The FASEB Journal • FJ Express Summary
Transcriptional regulation of APH-1A and increased ␥-secretase cleavage of APP and Notch by HIF-1 and hypoxia Ruishan Wang,*,†,1 Yun-wu Zhang,‡,1 Xian Zhang,*,‡ Runzhong Liu,* Xue Zhang,‡ Shuigen Hong,* Kun Xia,† Jiahui Xia,† Zhuohua Zhang,†,‡,2 and Huaxi Xu*,†,‡,2 *Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, and Institute for Biomedical Research, Xiamen University, Xiamen, China; †National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha, China; and ‡Center for Neuroscience and Aging, Burnham Institute for Medical Research, La Jolla, California, USA To read the full text of this article, go to http://www.fasebj.org/cgi/doi/10.1096/fj.06-5839fje SPECIFIC AIMS The aims of this study are 1) to identify the promoter region of the APH-1A gene, which encodes a major component of the ␥-secretase complex responsible for proteolytic cleavage of Alzheimer’s -amyloid precursor protein (APP) and the signaling receptor Notch; 2) to investigate transcription factors responsible for regulating APH-1A expression; and 3) to study whether transcriptional regulation of APH-1A gene affects its expression and thus the activity of ␥-secretase for APP and Notch processing. PRINCIPAL FINDINGS 1. Promoter analysis of the APH-1A gene To determine the transcription initiation site of the human APH-1A gene, 5⬘-RACE was performed and the polymerase chain reaction (PCR) products were cloned into pGEM T vector for sequencing. The results indicated that the major transcription initiation site of the APH-1A gene is located 211 bp upstream of the translation start codon ATG (Fig. 1A). Furthermore, we PCR-amplified 15 fragments with different lengths of the 5⬘ flanking region of the APH-1A gene and subcloned them individually into a promoterless luciferase plasmid pGL3-Enhancer (Fig. 1B). These plasmids were transfected into HeLa cells (Fig. 1C) and rat cortical neurons (Fig. 1D). The promoter activity of different APH-1A fragments to drive luciferase expression was assayed. The results from HeLa cells and rat cortical neurons were similar (Fig. 1C, D). The levels of luciferase gene expression driven by the longest APH-1A gene 5⬘-flanking region, the 926 bp fragment, was ⬃20% of the positive control in HeLa cells and 26% in rat cortical neurons. Different deletions from both ends of the 926 bp fragment either increased or decreased luciferase activity, which suggests that both cis- and transacting regulatory regions 0892-6638/06/0020-1275 © FASEB
exist between bp –746 to bp ⫹ 180. Luciferase activity driven by the 271 bp fragment was similar to the positive control, which suggests that the sequence from bp –233 to bp ⫹ 38 possesses a basic promoter apparatus. 2. The APH-1A gene promoter contains AP4 and HIF-1 binding sites To identify potential transcription factor binding sites, we analyzed the sequence shown in Fig. 1A. Prediction analysis revealed that the core promoter region possesses two AP1 consensuses, three AP4 consensuses, and one HIF-1 consensus (Fig. 1A). We mutated these potential binding sites individually and cloned them into the reporter vector. The promoter activity of these mutated fragments to drive luciferase expression was studied and compared with that of wild-type controls. Our results showed that mutations of the two AP1 sites (m1 and m2) had little effect on the promoter activity, whereas mutation of the HIF-1 site (m3) dramatically decreased the luciferase activity. Moreover, mutation of an AP4 site (m4) significantly reduced the luciferase activity, but mutations of the other two AP4 sites (m5 and m6) dramatically increased the luciferase activity. These results suggest that HIF-1 and AP4 are potential transcription factors regulating APH-1A expression. 3. AP4 and HIF-1 bind to APH-1A promoter in vitro To investigate the binding of AP4 and HIF-1 to the promoter region, we performed EMSA. For AP4, we 1
These authors contributed equally to this work. Correspondence: Z.Z., National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha 410078, Hunan, China. E-mail:
[email protected]; and H.X., Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, Xiamen University, Xiamen 361005, China. E-mail:
[email protected] doi: 10.1096/fj.06-5839fje 2
1275
Figure 1. Sequence features and functional deletion analysis of the human APH-1A gene promoter. A) The 5⬘-flanking region of the human APH-1A gene was shown. The numbering was based on the transcription initiation site, which was grayed/ boldfaced and defined as ⫹1. The potential transcription factor binding sites were underlined/boldfaced. The proteinencoding sequence was italicized; m1 to m6 denote each transcription factor-binding site that was mutated for the mutagenesis study. B) Schematic diagram of the APH-1A promoter deletion constructs consisting of a 5⬘ flanking region with serial deletions cloned into the promoterless vector pGL3-Enhancer. The numbers represent the end-points of each construct. The deletion plasmids were confirmed by sequencing and restriction enzyme digestion, and the digested samples were analyzed on a 1.5% agarose gel. C, D) The constructed plasmids were cotransfected with phRL-SV40 into HeLa cells (C) or rat cortical neurons (D). Luciferase activity was measured after 24 h with a luminometer. Renilla luciferase activity expressed by phRL-SV40 was used to normalize the transfection efficiency. The values represent means ⫾ se (nⱖ3), *P ⬍ 0.05 vs. pGL3-control, **P ⬍ 0.001 vs. pGL3-control (by ANOVA with the post hoc Newmann-Keuls test).
used the sequence corresponding to the APH-1A promoter region from bp –105 to bp – 83 as a probe. Incubation of this probe with HeLa nuclear extracts resulted in a formation of a DNA-protein complex, which migrated at the same position of an AP4 consensus binding probe–protein complex (as positive control). The APH-1A AP4 probe–protein complex formation was dramatically inhibited by competitive binding with unlabeled AP4 consensus and APH-1A AP4 probe but not affected by competition from an SP1 consensus probe. These results indicate that the identified AP4 binding element can form a complex with nuclear AP4 protein in vitro. Initial studies showed that incubation of the HIF-1 probes with HeLa nuclear extracts failed to produce any binding. However, when HeLa cells were treated with 1 mM NiCl2 for 20 h (a condition of chemical hypoxia) and the nuclear extracts were incubated with the HIF-1 probes, a probe–protein complex was detected for both the probe corresponding to the APH-1A promoter region from bp ⫹ 100 to bp ⫹ 122 and a HIF-1 consensus probe. Competitive binding with unlabeled HIF-1 consensus and APH-1A HIF-1 probe significantly inhibited the complex formation, whereas competitive binding with mutated APH-1A HIF-1 probe and SP1 probe had little effect. These results indicate that the APH-1A HIF-1 binding element can form a complex with nuclear HIF-1 protein in vitro, when HIF-1 concentration is increased under NiCl2 treatment.
in APH-1A expression. It has been well known that HIF-1 activity is low under physiological conditions but increases dramatically under hypoxia. Some metals such as nickel and cobalt can increase HIF-1 activity and promote HIF-1-dependent transcription, mimicking hypoxic effects. Having shown that HIF-1 binds to APH-1A promoter region under NiCl2 treatment in vitro, we further investigated whether HIF-1 regulates APH-1A expression in vivo. The APH-1A mRNA was significantly increased upon NiCl2 treatments in a time-dependent pattern in HeLa cells. Concomitantly, the protein concentration of APH-1A was also dramatically increased upon 2 and 4 h NiCl2 treatments, in response to increased HIF-1␣ concentration (Fig. 2A).
4. HIF-1 regulates APH-1A expression
CONCLUSIONS AND SIGNIFICANCE
Due to a lack of any known reagents that can regulate AP4 activity, we focused our study on the roles of HIF-1
The proteolytic cleavage of APP and Notch is mediated by the PS/␥-secretase complex, which consists of pre-
1276
Vol. 20
June 2006
5. Chemical hypoxia increases ␥-secretase mediated A and NICD formation Although the APH-1 concentration was significantly increased upon short-term nickel treatment, the levels of APP, as well as the other three ␥-secretase components, PEN-2, PS1, and nicastrin, remained unchanged. Interestingly, we found that A secretion was significantly increased upon 2 or 4 h treatment, accompanied with decreased APP CTFs and increased sAPP␣ (Fig. 2B), which indicates increased ␥-secretase activity presumably as a result of increased APH-1A concentration. In addition, we found that short-term NiCl2 treatments increased the steady-state levels of Notch NICD (Fig. 2B).
The FASEB Journal
WANG ET AL.
Figure 2. Effects of HIF-1 activation on expression of ␥-secretase components and proteolytic cleavage of APP and Notch. HeLa cells stably expressing human APP were treated with or without 1 mM NiCl2 for 2 or 4 h. A) Equal amounts of cell lysates were analyzed and immunoblotted with antibodies against HIF-1␣, APH-1A, PEN-2, PS1-NTF, nicastrin, APP/APP CTFs, and ␣-tubulin, respectively. B) The conditioned media were assayed for sAPP␣ by immunoblotting with antibody (Ab) 6E10 and for A by immunoprecipitation using Ab 4G8 followed by Western blot analysis using 6E10. For assaying Notch, cells were transiently transfected with Notch⌬E construct and cell lysates were immunoblotted with anti-myc Ab 9E10 to detect Notch and NICD. The protein levels were quantified and normalized to controls. Note: For (A), the control was samples treated for 0 h; for (B), the control was the untreated samples at each time point. The ratios of NICD over Notch ⌬E were calculated and then normalized to controls. Data represent means ⫾ se from three separate experiments.
senilins, nicastrin, APH-1, and PEN-2. Although the four components are known to coordinately regulate each other at the protein level, information regarding their transcription regulation is scarce. In the present study, we characterized the human APH-1A promoter region and demonstrated that AP4 and HIF-1 bind to the promoter. More importantly, we found that activation of HIF-1 by short-term NiCl2 treatments (chemical hypoxia) dramatically increased APH-1A mRNA and protein expression. Although NiCl2 treatments had little effect on APP and the other three ␥-secretase components, we noticed an increased secretion of A accompanied by a decreased APP CTFs formation, indicative of an increase in ␥-secretase activity. In addition, the secretion of sAPP␣, a derivative of APP through ␣-secretase cleavage, was increased. Furthermore, the cellular concentration of Notch intracellular domain (NICD) was also increased by the chemical hypoxic treatment. While no clear explanations for these perplexing results can be provided at present, we speculate the following: First, APH-1 may be the limiting factor for ␥-secretase activity and increased APH-1 concentration alone may be sufficient to elevate the ␥-secretase activity. Second, hypoxia has been known to affect membrane potential via mediating ion channels, hence nickel treatments or chemical hypoxia could change the intracellular/intramembranous microenvironHYPOXIA REGULATES APH-1 EXPRESSION AND ␥-SECRETASE
ments, rendering the substrates more susceptible to the ␥-secretase. Finally, based on our recent findings that activation of protein kinase A (by forskolin) or MAPK by insulin/insulin-like growth factor-1 promotes secretion of both A and sAPP␣ (or the trafficking of APP/A-containing vesicles from the trans-Golgi network), we could envision a similar stimulation by some yet unknown mechanisms involving HIF-1 activation. This may also possibly explain our observation of increased Notch cleavage. The formation of NICD has been thought to occur mainly at the plasma membrane, a site where ␣-secretase was known to be highly active. A recent finding that hypoxia promotes the Rab11mediated trafficking of the ␣64 integrin, together with our previous finding that Rab11 is a key trafficking factor for the estrogen-stimulated APP secretion, provided indirect but reasonable support to the trafficking hypothesis. Together, our results demonstrate that APH-1A expression and the ␥-secretase mediated A and Notch NICD generation are regulated by hypoxia/HIF-1 (Fig. 3). The specific control of APH-1A expression by HIF-1 may imply physiological functions uniquely assigned to APH-1A.
Figure 3. Schema of the features of the APH-1A promoter, and the hypoxia/HIF-1 regulated APH-1A expression and APP/Notch processing. The major transcription initiation site (TIS, numbered at ⫹1) is at 211 bp upstream of the APH-1A protein coding sequence (CDS). Sequence prediction, mutagenesis, and gel shift assays showed that the APH-1A promoter possesses three AP4 binding sites and one HIF-1 binding site, which was predicted from bp ⫹ 103 to bp ⫹ 117. Nickel treatment (a condition of chemical hypoxia) or hypoxia increases HIF-1␣ concentration, which binds to HIF-1 to form activated HIF-1 heterodimers. Activated HIF-1 promotes the transcription and translation of APH-1A. Increased APH-1A concentration probably promotes the ␥-secretase activity, hence enhances the processing of APP to generate A and the cleavage of Notch to release NICD. Alternatively, it is possible that nickel/hypoxia changes the intracellular/intramembranous microenvironments or affects protein intracellular trafficking, rendering the substrates more susceptible to the ␥-secretase. The dashed lines indicate hypothetical regulatory pathways. 1277
The FASEB Journal • FJ Express Full-Length Article
Transcriptional regulation of APH-1A and increased ␥-secretase cleavage of APP and Notch by HIF-1 and hypoxia Ruishan Wang,*,†,1 Yun-wu Zhang,‡,1 Xian Zhang,*,‡ Runzhong Liu,* Xue Zhang,‡ Shuigen Hong,* Kun Xia,† Jiahui Xia,† Zhuohua Zhang,†,‡,2, and Huaxi Xu*,†,‡,2 *Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, and Institute for Biomedical Research, Xiamen University, Xiamen, China; †National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha, China; and ‡Center for Neuroscience and Aging, Burnham Institute for Medical Research, La Jolla, California, USA The proteolytic cleavage of Alzheimer -amyloid precursor protein (APP) and signaling receptor Notch is mediated by the PS/␥-secretase complex, which consists of presenilins, nicastrin, APH-1, and PEN-2. Although the four components are known to coordinately regulate each other at the protein level, information regarding their transcription regulation is scarce. Here we characterized the 5ⴕ-flanking region of the human APH-1A gene and identified a 271-bp fragment containing the transcription initiation site for the promoter activity. Sequence analysis, mutagenesis, and gel shift studies revealed a binding of AP4 and HIF-1 to the promoter, which affects the promoter activity. Activation of HIF-1 by short-term NiCl2 treatments (a condition of chemical hypoxia) dramatically increased APH-1A mRNA and protein expression, accompanied by increased secretion of A and decreased APP CTFs formation, indicative of an increase in ␥-secretase activity. NiCl2 treatments had little effect on APP and the other three components of the ␥-secretase complex. The cellular concentration of Notch intracellular domain (NICD) was also increased by the hypoxic treatment. Our results demonstrate that APH-1A expression and the ␥-secretase mediated A and Notch NICD generation are regulated by HIF-1, and the specific control of APH-1A expression may imply physiological functions uniquely assigned to APH-1A.— Wang, R., Zhang, Y-w., Zhang, X., Liu, R., Zhang, X., Hong, S., Xia, K., Xia, J., Zhang, Z., Xu, H. Transcriptional regulation of APH-1A and increased ␥-secretase cleavage of APP and Notch by HIF-1 and hypoxia. FASEB J. 20, E614 –E622 (2006) ABSTRACT
Key Words: Alzheimer’s disease 䡠 AP4 䡠 promoter
cies, mostly A40 and the more deleterious A42, which are generally believed to cause Alzheimer’s disease. Alternatively, APP can be cleaved by ␣-secretase to generate the nonamyloidogenic soluble APP␣ (1, 2). Due to the importance of A generation in AD pathogenesis, regulation of PS/␥-secretase function/activity has become an extensive target of scrutiny. Besides APP, the PS/␥-secretase complex has been found to cleave a number of functionally important proteins such as Notch (3, 4), E-cadherin (5), ErbB4 (6), CD44 (7), etc., suggesting the involvement of PS/␥-secretase in a broad range of biological activities. The PS/␥-secretase is a high molecular weight complex that consists of at least four components: presenilin (PS), nicastrin (Nct), anterior pharynx-defective-1 (APH-1), and presenilin enhancer-2 (PEN-2) (8 –10). PS is generally believed to be the catalytic component of the PS/␥-secretase complex. Nascent PS undergoes endoproteolytic cleavage to generate an amino-terminal fragment (NTF) and a carboxyl-terminal fragment (CTF) to form functional PS heterodimer (11). Type I transmembrane glycoprotein Nct is the first identified protein cofactor of PS (12, 13). APH-1 and PEN-2 were identified through genetic screening in Caenorhabditis elegans (14, 15). Recent studies have demonstrated that the four components of PS/␥-secretase regulate each other in a coordinate way; down-regulation/deficiency of a given component typically results in a decrease in the concentration and impaired trafficking/maturation of other components, hence leading to inactivation of the enzymatic activity (8 –10, 16 –19). While no other homologue exists for Nct and PEN-2, PS and APH-1 possess two homologs in mammals, 1
-amyloids (A), the major components of senile plaques that accumulate in the brain of Alzheimer’s disease (AD) patients, are small peptides derived from -amyloid precursor protein (APP). APP can be sequentially cleaved by -secretase (BACE1) and PS/␥secretase complex to generate heterogeneous A speE614
These authors contributed equally to this work. Correspondence: Z. Z., National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha 410078, Hunan, China. E-mail: benzz @burnham.org; and H. X., Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, Xiamen University, Xiamen 361005, China. E-mail:
[email protected] doi: 10.1096/fj.06-5839fje 2
0892-6638/06/0020-0614 © FASEB
namely presenilin 1 (PS1) and presenilin 2 (PS2) (20 –22) and APH-1A and APH-1B. Murines have a third APH-1 homologue as APH-1C (14, 15, 17). PS1 or PS2 each has several spliced transcripts (23, 24). APH-1A has two spliced isoforms, a long form (APH1AL) and a short form (APH-1AS) (14, 15, 17). Recently a novel human APH-1B splice variant lacking exon 4 was also found (25). The existence of PS and APH-1 homologs/isoforms suggests that PS/␥-secretase is heterogeneous and that various PS/␥-secretase complexes might be associated with different functional specificity (26). Thus, knowledge regarding the regulation of PS/␥-secretase components, including regulation at transcriptional levels, is important for dissecting the physiological functions of different PS/␥-secretase complexes. Several studies have identified promoter regions of presenilins, showing that transcription of PS1 may be regulated by the cyclic AMP-response elementbinding protein (CREB) (27), Ets factors, Sp1 (28), and/or possibly HIF-1␣ (29). Recently we identified the promoter region of PEN-2 and demonstrated that PEN-2 may be regulated by CREB (30). In the present study, we identify and characterize the promoter region of APH-1A. Furthermore, we demonstrate that transcription factor AP4 and HIF-1 play a significant role in regulating APH-1A gene expression.
(Promega, Madison, WI). Site-directed mutations were integrated into the APH-1A promoter fragments by overlapping PCR and the mutated fragments were then cloned into vectors. To generate these mutants, two end primers, 5⬘ GGGGTACCAGCCACTCCCAGGACGAAGTCAAG 3⬘ and 5⬘ GAAGATCTGGGAGTCCGCGTGGGGTGGCAAC 3⬘, were used in combination with various primers with mutations: AP1 (m1), 5⬘ GGGGTACCAGCCACTCCCAGGACGAAGTACAGGCCTCGGAAG 3⬘; AP1 (m2), 5⬘ GTCTGGGGGGTACATTGCACCG 3⬘, and its reverse complementary sequence (RCS); HIF-1 (m3), 5⬘ GCACCGCGCCCCTCATGG 3⬘, and its RCS; AP4 (m4), 5⬘ CTACAACTCCTAGCAGGTCGAG 3⬘, and its RCS; AP4 (m5), 5⬘ CAGGTCGAGTAGTTCCGCC CGC 3⬘, and its RCS; and AP4 (m6), 5⬘ CGGACTC CCTAGCTGGCG 3⬘, and its RCS. Mutations are shown in boldface, italicized type. Transient transfection and reporter gene assays Transient transfections were carried out using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions. To normalize the different transfection efficiencies of various luciferase constructs, the phRL-SV40 plasmid containing Renilla Luciferase gene was cotransfected into the cells in a molar ratio of 1: 50 (phRL-SV40:pGL3). Cells were harvested 24 h (pGL3-Enhancer chimeric plasmids) or 48 h (pGL3Basic chimeric plasmids) after transfection and lysed with passive lysis buffer (Promega). Firefly luciferase activities and Renilla luciferase activities were measured sequentially using Dual-luciferase reporter assay system (Promega) and a Luminometer (Beckman, Fullerton, CA).
MATERIALS AND METHODS 5ⴕ-RACE Cell culture HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS. HeLa cells stably expressing human APP Swedish mutation construct (HeLaAPP Swe) were cultured in DMEM supplemented with 10% FBS and 200 g/ml G418. Primary rat neuronal cultures were derived from the cerebral cortices of embryonic day 17–19 Sprague-Dawley rat embryos and cultured in serum-free NeurobasalTM-A Medium (Invitrogen, Carlsbad, CA) with B-27 supplement (Invitrogen) (31). All cells were maintained at 37°C in an incubator containing 5% CO2. Cloning of APH-1A promoter, construction of luciferase reporter plasmids and site-directed mutagenesis Polymerase chain reaction (PCR) was performed to amplify the 5⬘-flanking regions of the APH-1A gene using human peripheral blood lymphocyte genomic DNA as templates. The primers used to generate different promoter deletion plasmids were as follows: forward (with KpnI site), 5⬘ GGGGTACCTCATTCACTCTAATATACAACCCCTC 3⬘, 5⬘ GGGGTACCGAATTTATGGCGGGGGTGGGGTG 3⬘, 5⬘ GGGGTACCAGCAGCTCTAGCCCATTTCCTCTC 3⬘, 5⬘ GGGGTACCTTCAAACAGGATCTACCCCCTC 3⬘, 5⬘ GGGGTACCCGAAAGG AAACAGCGACGGAAG 3⬘, 5⬘ GGGGTACCAGCCACTCCCAGGACGAAGTCA AG 3⬘ and 5⬘ GGGGTACCAGGCGACTACAACTCCCAGCAG 3⬘; reverse (with BglII site), 5⬘ GAAGATCTTGACCAGGACAGGCAAATGGGAG 3⬘, 5⬘ GAAGATCTGGGAGTCCGCGTGGGGTGGCAAC 3⬘ and 5⬘ GAAGATCTGTCCGC GCCACTTCCTCTAC 3⬘. The resulting PCR-amplified fragments were cloned into the multicloning sites upstream of luciferase reporter gene in the pGL3-enhancer expression vector HYPOXIA REGULATES APH-1 EXPRESSION AND ␥-SECRETASE
Total RNA was extracted from healthy human liver with Trizol reagent (Invitrogen). 5⬘ rapid amplification of cDNA ends (5⬘-RACE) was performed using BD SMART TM RACE cDNA Amplification Kit(BD Bioscience, San Jose, CA) following the manufacturer’s suggested procedures. To amplify the 5⬘ untranslated region of APH-1A, two gene-specific primers were used: GSP-APH-1A-1, 5⬘ GACGAAAGTG CAGCCGAAAAACACCGCAG 3⬘ and GSP-APH-1A-2, 5⬘ CAGCTGGGGAGTCCG CGTGGGGTGGCAAC 3⬘. The PCR products were cloned into pGEM T vector (Promega) and sequenced with primer SP6. EMSA EMSA was carried out essentially the same as described previously (30). Briefly, oligonucleotides were synthesized and annealed with their respective complements to generate double-stranded probes, which include AP4wt (where wt is wild-type), containing a putative AP4 binding site corresponding to the APH-1A promoter from bp –105 to bp – 83 (5⬘ TAC AAC TCC CAG CAG GTC GAG CA 3⬘); AP4mut with a C3 T mutation (5⬘ TAC AAC TCC TAG CAG GTC GAG CA 3⬘); HIF-1wt containing a putative HIF-1 binding site corresponding to the APH-1A promoter region bp ⫹ 100 to ⫹ 122 (5⬘ CCG CGC CCC TCG TGG GGT CGC GT 3⬘); HIF-1mut with a G3 A mutation (5⬘ CCG CGC CCC TCA TGG GGT CGC GT 3⬘); AP4 consensus sequence as described in reference 32 (5⬘ CAC CCG GTC AGC TGG CCT ACA CC 3⬘); HIF-1 consensus sequence as described in reference 33 (5⬘ ACC GGC CCT ACG TGC TGT CTC AC 3); and SP1 consensus sequence (Promega) (5⬘ ATT CGA TCG GGG CGG GGC GAG C 3⬘). Double-stranded AP4 wt and HIF-1wt were end-labeled with [␥-32P]ATP, incubated with nuclear extract from HeLa cells E615
and analyzed by nondenaturing PAGE and autoradiography. For the HIF-1 binding study, HeLa cells were treated with NiCl2 (1 mM) for 20 h before harvest for nuclear extracts. 32 P-labeled AP4 consensus sequence and HIF-1 consensus sequence incubated with HeLa nuclear extracts were used as positive control, respectively. For the competition assay, HeLa nuclear extracts were incubated with 1.75 pmol (50⫻ excess) of unlabeled competition oligonucleotides for 10 min prior to adding 35 fmol labeled probes. Northern blot hybridization HeLa-APP Swe cells were treated with 1 mM NiCl2 for indicated times, and total RNA was then extracted using Trizol reagent. RNAs were run on formaldehyde gels and transferred to nylon membranes. For Northern blot hybridization, the full-length of APH-1A was used as the probe. The probe for GAPDH has been reported previously (30). Probes were 32P-labeled using a random primed DNA labeling kit (Roche Molecular Biochemicals, Indianapolis, IN) and hybridized to Northern blots. Immunoblot and antibodies Cell lysates were analyzed by Tris-glycine SDS-PAGE, and proteins were detected by Western blot by using different antibodies as indicated. Rabbit anti-APH-1A polyclonal antibody (pAb) and anti-PEN-2 pAb were from ZYMED. Rabbit anti-PS1 NTF antibody (Ab) Ab14, anti-nicastrin Ab SP716, anti-APP Ab 369, and anti-BACE1 Ab 690 were developed in our lab (16, 18, 19). Mouse anti-HIF-1␣ Ab was from Novus Biologicals (Littleton, CO). Mouse anti-␣-tubulin Ab was from (Sigma, St. Louis, MO). Monoclonal antibodies 6E10 and 4G8 (Signet Laboratories, Dedham, MA) that recognize amino acid 1–17 and 17–24 of human A peptide, respectively, were used to detect soluble APP␣ and A. For assaying Notch, HeLa-APP Swe cells were transiently transfected with Notch ⌬E-myc construct. After NiCl2 treatment, the cell lysates were run on gel and immunoblotted with mouse anti-myc Ab 9E10 to visualize Notch and its intracellular domain (NICD).
RESULTS Promoter analysis of the APH-1A gene To determine the transcription initiation site of the human APH-1A gene, 5⬘-RACE was performed. Two gene-specific primers were used in PCR amplification, producing two fragments of ⬃180 and 260 bp, respectively (data not shown). The two PCR products were cloned into pGEM T vector and sequenced. The results indicated that the transcription initiation site of the APH-1A gene is located 211 bp upstream of the translation start codon ATG (Fig. 1A). We assigned the transcription initiation site as ⫹ 1 for numbering. To study the transcriptional regulation of APH-1A, we PCR-amplified 15 fragments with different length of the 5⬘ flanking region of the APH-1A gene and subcloned them individually into a promoterless luciferase plasmid, pGL3-Enhancer (Fig. 1B). These constructed plasmids were transfected into HeLa cells (Fig. 1C) and rat cortical neurons (Fig. 1D). The luciferase activity driven by different APH-1A fragments was assayed using E616
Vol. 20
June 2006
a dual luciferase system and normalized to cotransfected Renilla luciferase activity. The luciferase activity in cells transfected with the luciferase gene driven by an SV40 promoter was used as a positive control and defined as 100% for the normalization purpose, whereas the luciferase activity in cells transfected with empty pGL3-Enhancer was used as a negative control. As shown in Fig. 1C and D, the results from HeLa cells and rat cortical neurons were similar. The levels of luciferase gene expression driven by the longest APH-1A gene 5⬘-flanking region, the 926 bp fragment, was ⬃20% of the positive control in HeLa cells and 26% in rat cortical neurons. Different deletions from both ends of the 926 bp fragment either increased or decreased luciferase activity, suggesting that both cisacting regulatory regions and trans-acting regulatory regions exist between bp –746 to bp ⫹ 180. Luciferase activity driven by the 271 bp fragment was ⬃127 and 79% of the positive control in HeLa cells and in rat cortical neurons, respectively, suggesting the sequence from bp –233 to bp ⫹ 38 containing the transcription initiation site possesses a basic promoter apparatus. The APH-1A gene promoter contains AP4 and HIF-1 binding sites The sequence shown in Fig. 1A covers the 5⬘-flanking region of the human APH-1A gene, as well as a partial protein-encoding region. To identify potential transcription factor binding sites on the APH-1A promoter region, we first analyzed this sequence using MatInspector2.2 software (Genomatrix, Munich, Germany). We focused our analysis on the region with basic promoter activities. Prediction analysis revealed that this region possesses two AP1 consensuses, three AP4 consensuses, and one HIF-1 consensus (Fig. 1A). To define the potential transcription factor for the APH-1A promoter, we mutated these potential transcriptional factor binding sites individually. The mutated fragments were cloned into pGL3-Enhancer luciferase reporter vector, followed by promoter activity analysis. Mutations of the two AP1 sites had little effect on the promoter activity (Fig. 2). Mutation of the HIF-1 site resulted in a dramatic decrease of the luciferase activity (54% of the WT) control). Furthermore, mutation of an AP4 site (m4) significantly reduced the luciferase activity to 20% of the control, whereas mutations of the other two AP4 sites (m5 and m6) dramatically increased the luciferase activity (Fig. 2). These results suggest that HIF-1 and AP4 are potential transcriptional factors regulating APH-1A transcription. To further investigate the binding of AP4 and HIF-1 to the promoter region, we performed gel shift assays. For AP4, a double-stranded oligonucleotide sequence corresponding to the APH-1A promoter region from bp –105 to bp – 83 was synthesized and labeled as the probe. As shown in Fig. 3A (lane 3), a protein-DNA complex was detected after incubation of the probe with HeLa nuclear extracts. As a positive control, a classic AP4 binding oligoncleotide probe (see Materials
The FASEB Journal
WANG ET AL.
Figure 2. Mutation analysis of the potential transcription factor binding sites. HeLa cells were transfected with wild-type (WT) plasmid (pGL3-basic inserted with the APH-1A promoter 324-bp fragment), various mutant constructs, or the promoterless pGL3-basic as control (–). Relative luciferase activity was determined in triplicate, and data were normalized to Renilla luciferase activity expressed by phRL-SV40. Data represent means ⫾ se. *P ⬍ 0.05 vs. WT by ANOVA with the post hoc Newmann-Keuls test.
and Methods) was also shown to form a protein-DNA complex that migrated at the same position of APH-1A AP4 probe-protein complex (Fig. 3A, lane 2). Notably, the APH-1A AP4 probe was able to form the proteinDNA complex even more effectively than the classic AP4 consensus probe. The complex formation between APH-1A AP4 probe–protein was dramatically inhibited by competitive binding of the AP4 consensus (Fig. 3A, lane 4) and APH-1A AP4 probe (Fig. 3A, lane 5). In contrast, the APH-1A AP4 probe–protein complex formation was not affected by competition from an SP1 consensus probe (Fig. 3A, lane 7). The competitive binding with an AP4 mutant observed in Fig. 3A (lane 6) is likely due to a nonconservative mutation of the AP4 probe. Together, these results indicate that the identified AP4 binding element could form a complex with nuclear AP4 protein in vitro. Initial studies showed that incubation of the HIF-1 probes with HeLa nuclear extracts failed to produce any binding (data not shown). However, when HeLa cells were treated with 1 mM NiCl2 for 20 h (a condition of chemical hypoxia) and the nuclear extracts were incubated with the HIF-1 probes, a probe–protein
Figure 1. Sequence features and functional deletion analysis of the human APH-1A gene promoter. A) The 5⬘-flanking region of the human APH-1A gene ranging from bp –746 to bp ⫹ 229 was shown. The numbering was based on the transcription initiation site, which was grayed and in boldface and defined as ⫹1. The potential transcription factor binding sites were underlined and in boldface. The protein-encoding sequence was italicized. m1 to m6 denote each transcription factor binding site that was mutated for the mutagenesis study. B) Schematic diagram of the APH-1A promoter HYPOXIA REGULATES APH-1 EXPRESSION AND ␥-SECRETASE
deletion constructs consisting of a 5⬘ flanking region with serial deletions cloned into the promoterless vector pGL3Enhancer. The numbers represent the end-points of each construct. The deletion plasmids were confirmed by sequencing and restriction enzyme digestion, and the digested samples were analyzed on a 1.5% agarose gel. The vector size is 5.06 kb, and the sizes of APH-1A promoter deletion constructs range from 0.18 to 0.93 kb. C, D) The constructed plasmids were cotransfected with phRL-SV40 into HeLa cells (C) or rat cortical neurons (D). Luciferase activity was measured after 24 h with a luminometer. Renilla luciferase activity expressed by phRL-SV40 was used to normalize the transfection efficiency. The values represent means ⫾ se (nⱖ3), *P ⬍ 0.05 vs. pGL3-control, **P ⬍ 0.001 vs. pGL3-control (by ANOVA with the post hoc Newmann-Keuls test). E617
binding element could form a complex with nuclear HIF-1 protein in vitro, when HIF-1 concentration is increased under NiCl2 treatment. HIF-1 regulates APH-1A expression and hypoxic treatments increase ␥-secretase mediated A and NICD formation
Figure 3. EMSA for the APH-1A gene promoter. The gel shift assay was performed as described in Materials and Methods. A) AP4 binding. 32P-labeled AP4 consensus (cons.) probe (lane 2) and AP4 wild-type (wt) probe based on APH-1A promoter sequence (lanes 3–7) were incubated with HeLa nuclear extracts. For competition assays, a 50-fold molar excess of unlabeled competition oligonucleotides, including AP4 cons. (lane 4), AP4 wt (lane 5), AP4 mut containing a nucleotide (nt) mutation, and SP1 consensus sequence, were incubated with HeLa nuclear extracts prior to incubation with 32P-labeled AP4 wt probe. Lane 1, labeled AP4 wt probe without nuclear extract. B) HIF-1 binding. The assay was performed essentially the same as in (A), except that nuclear extracts were from HeLa cells pretreated with 1 mM NiCl2 for 20 h, and that the labeled probes used were HIF-1 cons. probe (lane 2) and HIF-1 wt probe based on APH-1A promoter sequence (lanes 3–7). Competition probes were HIF-1 cons., HIF-1 wt, HIF-1 mut containing a nt mutation and SP1 consensus probe. *Labeled AP4 consensus probe or HIF-1 consensus probe.
complex was detected for both the probe corresponding to the APH-1A promoter region from bp ⫹ 100 to bp ⫹ 122 (Fig. 3B, lane 3) and a HIF-1 consensus probe (Fig. 3B, lane 2). Competitive binding with unlabeled HIF-1 consensus (Fig. 3B, lane 4) and APH-1A HIF-1 probe (Fig. 3B, lane 5) significantly inhibited the complex formation between APH-1A HIF-1 probe and nuclear proteins. Competitive binding with mutated APH-1A HIF-1 probe and SP1 probe had little effect on the formation of probe-protein complex (Fig. 3B, lanes 6, 7). These results indicate that the APH-1A HIF-1 E618
Vol. 20
June 2006
In addition to a lack of any known reagents that can regulate AP4 activity, the perplexing observation that mutations at different AP4 sites had opposite effects on promoter activity has hindered our pursuit of AP4 regulation of APH-1A transcription. Hence, we focused on studying the roles of HIF-1 in APH-1A expression. HIF-1 has two subunits as HIF-1␣ and HIF-1. The concentration of HIF-1␣ is found to be low under physiological conditions but increases dramatically under hypoxia. Increased HIF-1␣ binds HIF-1 to form functional HIF-1 heterodimers, consequently regulating a series of gene expression events. Some metals such as nickel and cobalt increase HIF-1␣ levels and promote HIF-1-dependent transcription, mimicking hypoxic effects (34, 35). Having shown that HIF-1 binds to APH-1A promoter region under NiCl2 treatment in vitro, we further investigated whether HIF-1 regulates the expression of APH-1A in vivo. The APH-1A mRNA was found to significantly increase (up to 2.5-fold) upon NiCl2 treatments in a time-dependent pattern in HeLa cells (Fig. 4). The transcription of GAPDH, a known HIF-1 responsive gene (36), also increased correspondingly (Fig. 4). It has been well known that chronic chemical hypoxic conditions render dramatic stress to cells (34, 35). We indeed observed a significant slowdown on cell metabolism after 8 h NiCl2 treatment associated with a small proportion of cell death after 20 h treatments (by propidium iodide staining and MTT assays; data not shown). To study the effect of HIF-1 on protein expression, we treated HeLa cells stably expressing a mutant form of human APP with NiCl2 for short periods (2 and 4 h) to induce HIF-1 with minimal stress effects. We found that the NiCl2 treatment significantly resulted in an increased HIF-1␣ level (Fig. 5A) and a concomitant increase of APH-1A. The levels of APP, as well as the other three ␥-secretase components, PEN-2, PS1 (its NTF), and nicastrin, remained unchanged. Interestingly, we found that A secretion was significantly increased upon 2 or 4 h treatment, accompanied with decreased APP CTFs and increased sAPP␣ (Fig. 5B), indicative of increased ␥-secretase activity, which was presumably a result of increased APH-1A concentration. In addition, we also found that the short-term NiCl2 treatments increased the steady-state levels of Notch NICD (Fig. 5B).
DISCUSSION It has previously been shown that the transcription of -secretase gene BACE1 is regulated by SP1 (37).
The FASEB Journal
WANG ET AL.
Figure 4. Northern blot analysis of APH-1A RNA concentration change under HIF-1 activation. HeLa cells stably expressing human APP were treated with 1 mM NiCl2 for indicated time. Total RNAs were then extracted for Northern blot hybridization analysis. The mRNA levels of APH-1A and GAPDH were analyzed by autoradiography. The levels of 18s/28s rRNAs were visualized by ethidium bromide staining. The ratios of APH-1A over 18s/28s rRNA and GAPDH over 18s/28s rRNAs were calculated and normalized to those under 0 h treatment. Data represent means ⫾ se from three separate experiments.
Among the four ␥-secretase components, however, only the promoters of PEN-2 and PSs have been studied so far. Recently, we characterized the promoter region of PEN-2 and demonstrated that PEN-2 expression is regulated by CREB; activation of CREB by forskolin significantly stimulated the transcription and translation of PEN-2 (30). Pastorcic and Das (28) showed that Ets factors were involved in regulation of PS1 and that Ets factors were differentially utilized in human neuroblastoma SH-SY5Y and SK-N-SH cells. Mitsuda et al. (27) identified a CREB binding site on the PS1 promoter region and showed that both PS1 transcription and translation were up-regulated in SK-N-SH cells on CREB activation by NMDA. In addition, there are potential HIF binding sites on PS1/PS2 promoter regions. The hypoxia treatment potentiated PS1 gene expression in interleukin-1 and A42 treated human neural cells (29), implying that HIF-1 may be involved in stress-mediated PS transcriptional regulation. However, in our experiments, the PS1 concentration was not affected by increased HIF-1 activity on NiCl2 treatment (Fig. 5A). This discrepancy may be attributed to the use of different cell types and the ways of activating HIF-1. We chose nickel treatment as a means of hypoxia throughout our studies because more significant effects HYPOXIA REGULATES APH-1 EXPRESSION AND ␥-SECRETASE
Figure 5. Effects of HIF-1 activation on expression of ␥-secretase components and proteolytic cleavage of APP and Notch. HeLa cells stably expressing human APP were treated with or without 1 mM NiCl2 for 2 or 4 h. A) Equal amounts of cell lysates were analyzed and immunoblotted with antibodies against HIF-1␣, APH-1A, PEN-2, PS1-NTF, Nicastrin, APP/APP CTFs, and ␣-tubulin, respectively. B) The conditioned media were assayed for sAPP␣ by immunoblotting with Ab 6E10 and for A by immunoprecipitation using Ab 4G8 followed by Western blot analysis using 6E10. For assaying Notch, cells were transiently transfected with Notch⌬E construct and cell lysates were immunoblotted with antimyc Ab 9E10 to detect Notch and NICD. The protein levels were quantified for all samples and normalized to controls. Note: for (A), the control was samples treated for 0 h; for (B), the control was the untreated samples at each time point. The ratios of NICD over Notch ⌬E were calculated and then normalized to controls. Data represent means ⫾ se from three separate experiments. E619
on APH-1 expression were observed when using NiCl2 than low oxygen hypoxic treatment. Nickel is recognized as a human carcinogen and possible mechanisms underlying the carcinogenic actions of nickel include oxidative stress, genomic DNA damage, epigenetic effects, and gene expression regulation by activation of certain transcription factors such as HIF-1 (34, 35, 38). Upon short-term treatment (ⱕ4 h) with NiCl2 to mimic hypoxia while minimizing other harmful effects to cells, APH-1A concentration was dramatically increased in response to increased HIF-1 concentration. Interestingly, the secretion of A was significantly increased accompanied by reduced APP CTFs, and the steadystate levels of Notch NICD was also increased. All of the observations imply an increased ␥-secretase activity. Several previous studies reporting increased gene expression downstream of Notch signaling in response to hypoxia provided indirect evidence indicative of regulation by HIF-1/hypoxia of ␥-secretase activity (39, 40). Although it is suggested that the ␥-secretase activity requires precise stoichiometric interaction among all four components, the levels of the other three ␥-secretase components were found to be unaffected by the nickel treatments. Furthermore, the secretion of sAPP␣, which is regarded as a competitive pathway to that for A (1), was indeed also increased. While no explicit explanations for these perplexing results can be provided at present, we reason the following speculations: First, APH-1 may indeed be the limiting factor for ␥-secretase activity and increased APH-1 concentration alone may be sufficient to elevate the ␥-secretase activity. Second, hypoxia has been known to affect membrane potential via mediating ion channels (41), hence nickel treatments or chemical hypoxia could change the intracellular/intramembranous microenvironments, rendering the substrates more susceptible to the ␥-secretase. Additionally, based on our recent findings that activation of protein kinase A by forskolin or MAPK by insulin/ insulin-like growth factor-1 promotes secretion of both A and sAPP␣ (or the trafficking of APP/A-containing vesicles from the trans-Golgi network) (30, 42, 43), we could envision a similar stimulation by yet-unknown mechanisms involving HIF-1 activation. A possibility of increased Notch trafficking to the plasma membrane by hypoxia could also exist to account for our observation of increased Notch cleavage. The formation of NICD has been thought to occur mainly at the plasma membrane—a site where ␣-secretase was known to be highly active (44 – 46). It has recently been reported that hypoxia promotes the Rab11-mediated trafficking of the ␣64 integrin (47). This work, together with our previous finding that Rab11 is a key trafficking factor for the estrogen-stimulated APP secretion (48), provided indirect but reasonable support to the trafficking hypothesis. While each of the identified components of the ␥-secretase is essential for its activity, little is known about the biology of nicastrin, APH-1, and PEN-2, and the nature of their involvement in APP/Notch processing. Further, numerous reports have assigned additional physiological functions to PS, including calcium E620
Vol. 20
June 2006
homeostasis, skeletal development, neurite outgrowth, apoptosis, synaptic plasticity, and tumorigenesis (49 – 52). In addition, although mice individually lacking PS1 (53), nicastrin (54, 55), or APH-1A (17) are embryonically lethal, these knockout models exhibit similar but distinguishable patterning defects at early embryonic stages. In the present study, HIF-1 activation promoted APH-1 expression differently from the expression of other ␥-secretase components. Consequently, the HIF-1/hypoxia-stimulated APH-1A expression regulates the ␥-secretase cleavage and/or trafficking of APP and Notch. These results suggest that additional physiological functions may be uniquely assigned to APH-1A through the specific control of APH-1A expression. We thank Zonglei Zhang, Jie Ling, and Fang Cai for technical assistance. This work was supported in part by National Institutes of Health grants (RO1 NS046673 to H.X., RO1 AG024895 to H.X., and RO1 DC006497 to Z.Z.), grants from the Alzheimer’s Association (to H.X. and Z.Z.), American Health Assistance Foundation (to H.X.) and funds from the National Natural Science Foundation of China (No. 30572077 and 30370737), China’s 973 Project (2002BA711A07– 08) and 863 Project (2001CB510302). Y.-w. Z. is the recipient of National Institutes of Health training grant F32 AG024895.
REFERENCES 1. 2. 3.
4.
5.
6. 7.
8. 9. 10.
Greenfield, J. P., Gross, R. S., Gouras, G. K., and Xu, H. (2000) Cellular and molecular basis of beta-amyloid precursor protein metabolism. Front. Biosci. 5, D72– 83 Golde, T. E. (2005) The Abeta hypothesis: leading us to rationally-designed therapeutic strategies for the treatment or prevention of Alzheimer disease. Brain Pathol. 15, 84 – 87 De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J., Goate, A., and Kopan, R. (1999) A presenilin-1dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398, 518 –522 Song, W., Nadeau, P., Yuan, M., Yang, X., Shen, J., and Yankner, B. A. (1999) Proteolytic release and nuclear translocation of Notch-1 are induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. Proc. Natl. Acad. Sci. U. S. A. 96, 6959 – 6963 Marambaud, P., Shioi, J., Serban, G., Georgakopoulos, A., Sarner, S., Nagy, V., Baki, L., Wen, P., Efthimiopoulos, S., Shao, Z., Wisniewski, T., and Robakis, N. K. (2002) A presenilin-1/ gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions. EMBO J. 21, 1948 –1956 Ni, C. Y., Murphy, M. P., Golde, T. E., and Carpenter, G. (2001) gamma -Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294, 2179 –2181 Lammich, S., Okochi, M., Takeda, M., Kaether, C., Capell, A., Zimmer, A. K., Edbauer, D., Walter, J., Steiner, H., and Haass, C. (2002) Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J. Biol. Chem. 277, 44754 – 44759 De Strooper, B. (2003) Aph-1, Pen-2, and Nicastrin with Presenilin generate an active gamma-Secretase complex. Neuron 38, 9 –12 Iwatsubo, T. (2004) The gamma-secretase complex: machinery for intramembrane proteolysis. Curr. Opin. Neurobiol. 14, 379 – 383 Kimberly, W. T., LaVoie, M. J., Ostaszewski, B. L., Ye, W., Wolfe, M. S., and Selkoe, D. J. (2003) ␥-Secretase is a membrane
The FASEB Journal
WANG ET AL.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26. 27.
protein complex comprised of presenilin, nicastrin, aph-1, and pen-2. Proc. Natl. Acad. Sci. U. S. A. 100, 6382– 6387 Thinakaran, G., Borchelt, D. R., Lee, M. K., Slunt, H. H., Spitzer, L., Kim, G., Ratovitsky, T., Davenport, F., Nordstedt, C., Seeger, M., Hardy, J., Levey, A. I., Gandy, S. E., Jenkins, N. A., Copeland, N. G., Price, D. L., and Sisodia, S. S. (1996) Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17, 181–190 Yu, G., Nishimura, M., Arawaka, S., Levitan, D., Zhang, L., Tandon, A., Song, Y. Q., Rogaeva, E., Chen, F., Kawarai, T., et al. (2000) Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature 407, 48 –54 Yang, D. S., Tandon, A., Chen, F., Yu, G., Yu, H., Arawaka, S., Hasegawa, H., Duthie, M., Schmidt, S. D., Ramabhadran, T. V., et al. (2002) Mature glycosylation and trafficking of nicastrin modulate its binding to presenilins. J. Biol. Chem. 277, 28135– 28142 Goutte, C., Tsunozaki, M., Hale, V. A., and Priess, J. R. (2002) APH-1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos. Proc. Natl. Acad. Sci. U. S. A. 99, 775–779 Francis, R., McGrath, G., Zhang, J., Ruddy, D. A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M. C., et al. (2002) aph-1 and pen-2 are required for Notch pathway signaling, gamma-secretase cleavage of betaAPP, and presenilin protein accumulation. Dev. Cell 3, 85–97 Zhang, Y. W., Luo, W. J., Wang, H., Lin, P., Vetrivel, K. S., Liao, F., Li, F., Wong, P. C., Farquhar, M. G., Thinakaran, G., and Xu, H. (2005) Nicastrin is critical for stability and trafficking but not association of other presenilin/gamma-secretase components. J. Biol. Chem. 280, 17020 –17026 Ma, G., Li, T., Price, D. L., and Wong, P. C. (2005) APH-1a is the principal mammalian APH-1 isoform present in gamma-secretase complexes during embryonic development. J. Neurosci. 25, 192–198 Wang, H., Luo, W. J., Zhang, Y. W., Li, Y. M., Thinakaran, G., Greengard, P., and Xu, H. (2004) Presenilins and gammasecretase inhibitors affect intracellular trafficking and cell surface localization of the gamma-secretase complex components. J. Biol. Chem. 279, 40560 – 40566 Luo, W. J., Wang, H., Li, H., Kim, B. S., Shah, S., Lee, H. J., Thinakaran, G., Kim, T. W., Yu, G., and Xu, H. (2003) PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1. J. Biol. Chem. 278, 7850 –7854 Sherrington, R., Rogaev, E. I., Liang, Y., Rogaeva, E. A., Levesque, G., Ikeda, M., Chi, H., Lin, C., Li, G., Holman, K., et al. (1995) Cloning of a gene bearing mis-sense mutations in early-onset familial Alzheimer’s disease. Nature 375, 754 –760 Levy-Lahad, E., Wasco, W., Poorkaj, P., Romano, D. M., Oshima, J., Pettingell, W. H., Yu, C., Jondro, P. D., Schmidt, S. D., Wang, K., et al. (1995) Candidate gene for the chromosome 1 familial Alzheimer’s disease locus. Science 269, 973–977 Rogaev, E. I., Sherrington, R., Rogaeva, E. A., Levesque, G., Ikeda, M., Liang, Y., Chi, H., Lin, C., Holman, K., Tsuda, T., et al. (1995) Familial Alzheimer’s disease in kindreds with missense mutations in a gene on chromosome 1 related to the Alzheimer’s disease type 3 gene. Nature 376, 775–778 Rogaev, E. I., Sherrington, R., Wu, C., Levesque, G., Liang, Y., Rogaeva, E. A., Ikeda, M., Holman, K., Lin, C., Lukiw, W. J., et al. (1997) Analysis of the 5-prime sequence, genomic structure, and alternative splicing of the presenilin-1 gene (PSEN1) associated with early onset Alzheimer disease. Genomics 40, 415– 424 Smith, M. J., Sharples, R. A., Evin, G., McLean, C. A., Dean, B., Pavey, G., Fantino, E., Cotton, R. G., Imaizumi, K., Masters, C. L., et al. (2004) Expression of truncated presenilin 2 splice variant in Alzheimer’s disease, bipolar disorder, and schizophrenia brain cortex. Brain Res. Mol. Brain Res. 127, 128 –135 Saito, S., Takahashi-Sasaki, N., and Araki, W. (2005) Identification and characterization of a novel human APH-1b splice variant lacking exon 4. Biochem. Biophys. Res. Commun. 330, 1068 –1072 Shirotani, K., Edbauer, D., Prokop, S., Haass, C., and Steiner, H. (2004) Identification of distinct gamma-secretase complexes with different APH-1 variants. J. Biol. Chem. 279, 41340 – 41345 Mitsuda, N., Ohkubo, N., Tamatani, M., Lee, Y. D., Taniguchi, M., Namikawa, K., Kiyama, H., Yamaguchi, A., Sato, N., Sakata, K., et al. (2001) Activated cAMP-response element-binding
HYPOXIA REGULATES APH-1 EXPRESSION AND ␥-SECRETASE
28.
29.
30.
31.
32.
33.
34. 35. 36.
37.
38. 39.
40.
41.
42.
43.
44. 45.
46. 47.
protein regulates neuronal expression of presenilin-1. J. Biol. Chem. 276, 9688 –9698 Pastorcic, M., and Das, H. K. (2004) Alternative initiation of transcription of the human presenilin 1 gene in SH-SY5Y and SK-N-SH cells. The role of Ets factors in the regulation of presenilin 1. Eur. J. Biochem. 271, 4485– 4494 Bazan, N. G., and Lukiw, W. J. (2002) Cyclooxygenase-2 and presenilin-1 gene expression induced by interleukin-1beta and amyloid beta 42 peptide is potentiated by hypoxia in primary human neural cells. J. Biol. Chem. 277, 30359 –30367 Wang, R., Zhang, Y. W., Sun, P., Liu, R., Zhang, X., Zhang, X., Xia, K., Xia, J., Xu, H., and Zhang, Z. (2006) Transcriptional regulation of PEN-2, a key component of the ␥-secretase complex, by CREB. Mol. Cell. Biol. 26, 1347–1354 Xu, H., Gouras, G. K., Greenfield, J. P., Vincent, B, Naslund, J., Mazzarelli, L, Jovanovic, J. N., Seeger, M., Relkin, N. R., Liao, F., et al. (1998) Estrogen Reduces Neuronal Generation of Alzheimer -amyloid Peptides. Nat. Med. 4, 447– 451 Cheng, C. K., Hoo, R. L., Chow, B. K., and Leung, P. C. (2003) Functional Cooperation between Multiple Regulatory Elements in the Untranslated Exon 1 Stimulates the Basal Transcription of the Human GnRH-II Gene. Mol. Endocrinol. 17, 1175–1191 Chun, Y. S., Choi, E., Yeo, E. J., Lee, J. H., Kim, M. S., and Park, J. W. (2001) A new HIF-1 alpha variant induced by zinc ion suppresses HIF-1-mediated hypoxic responses. J. Cell Sci. 114, 4051– 4061 Maxwell, P., and Salnikow, K. (2004) HIF-1: an oxygen and metal responsive transcription factor. Cancer Biol. Ther. 3, 29 –35 Costa, M., Davidson, T. L., Chen, H., Ke, Q., Zhang, P., Yan, Y., Huang, C., and Kluz, T. (2005) Nickel carcinogenesis: Epigenetics and hypoxia signaling. Mutat. Res. 592, 79 – 88 Lu, S., Gu, X., Hoestje, S., and Epner, D. E. (2002) Identification of an additional hypoxia responsive element in the glyceraldehyde-3-phosphate dehydrogenase gene promoter. Biochim. Biophys. Acta 1574, 152–156 Christensen, M. A., Zhou, W., Qing, H., Lehman, A., Philipsen, S., and Song, W. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol. Cell. Biol. 24, 865– 874 Lu, H., Shi, X., Costa, M., and Huang, C. (2005) Carcinogenic effect of nickel compounds. Mol. Cell Biochem. 279, 45– 67 Gustafsson, M. V., Zheng, X., Pereira, T., Gradin, K., Jin, S., Lundkvist, J., Ruas, J. L., Poellinger, L., Lendahl, U., and Bondesson, M. (2005) Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev. Cell 9, 617– 628 Jogi, A., Ora, I., Nilsson, H., Lindeheim, A., Makino, Y., Poellinger, L., Axelson, H., and Pahlman, S. (2002) Hypoxia alters gene expression in human neuroblastoma cells toward an immature and neural crest-like phenotype. Proc. Natl. Acad. Sci. U. S. A. 99, 7021–7026 Seta, K., Kim, H. W., Ferguson, T., Kim, R., Pathrose, P., Yuan, Y., Lu, G., Spicer, Z., and Millhorn, D. E. (2002) Genomic and physiological analysis of oxygen sensitivity and hypoxia tolerance in PC12 cells. Ann. N. Y. Acad. Sci. 971, 379 –388 Xu, H., Sweeney, D., Greengard, P., and Gandy, S. (1996) Metabolism of Alzheimer beta-amyloid precursor protein: regulation by protein kinase A in intact cells and in a cell-free system. Proc. Natl. Acad. Sci. U. S. A. 93, 4081– 4084 Gasparini, L., Gouras, G. K., Wang, R., Gross, R. S., Beal, M. F., Greengard, P., and Xu, H. (2001) Stimulation of beta-amyloid precursor protein trafficking by insulin reduces intraneuronal beta-amyloid and requires mitogen-activated protein kinase signaling. J. Neurosci. 21, 2561–2570 Schroeter, E. H., Kisslinger, J. A., and Kopan, R. (1998) Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 393, 382–386 Tarassishin, L., Yin, Y. I., Bassit, B., and Li, Y. M. (2004) Processing of Notch and amyloid precursor protein by gammasecretase is spatially distinct. Proc. Natl. Acad. Sci. U. S. A. 101, 17050 –17055 Sisodia, S. (1992) Beta-amyloid precursor protein cleavage by a membrane-bound protease. Proc. Natl. Acad. Sci. U. S. A. 89, 6075– 6079 Yoon, S, O, Shin, S., and Mercurio, A. M. (2005) Hypoxia stimulates carcinoma invasion by stabilizing microtubules and promoting the Rab11 trafficking of the alpha6beta4 integrin. Cancer Res. 65, 2761–2769
E621
48.
49.
50.
51. 52.
E622
Greenfield, J. P., Leung, L. W., Cai, D., Kaasik, K., Gross, R. S., Rodriguez-Boulan, E., Greengard, P., and Xu, H. (2002) Estrogen lowers Alzheimer beta-amyloid generation by stimulating transGolgi network vesicle biogenesis. J. Biol. Chem. 277, 12128 –12136 Kang, D. E., Sang Yoon, I., Repetto, E., Busse, T., Yermian, N., Ie, L., and Koo, E. H. (2005) Presenilins mediate PI3K/Akt and ERK activation via select signaling receptors: selectivity of PS2 in PDGF signaling. J. Biol. Chem. 280, 31537–31547 Leem, J. Y., Vijayan, S., Han, P., Cai, D., Machura, M., Lopes, K. O., Veselits, M. L., Xu, H., and Thinakaran, G. (2002) Presenilin 1 is required for maturation and cell surface accumulation of nicastrin. J. Biol. Chem. 277, 19236 –19240 Sisodia, S. S., Kim, S. H., and Thinakaran, G. (1999) Function and dysfunction of the presenilins. Am. J. Hum. Genet. 65, 7–12 Thinakaran, G., and Parent, A. T. (2004) Identification of the role of presenilins beyond Alzheimer’s disease. Pharmacol. Res. 50, 411– 418
Vol. 20
June 2006
53.
Donoviel, D. B., Hadjantonakis, A. K., Ikeda, M., Zheng, H., St George-Hyslop, P., and Bernstein, A. (1999) Mice lacking both presenilin genes exhibit early embryonic patterning defects. Genes Dev. 13, 2801–2810 54. Li, J., Fici, G. J., Mao, C. A., Myers, R. L., Shuang, R., Donoho, G. P., Pauley, A. M., Himes, C. S., Qin, W., Kola, I., et al. (2003) Positive and negative regulation of the gamma-secretase activity by nicastrin in a murine model. J. Biol. Chem. 278, 33445–33449 55. Li, T., Ma, G., Cai, H., Price, D. L., and Wong, P. C. (2003) Nicastrin is required for assembly of presenilin/gamma-secretase complexes to mediate Notch signaling and for processing and trafficking of beta-amyloid precursor protein in mammals. J. Neurosci. 23, 3272–3277
The FASEB Journal
Received for publication January 26, 2006. Accepted for publication February 14, 2006.
WANG ET AL.
