (not shown). The results show that the carboxy-terminally truncated variants, similar to the tumour cell-derived p53His175, are deficient in the induction of apoptosis in HeLa or SKBR3 cells.

Induction of conditional, tetracycline-regulated p53 gene constructs in Saos2 and SKBR3 To study the induction of apoptosis by wild-type p53 and p53⌬326 independently from the process of transfection, we derived expression vectors for these p53 variants in which transcription has been subjected to the control of tetracycline. The tetracycline-inducible wild-type p53 and p53⌬326 constructs were stably introduced into Saos2, p53-negative human osteosarcoma cells, and SKBR3 cells. Stably transfected cell clones were grown in medium containing tetracycline. For p53 induction, tetracycline was removed.46 We followed the induction of p53 expression and the induction of apoptosis as a function of time after tetracycline removal from the cell culture medium (Figure 4). At 0, 24 and 48 h the cells were fixed and incubated with PAb1801 and FITC-conjugated second antibody to visualise p53 expression (left panels) and propidium iodide to visualise DNA (right panels). Each pair in Figure 4a–d depicts the same area, fluorescing at two different wavelengths. Immunofluorescence microscopy revealed expression of wild-type p53 24 h (Figure 4b) and wildtype p53 (Figure 4c) or p53⌬326 (Figure 4d) 48 h after tetracycline withdrawal. Uninduced cells served as controls (Figure 4b and c). A large majority of the Saos2 cells expressing wild-type p53 showed the characteristic signs of apoptosis (condensed nuclei, degraded DNA) 48 h after tetracycline withdrawal (Figure 4c). No apoptotsis was detected in p53⌬326 expressing cells induced for the same time (Figure 4d). The quantification of viable cells upon increasing lengths of time after tetracycline withdrawal (Figure 4e) shows a difference in sensitivity towards wild-type p53-induced apoptosis between SKBR3 and Saos2 cells. The induction of apoptosis by wild-type p53 in SKBR3 cells is less efficient than in Saos2 cells. About 40% of the cells are still alive 72 h after induction. This is probably due to the lower expression of wild-type p53 in the SKBR3 cell clone when compared with the Saos2 clone. A Northern blot analysis of the induction of p53 mRNA in the four clones revealed that wild-type p53 mRNA was maximal after 12 h in the Saos2 cells and about 10 times higher at that time than in SKBR3 cells (not shown). Consistent with the results obtained in our transient transfection experiments, no induction of apoptosis was effected by p53⌬326 in SKBR3 or in Saos2 cells (Figure 4e). The onset of apoptosis as a function of time after p53 induction (Figure 4e) indicates that the process is not perfectly synchronised. The first apoptotic Saos2 cells can be detected 16 h after tetracycline withdrawal and cell death of p53-positive cells was nearly complete after 72 h. The induction of p53 expression in individual cells of the

Figure 4 Induction of apoptosis in Saos2 and SKBR3 cell clones with inducible p53 expression. Immunofluorescence analysis of p53 expression in two inducible Saos2 cell clones expressing wild-type p53 (a–c) or p53⌬326 (d). Cells were seeded on to glass coverslips 24 h before induction. At the indicated time after induction, cells were fixed and stained for p53 with the monoclonal antibody PAb1801 and FITC-conjugated secondary antibody (left panels), and with propidium iodide for DNA (right panels). Each pair of adjacent panels depicts the same field of cells, viewed under two different wavelengths. Arrows indicate p53-positive cells, showing characteristic apoptotic nuclei. (e) Time-course of p53-induced cell death in SKBR3 and Saos2 clones, expressing wild-type p53 or p53⌬326 under the transcriptional control of tetracycline. Cells were analysed for p53 expression at the indicated times after induction by immunofluorescence, viable and apoptotic p53 positive cells were counted (at least 100 cells in total each).


1636

Saos2 population was in accordance with the nonsynchronous onset of apoptosis. Delayed induction of p53 resulted in a delayed onset of apoptosis (Figure 4c). Individual cells have completely lost the ability to induce p53, and survive even extended times of tetracycline withdrawal.

Expression of p53-dependent cellular genes in tetracycline-inducible cell lines At least three parameters have been recognised to be important in the quantitative regulation of p53-dependent transcription: the cellular concentration of p53, the activation status of p5329 and the sequence and sequence context of the response element in the promoters of p53 target genes.19,41 Since these parameters could contribute to the results that we have obtained in the analysis of p53 mutants in our transient transfection experiments, we also investigated the induction of endogenous, p53dependent genes in our stably transfected, conditional cell lines. P21/waf1/cip1 is a crucial target gene of p53. P21 mediates the p53 cell cycle arrest through inhibition of the activities of cyclin-dependent kinases. We measured the induction of p21 expression by immunofluorescence in SKBR3 cells expressing wild-type p53 or p53⌬326 upon tetracycline withdrawal (Figure 5a). The cells were stained with a p53-specific antibody (red fluorescence) and a p21-specific antibody (green fluorescence). Induction of the endogenous p21 gene was only observed in wild-type p53 expressing cells, but not in cells expressing

p53⌬326 or in uninduced cells (not shown). Similar results were obtained with two Saos2 cell clones (data not shown). We examined the expression of additional p53 target genes in inducible Saos2 or SKBR3 cell lines by RT-PCR analysis. Saos2 were induced for 12 and 24 h and SKBR3 cells for longer, 24 and 48 h. RT-PCR reactions were performed to quantify the transcription of the p53, p21/waf1/cip1, bax, mdm2, Gadd45 and IGF-1R genes. Endogenous ␤-actin mRNA served as an internal standard for the RT reaction and efficiency of the PCR amplifications. Figure 5b shows the results of PCR amplifications in which p53- and p21-specific primers have been introduced. The PCR signals were quantified and the expression levels of p53, p21, mdm2, Gadd45, bax and IGF-1R mRNA are indicated in Figure 5c. The transcription of the p53 gene was low in all four cell clones as long as the cells were grown in tetracycline. These results were confirmed in Northern blot, Western blot and immunofluorescence analysis (data not shown). p21 mRNA was induced in Saos2 and SKBR3 cells by wild-type p53, but not by p53⌬326. p21 expression is not exclusively controlled by p5347 and a signal is detectable in the absence of p53 (+tetracycline). Bax mRNA was induced in SKBR3 and Saos2 cells after expression of wild-type p53, but not p53⌬326. The monomeric p53 mutant is not able to stimulate transcription of this apoptosis inducing target gene. Similar observations were made concerning the transcription of the mdm2 gene in both cell lines, induction by wild-type p53, no effect

Figure 5 Regulation of endogenous target genes by induction of p53 expression in Saos2 and SKBR3 cells. (a) Immunofluorescence analysis of p53 and p21 expression in tetracycline-regulated SKBR3 cells, expressing wild-type p53 or p53⌬326. Cells were fixed 24 h after induction, stained for p53 (Cy3conjugated secondary antibody, red) and p21 (FITC-conjugated secondary antibody, green) and viewed under two different wavelengths. Uninduced cells showed only background staining of p53 due to the endogenous mutant p53, but no p21 staining (not shown). (b) Analysis of p53 and p21 mRNA levels by RT-PCR. The transcription of p53 and p21 in stable cell clones of Saos2 and SKBR3 cells was measured. Uninduced cells (+tet) or cells induced for the indicated times were collected, mRNA was prepared and the reverse transcription and PCR recations were carried out as described in Materials and methods. The PCR products were visualised upon gel electrophoresis. (*) ␤-Actin specific band (288 bp) was used as an endogenous standard in each PCR reaction. The sizes of the specific bands are indicated by the arrows; 1 kb ladder (Gibco) was used as a marker (not shown). (c) Quantitative analysis of the p53-induced mRNA levels. The mRNA levels of p53, p21, mdm2, Gadd45, bax and IGF-1R in the four stable cell clones were measured in RT-PCR reactions. Signal strength was calculated after scanning and quantification of the bands using ImageQuant (Molecular Dynamics). The ratios of the specific mRNA signals to the ␤-actin band, used as an internal standard, are plotted.


1637

Figure 5 Continued.

by p53⌬326. Gadd45 mRNA was induced by wild-type p53 in SKBR3 and Saos2 cells. High constitutive levels were present in p53⌬326 Saos2 cells. It has been reported that the IGF-1 receptor gene transcription is repressed by p53, a mechanism which might neutralise the apoptosis inhibiting action of IGF-1 receptor activation.48,49 We measured IGF-1 receptor mRNA upon induction of p53 or p53⌬326 and did not observe significant changes in the RT-PCR signals. The reported repression might be cell line dependent. Repression of the IGF-1R is not essential for p53-induced apoptosis in Saos2 and SKBR3 cells.

Discussion We have evaluated the potential of two carboxy-terminal deletion mutants of p53, p53⌬326 and p53⌬300 with respect to their ability to transactivate responsive genes and to induce apoptosis. These variants are lacking the carboxy-terminal regulatory and oligomerisation domain and act as monomers. We found that the two variants

retain a reduced degree of transactivation potential in transient transfection experiments in HeLa and SKBR3 cells compared with wild-type p53, complementing the results obtained by Pellegata et al,50 Subler et al51 and Zhang et al.52,53 Transient transfections of expression plasmids driven by viral promoters usually yield high amounts of expressed protein. We studied the dose–response of p53 expression and observed that the extent of wild-type p53dependent transcription reaches a maximum and decreases again at high levels of p53 (not shown). In contrast, both deletion mutants showed enhanced transactivation with higher amounts of transfected expression plasmids. The nuclear concentrations of p53 were proportional to the amounts of plasmid transfected (data not shown). Our experiments also show that the oligomerisation of p53, through its intrinsic oligomerisation domain or through antibody crosslinking, results in more efficient DNA binding. The binding of the antibody probably results in the stabilisation of protein–DNA complexes by coupling two monomeric proteins. In vitro DNA binding


1638

of monomeric p53 can also be achieved by increasing the concentration of the protein in the binding reaction, yielding complexes migrating similarly to wild-type p53DNA complexes (data not shown).54 Monomeric p53 variants with a functional DNA binding domain probably aggregate on p53 response elements to form labile DNA– protein complexes. Such complexes are still able to initiate the transcription of genes in vivo. We suggest that the efficiency of DNA binding of p53 is limiting the transcriptional induction and consider this to be the reason for the more effective transactivation by wild-type p53.19,54–57 At high concentrations of wild-type p53 transactivation activity decreased again. p53 functions as a transcription factor itself and contacts members of the basal transcription machinery, such as TBP, the TATA binding protein58 and the co-activator p300.59,60 In combination with sequence-specific DNA binding such interactions are necessary for transactivation of target genes. If high amounts of wild-type p53 are present in the nucleus, sequestration of general transcription factors by p53 can lead to the depletion of such factors and result in squelching. The observation was made only with wild-type p53, but not with monomeric p53 and indicates that limiting transcription factors interact with the carboxy-terminal region of p53.58 The onset of apoptotic events induced 24–30 h after transfection with the high amount of wildtype p53 could also contribute to the reduced values of luciferase activity. Although p53⌬326 and p53⌬300 retain some transactivation activity, they were unable to induce apoptosis under our experimental conditions. These results differ from reports in which monomeric or transactivationdeficient p53 variants were shown to induce apoptosis in transiently transfected HeLa cells.38 It has also been reported that, under certain conditions, p53 can induce apoptosis in the absence of RNA and protein synthesis.37,39 These results suggest that monomeric p53 and even transactivation-deficient p53 may have residual apoptotic activity. On the other hand, several groups have shown that the apoptotic activity of p53 is dependent on transcriptional activation61,62 and that only wildtype p53 can induce a full apoptotic response in transiently transfected cells or in inducible cell systems.40,41 The results presented here, based on two cell lines expressing monomeric p53 under the transcriptional control of tetracycline and unable to induce apoptosis, support the latter conclusions. Since inducible p53 expression in stably transfected cell lines seems somewhat less artificial than transient transfection of cells, we suggest that the induction of apoptosis by monomeric p53 may be due to the particular experimental conditions used. Our analysis of gene induction in the tetracyclinecontrolled cell clones showed that p53⌬326 was not able to transactivate endogenous p53 target genes, while wildtype p53 caused enhanced expression of the p21/waf1/cip1, mdm2, Gadd45 and bax mRNAs. We did not observe transcriptional repression of the IGF-1R gene in our inducible systems, although repression of the IGF1R has been proposed as being associated with the induction of apoptosis by wild-type p53.48,49 The transactivation of reporter constructs by monomeric p53 is probably limited to situations where overexpression of the monomeric variant coincides with binding to a high affinity response element in the promoter. This is rare

under physiological conditions and is the reason why no transactivation by p53⌬326 was observed. While the lack of transcriptional activation of the p21 gene by monomeric p53 results in a G1 checkpoint defect,36 both loss of transcriptional activation and repression of other target genes might contribute to the deficiency in apoptosis induction. We also examined the potential of monomeric p53 to cause cell cycle arrest in Saos2 or SKBR3 cells upon tetracycline induction. Our results confirmed the observations by Tarunina et al;36 no cell cycle arrest was found. The interest in monomeric variants of p53 resulted from the possibility of circumventing the dominant-negative effects of mutated p53 molecules found in tumour cells. The usefulness of monomeric variants in a gene therapeutic setting, might be limited, due to the impaired transactivation potential of these molecules. We did not observe dominant-negative effects of the endogenous mutant p53His175 in SKBR3 cells. Wild-type p53 was shown efficiently to transactivate the transcription of luciferase reporter genes as well as endogenous p53 target genes in this cell line. Sequence-specific DNA binding of wild-type p53 was found not to be inhibited and wildtype p53 but not p53⌬326 induced apoptosis in SKBR3 cells after induction of tetracycline-regulated constructs. Induction of apoptosis would be a requirement for the deployment of monomeric variants in a therapeutic context. Efforts to replace the native tetramerisation domain of p53 with engineered oligomerisation domains resulted in proteins that showed higher sequence-specific DNA binding and transactivation activity than monomeric variants of p53.34,43 The induction of apoptosis by such chimeric proteins has not yet been systematically evaluated. Post-translational modifications and protein–protein interactions at the carboxyl-terminus of p53 contribute to the regulation of the transcriptional activity of p53.27,63 However, we could demonstrate that oligomerisation of p53 is essential for sufficient transcriptional activity and induction of apoptosis.

Materials and methods Cells and transfections HeLa cells (derived from a HPV-infected cervical carcinoma), Saos2 cells (derived from an osteosarcoma) and SKBR3 cells (derived from a mammary carcinoma) are human tumour cells which were grown at 37°C in Dulbecco’s modified Eagle’s medium (DMEM; Boehringer Ingelheim Bioproducts, Germany) supplemented with 10% fetal calf serum (FCS; Gibco BRL, Eggenstein, Germany). The cells were plated 24 h before transfection at 1 × 106 cells per 10 cm dish (for luciferase and protein assays) or at 5 × 104 cells per well on 12 well dishes supplied with glass coverslips (for immunofluorescence analysis). Cells were transfected by the calcium–phosphate method and the precipitate left on the cells for 6– 12 h, after which cells were treated with PBS containing 15% glycerol for 3 min. Luciferase assays were performed 24–30 h later as described elsewhere.64 Saos2 clones harbouring tetracycline-inducible p53 constructs were obtained after two rounds of stable transfection and selection for hygromycin (Boehringer Mannheim, Mannheim, Germany) and neomycin (Gibco BRL), respectively. Stable clones were maintained in growth medium containing 1 ␮g/ml tetracycline (Sigma, Deisen-


hofen, Germany). For induction, cells were seeded in growth medium without tetracycline for the indicated times.

Gel retardation assays and nuclear extracts DNA protein binding reactions were carried out in 20 ␮l volume (per lane) and final concentrations of 50 mm Tris pH 7.9, 50 mm NaCl, 4% glycerol, 2 mm DTT, 0.5 mm MgCl2, 0.05% Triton X-100. 2.5 ␮g unspecific competitor DNA (poly d(AT); Boehringer Mannheim) and 1 ␮l BSA per binding reaction. The p53-specific probe was prepared by annealing of the single-stranded oligonucleotides (5′-GATCCCGGGCATGTCCGGGCATGTCCGGG CATGTA3′ and 5′-GATCTACATGCCCGGACATGCC CGGACATGCCCGG-3′) which contain a BC element.28 The double-stranded oligonucleotides were gel purified and labeled with 32P by Klenow fill-in reactions. Incubation with antibody PAb1801 (Dianova, Hamburg, Germany) and binding to the labelled DNA were carried out in parallel for 30 min at room temperature. Separation of the complexes was carried out on a 5% polyacrylamide gel in 0.25 × TBE. Nuclear extracts of transiently transfected SKBR3 cells were prepared as described previously.25 Plasmids All p53 expression vectors used in this study were constructed from the pCMX-pL165 vector containing the CMV immediate–early promoter/enhancer and human p53 cDNA. Truncated p53 variants, p53⌬326 and p53⌬300 were derived from wild-type cDNA using PCR methods. A cDNA encoding the mutant p53His175 was obtained from P Che`ne, Novartis, Basel, Switzerland. The pUHD13–1 plasmid contains the tTA transactivator gene and the hygromycin gene, and wild-type p53 or p53⌬326 were cloned into the pUHD10–3 plasmid to allow their conditional expression as described by Gossen and Bujard.46 The luciferase reporter plasmid pGL2-PG13 contains 13 copies of the RGC p53 binding site,7 pGL2mdm2 contains a p53 binding site from intron 1 of the mouse mdm-2 gene45 linked to a luciferase reporter gene, pGL3-bax contains the p53 response element of the human bax gene promoter.17 RcCMV-bcl-2 encodes the human bcl-2 gene. Protein purification BL21(DE3)pLysS- cultures containing the construct pRSETc-p53⌬326 were grown in LB-medium with 100 ␮g/ml ampicillin and 0.6% glucose to OD550 of 0.8–1.0 was attained. Protein expression was induced by addition of 0.2 mm IPTG for 3 h at 37°C. The cultures were harvested by centrifugation at 4400 g. Bacterial pellets were resuspended in 40 ml of ice-cold PBS. The cells were lysed by three steps of freezing in liquid nitrogen and thawing at room temperature. The DNA was sheared by sonication on ice. The lysates were then cleared by centrifugation at 31 000 g in a JA-20 rotor for 30 min at 4°C. The recombinant His-tagged protein was bound to 5 ml of Ni-NTA-agarose (Qiagen, Hilden, Germany) and washed extensively with PBS. The columns were step eluted with PBS containing increasing concentrations of imidazole (50, 100, 200, 300, 400 and 500 mm). p53⌬326 containing fractions were dialysed overnight at 4°C against PBS. The proteins were stored in aliquots at −80°C. As judged by Coomassie blue staining, the purity of the recombinant protein was between 50 and 80%.

Indirect immunofluorescence analysis Cells were grown on glass coverslips, washed with PBS, fixed in methanol/acetone (1:1) at −20°C for 10 min. Cells were incubated with p53 monoclonal mouse antibody PAb1801 (Dianova) and/or p21 polyclonal rabbit antibody (C-19, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h at 37°C in PBS containing 0.05% Tween 20 (TPBS). The cells were washed with TPBS (three changes within 10 min) and incubated with FITC-conjugated goat anti-mouse IgG (for single IF) or Cy3-conjugated goat anti-mouse IgG plus FITC-conjugated goat anti-rabbit IgG (for Co-IF) for 45 min at 37°C. As indicated, cells were incubated with 50 ␮g/ml propidium iodide in the presence of 0.5 mg/ml RNase A for 15 min at 4°C for DNA staining. After a final wash in TPBS, coverslips were mounted on to slides and viewed under a fluorescence microscope (Zeiss Axiophot; Carl Zeiss, Jena, Germany) for green fluorescence (FITC) at 470 nm and for red fluorescence (Cy3 or PI) at 546 nm. RNA preparation and RT-PCR analysis Total RNA was isolated from 107 cells grown on 15-cm plates using the RNeasy Kit (Qiagen, Hilden, Germany) as recommended by the manufacturer. For generation of cDNA, 5 ␮g of RNA was heat denatured at 65°C for 10 min. The RT reaction was performed using 0.2 ␮g of d(T)18 at 37°C for 1 h in a total volume of 33 ␮l. Two ␮l (for p53 amplification) or 3 ␮l (others) of the heat denatured (5 min at 90°C) reaction mixture were used for subsequent PCR amplification in 20 ␮l reaction volumes including 10 pmol of each primer. The ␤-actin primer set was included in every reaction to normalise for amplification efficiency and monitor pipetting variations. The following conditions and primer sets were used: ␤-actin (5′ primer: CGCGGGCGACGATGCTC, 3′ primer: TCACGGTTGGCCTTAGGGTTCAGA); p53, 28 cycles at 61°C (5′ primer: CCCCCTCCTGGCCCCTGTCATCTT, 3′ primer: AGGCGGCTCATAGGGCACCACCAC); IGF-1R, 28 cycles at 58.5°C (5′ primer: CACGGCCGCAGACACCTACAACA, 3′ primer: AGCGACGGGCAGA GCGATGAT); Gadd45, 28 cycles at 58.5°C (5′ primer: GGATGCCCTGGAGGAAGTGCT, 3′ primer: CGGCC CGGGTTGCTGAC); mdm2, 30 cycles at 53°C (5′ primer: AGGCAGGGGAGAGTGATACAGAT, 3′ primer: AGGGGCAAACTAGATTCCACACT); Bax, 28 cycles at 58.5°C (5′ primer: GATGCGTCCACCAAGAAGC, 3′ primer: TGAGCACTCCCGCCACAA); p21, 28 cycles at 61°C (5′ primer: CGGCCCAGTGGACAGCGAGCAG, 3′ primer: CAGCCGGCGTTTGGAGTGGTAGAA). The complete PCR reactions were separated on 1.5% agarose gels containing 0.01% ethidium bromide and viewed and photographed under UV light. For quantitative analysis bands were scanned and quantified using ImageQuant (Molecular Dynamics, Sunnyvale, CA, USA).

Acknowledgements We thank Dr Patrick Chene, Basel for providing plasmids encoding human wild-type p53 and mutant p53His175. We also thank Drs Bert Vogelstein, Baltimore and Moshe Oren, Rehovot for the reporter plasmids PG13-CAT and pGL2-mdm2/pGL3-bax, Prof Patrick Ba¨uerle, San Fransisco, for the plasmid RcCMV-bcl-2 and Ines Fernandez for editorial assistance. The work was supported by a grant from ‘Deutsche Forschungsgemeinschaft’ to Dr Bernd

1639


1640

Groner (Gr 536/2–1) and a collaborative grant from Novartis, Basel.

References 1 Fritsche M, Haessler C, Brandner G. Induction of nuclear accumulation of the tumor-suppressor protein p53 by DNAdamaging agents. Oncogene 1993; 8: 307–318. 2 Graeber TG et al. Hypoxia induces accumulation of p53 protein, but activation of a G1-phase checkpoint by low-oxygen conditions is independent of p53 status. Mol Cell Biol 1994; 14: 6264–6277. 3 Lane DP. Cancer. p53, guardian of the genome. Nature 1992; 358: 15–16. 4 Wang P et al. p53 domains: structure, oligomerization, and transformation. Mol Cell Biol 1994; 14: 5182–5191. 5 Pavletich NP, Chambers KA, Pabo CO. The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots. Genes Dev 1993; 7: 2556–2564. 6 Bargonetti J et al. A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein. Genes Dev 1993; 7: 2565–2574. 7 Kern SE et al. Identification of p53 as a sequence-specific DNAbinding protein. Science 1991; 252: 1708–1711. 8 Funk WD et al. A transcriptionally active DNA-binding site for human p53 protein complexes. Mol Cell Biol 1992; 12: 2866–2871. 9 El-Deiry WS et al. Definition of a consensus binding site for p53. Nat Genet 1992; 1: 45–49. 10 El-Deiry WS et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993; 75: 817–825. 11 Harper JW et al. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993; 75: 805–816. 12 Xiong Y, Zhang H, Beach D. Subunit rearrangement of the cyclin-dependent kinases is associated with cellular transformation. Genes Dev 1993; 7: 1572–1583. 13 Zauberman A et al. A functional p53-responsive intronic promoter is contained within the human mdm2 gene. Nucleic Acids Res 1995; 23: 2584–2592. 14 Wu X, Bayle JH, Olson D, Levine AJ. The p53-mdm2 autoregulatory feedback loop. Genes Dev 1993; 7: 1126–1132. 15 Smith ML et al. Interaction of the p53-regulated protein Gadd45 with proliferating cell nuclear antigen. Science 1994; 266: 1376– 1380. 16 Okamoto K, Beach D. Cyclin G is a transcriptional target of the p53 tumor suppressor protein. EMBO J 1994; 13: 4816–4822. 17 Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995; 80: 293–299. 18 Buckbinder L et al. Induction of the growth inhibitor igf-binding protein 3 by p53. Nature 1995; 377: 646–649. 19 Friedlander P, Haupt Y, Prives C, Oren M. A mutant p53 that discriminates between p53-responsive genes cannot induce apoptosis. Mol Cell Biol 1996; 16: 4961–4971. 20 Ludwig RL, Bates S, Vousden KH. Differential activation of target cellular promoters by p53 mutants with impaired apoptotic function. Mol Cell Biol 1996; 16: 4952–4960. 21 Rowan S et al. Specific loss of apoptotic but not cell-cycle arrest function in a human tumor derived p53 mutant. EMBO J 1996; 15: 827–838. 22 Hupp TR, Meek DW, Midgley CA, Lane DP. Regulation of the specific DNA binding function of p53. Cell 1992; 71: 875–886. 23 Takenaka I, Morin F, Seizinger BR, Kley N. Regulation of the sequence-specific DNA binding function of p53 by protein kinase C and protein phosphatases. J Biol Chem 1995; 270: 5405– 5411. 24 Hupp TR, Sparks A, Lane DP. Small peptides activate the latent sequence-specific DNA binding function of p53. Cell 1995; 83: 237–245. 25 Mundt M et al. Protein interactions at the carboxyl terminus of p53 result in the induction of its in vitro transactivation potential. Oncogene 1997; 15: 237–244.

26 Gu W, Roeder RG. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 1997; 90: 595–606. 27 Jayaraman L et al. Identification of redox/repair protein Ref-1 as a potent activator of p53. Genes Dev 1997; 11: 558–570. 28 Halazonetis TD, Kandil AN. Conformational shifts propagate from the oligomerization domain of p53 to its tetrameric DNA binding domain and restore DNA binding to select p53 mutants. EMBO J 1993; 12: 5057–5064. 29 Hupp TR, Lane DP. Allosteric activation of latent p53 tetramers. Curr Biol 1994; 4: 865–875. 30 Ginsberg D, Michael-Michalovitz D, Ginsberg D, Oren, M. Induction of growth arrest by a temperature-sensitive p53 mutant is correlated with increased nuclear localization and decreased stability of the protein. Mol Cell Biol 1991; 11: 582–585. 31 Subler MA, Martin DW, Deb S. Inhibition of viral and cellular promoters by human wild-type p53. J Virol 1992; 66: 4757–4762. 32 Mack DH, Vartikar J, Pipas JM, Laimins LA. Specific repression of TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature 1993; 363: 281–283. 33 Wyllie AH. The genetic regulation of apoptosis. Curr Opin Genet Dev 1995; 5: 97–104. 34 Pietenpol JA et al. Sequence-specific transcriptional activation is essential for growth suppression by p53. Proc Natl Acad Sci USA 1994; 91: 1998–2002. 35 Crook T, Marston NJ, Sara EA, Vousden KH. Transcriptional activation by p53 correlates with suppression of growth but not transformation. Cell 1994; 79: 817–827. 36 Tarunina M et al. Selective loss of endogenous p21/waf1/cip1 induction underlies the G1 checkpoint defect of monomeric p53 protein. Oncogene 1996; 13: 589–598. 37 Caelles C, Helmberg A, Karin M. p53-dependent apoptosis in the absence of transcriptional activation of p53-target genes. Nature 1994; 370: 220–223. 38 Haupt Y et al. Induction of apoptosis in HeLa cells by transactivation-deficient p53. Genes Dev 1995; 9: 2170–2183. 39 Wagner AJ, Kokontis JM, Hay N. Myc-mediated apoptosis requires wild-type p53 in a manner independent of cell cycle arrest and the ability of p53 to induce p21/waf1/cip1. Genes Dev 1994; 8: 2817–2830. 40 Yonish-Rouach E et al. Transcriptional activation plays a role in the induction of apoptosis by transiently transfected wild-type p53. Oncogene 1996; 12: 2197–2205. 41 Chen X, Ko LJ, Jayaraman L, Prives C. p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells. Genes Dev 1996; 10: 2438–2451. 42 Kern SE et al. Oncogenic forms of p53 inhibit p53-regulated gene expression. Science 1992; 256: 827–830. 43 Waterman M, Waterman J, Halazonetis TD. Engineered fourstranded coiled coil substitutes for the tetramerization domain of wild-type p53 and alleviates transdominant inhibition by tumor-derived p53 mutants. Cancer Res 1996; 56: 158–163. 44 Shaulsky G, Goldfinger N, Ben-Ze’ev A, Rotter V. Nuclear accumulation of p53 protein is mediated by several nuclear localization signals and plays a role in tumorigenesis. Mol Cell Biol 1990; 10: 6565–6577. 45 Juven, T et al. Wild-type p53 can mediate sequence-specific transactivation of an internal promoter within the mdm2 gene. Oncogene 1993; 8: 3411–3416. 46 Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA 1992; 89: 5547–5551. 47 Halevy O et al. Correlation of terminal cell cycle arrest of skeletal muscle with induction of p21 by MyoD. Science 1995; 267: 1018–1021. 48 Werner H, Karniele E, Rauscher III FJ, LeRoith D. Wild-type and mutant p53 differentially regulate transcription of insulin-like growth factor I receptor gene. Proc Natl Acad Sci USA 1996; 93: 8318–8323. 49 Prisco M et al. The insulin-like growth factor I receptor as a physiologically relevant target of p53 in apoptosis caused by interleukin-3 withdrawal. Mol Cell Biol 1997; 17: 1084–1092.


50 Pellegata NS, Cajot JF, Stanbridge EJ. The basic carboxy-terminal domain of human p53 is dispensable for both transcriptional regulation and inhibition of tumor cell growth. Oncogene 1995; 11: 337–349. 51 Subler MA, Martin DW, Deb S. Overlapping domains on the p53 protein regulate its transcriptional activation and repression functions. Oncogene 1994; 9: 1351–1359. 52 Zhang W, Randhawa GS, Guo XY, Deisseroth AB. The DNAbinding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function. Cell Growth Diff 1994; 5: 705–710. 53 Zhang W, Guo XY, Deisseroth AB. The requirement of the carboxyl terminus of p53 for DNA binding and transcriptional activation depends on the specific p53 binding DNA element. Oncogene 1994; 9: 2513–2521. 54 Wang Y et al. Interaction of p53 with its consensus DNA-binding site. Mol Cell Biol 1995; 15: 2157–2165. 55 Wang Y et al. p53 domains: identification and characterization of two autonomous DNA-binding regions. Genes Dev 1993; 7: 2575–2586. 56 Thomas M, Massimi P, Banks L. HPV-18 E6 inhibits p53 DNA binding activity regardless of the oligomeric state of p53 or the exact p53 recognition sequence. Oncogene 1996; 13: 471–480. 57 Stenger JE et al. p53 oligomerization and DNA looping are linked with transcriptional activation. EMBO J 1994; 13: 6011– 6020.

58 Horikoshi N et al. Two domains of p53 interact with the TATAbinding protein, and the adenovirus 13S E1A protein disrupts the association, relieving p53-mediated transcriptional repression. Mol Cell Biol 1995; 15: 227–234. 59 Gu W, Shi X-L, Roeder RG. Synergistic activation of transcription by CBP and p53. Nature 1997; 387: 819–823. 60 Lill NL et al. Binding and modulation of p53 by p300/CBP coactivators. Nature 1997; 387: 823–827. 61 Sabbatini P, Lin J, Levine AJ, White E. Essential role for p53mediated transcription in E1A-induced apoptosis. Genes Dev 1995; 9: 2184–2192. 62 Attardi LD, Lowe SW, Brugarolas J, Jacks T. Transcriptional activation by p53, but not induction of the p21 gene, is essential for oncogene-mediated apoptosis. EMBO J 1996; 15: 3693–3699. 63 Wang XW et al. The XPB and XPD DNA helicases are components of the p53-mediated apoptosis pathway. Genes Dev 1996; 10: 1219–1232. 64 Gouilleux F, Wakao H, Mundt M, Groner B. Prolactin induces phosphorylation of Tyr694 of Stat5 (MGF), a prerequisite for DNA binding and induction of transcription. EMBO J 1994; 13: 4361–4369. 65 Pfitzner E, Becker P, Rolke A, Schu¨le R. Functional antagonism between the retinoic acid receptor and the viral transactivator BZLF1 is mediated by protein–protein interactions. Proc Natl Acad Sci USA 1995; 92: 12265–12269.

1641