Transcriptional Regulation of the Ferritin Heavy-Chain Gene: the ...

MOLECULAR AND CELLULAR BIOLOGY, Mar. 1997, p. 1387–1395 0270-7306/97/$04.0010 Copyright q 1997, American Society for Microbiology

Vol. 17, No. 3

Transcriptional Regulation of the Ferritin Heavy-Chain Gene: the Activity of the CCAAT Binding Factor NF-Y Is Modulated in Heme-Treated Friend Leukemia Cells and during Monocyte-to-Macrophage Differentiation G. MARZIALI,1 E. PERROTTI,1 R. ILARI,1 U. TESTA,2 E. M. COCCIA,1 1

AND

A. BATTISTINI1*

2

`, 00161 Rome, Italy Laboratory of Virology and Hematology and Oncology, Istituto Superiore di Sanita Received 10 October 1996/Returned for modification 14 November 1996/Accepted 11 December 1996

The ferritin H-chain gene promoter regulation was analyzed in heme-treated Friend leukemia cells (FLCs) and during monocyte-to-macrophage differentiation. In the majority of cell lines studied, the regulation of ferritin expression was exerted mostly at the translational level. However, in differentiating erythroid cells, which must incorporate high levels of iron to sustain hemoglobin synthesis, and in macrophages, which are involved in iron storage, transcriptional regulation seemed to be a relevant mechanism. We show here that the minimum region of the ferritin H-gene promoter that is able to confer transcriptional regulation by heme in FLCs to a reporter gene is 77 nucleotides upstream of the TATA box. This cis element binds a protein complex referred to as HRF (heme-responsive factor), which is greatly enhanced both in heme-treated FLCs and during monocyte-to-macrophage differentiation. The CCAAT element present in reverse orientation in this promoter region of the ferritin H-chain gene is necessary for binding and for gene activity, since a single point mutation is able to abolish the binding of HRF and the transcriptional activity in transfected cells. By competition experiments and supershift assays, we identified the induced HRF as containing at least the ubiquitous transcription factor NF-Y. NF-Y is formed by three subunits, A, B, and C, all of which are necessary for DNA binding. Cotransfection with a transdominant negative mutant of the NF-YA subunit abolishes the transcriptional activation by heme, indicating that NF-Y plays an essential role in this activation. We have also observed a differential expression of the NF-YA subunit in heme-treated and control FLCs and during monocyte-tomacrophage differentiation. basal expression, induction, or tissue-specific expression are poorly understood. Coulson and Cleveland (12) reported a transcription-dependent increase of ferritin mRNA levels in Chinese hamster ovary cells exposed to hemin. It has also been shown that iron acts at the transcriptional level to modulate the expression of the ferritin L gene in HeLa cells and hepatocytes without affecting the expression of the H gene (6, 46). Furthermore, tumor necrosis factor alpha and interleukin-1 selectively increase the ferritin H mRNA level in a variety of mesenchymal cell lines through a transcriptional mechanism (28). We have previously shown that in Friend leukemia cells (FLCs), transcriptional control is a relevant mechanism for the regulation of ferritin expression by heme (9–11). Heme (ironprotoporphyrin) is the prosthetic group of hemoproteins such as hemoglobin, catalase, and the cytochromes. As a prosthetic group, heme can regulate both the structure and the activity of hemoproteins, and it has been shown to function as an effector molecule that can regulate many biological processes including transcription, translation, transport, assembly, and protein degradation. It also plays an important role in cellular differentiation and maturation processes, and a significant amount of information is available on the role of hemin in the differentiation of the erythropoietic system (for a review, see reference 35). FLCs are erythroid precursors blocked in their differentiation pathway at the proerythroblastic stage. These cells can be induced to differentiate by treatment with several compounds (for a review, see reference 37) and thus represent an optimal cell culture model system for the study of the molecular mechanisms involved in regulation of ferritin expression in erythroid cells. An increase in ferritin accumulation accompanied by a

Ferritin is a ubiquitous intracellular iron storage protein, whose major role is to sequester and then detoxify intracellular iron that has not been otherwise utilized in cellular metabolism (38, 44). Iron is an essential constituent of some proteins, enzymes, and cofactors, and the regulation of its metabolism and homeostasis is an essential feature of living organisms. This homeostasis is maintained by the coordinate regulation of iron uptake via the transferrin receptor and iron sequestration by ferritin, within a hollow protein shell formed by subunits of two types, H and L. The H and L chains are found associated in various ratios, giving rise to a wide range of isoforms depending on the physiological conditions and the type of tissue (1). H-chain-rich ferritin accumulates and releases iron faster than L-chain-rich ferritin does (45) and predominates in erythropoietic tissues; the L subunit is better suited for long-term iron storage and accumulates in the liver and spleen (5). Intracellular iron is the master regulator of ferritin biosynthesis and accumulation. Extensive studies have shown that this regulation is mostly exerted posttranscriptionally by specific mRNA-protein interactions between the iron-regulatory proteins and the iron-responsive elements contained in the 59 untranslated region of the ferritin mRNA (26, 27). This translational control is probably the best-characterized level of regulation of ferritin synthesis in the majority of cell types studied. In contrast, the mechanisms and the trans-activating factor(s) by which ferritin transcription is regulated, in terms of either

* Corresponding author. Mailing address: Laboratory of Virology, Istituto Superiore di Sanita`, Viale Regina Elena, 299, 00161 Rome, Italy. Phone: (396) 49903266. Fax: (396) 49902082. E-mail: BATTIST @VIRUS1.ISS.INFN.IT. 1387

1388

MARZIALI ET AL.

pronounced increase in ferritin mRNA content (43) has also been observed during differentiation of monocytes to macrophages, the cell type mostly involved in iron storage. In this study, we analyzed the transcriptional regulation of the ferritin H-gene promoter in heme-treated FLCs and identified a minimum region of 77 nucleotides upstream of the TATA box, sufficient to confer a high level of expression to a reporter gene. This region contains a CCAAT box in reverse orientation and two Sp1 binding sites. Specific mutations in the CCAAT box are able to abolish both the formation of the complex and the transcriptional activity. Supershift experiments with specific antibodies in heme-treated FLCs show that the activity of the ferritin H-gene promoter fragment is associated with the formation of a complex which contains the CCAAT binding factor NF-Y (also known as CP1 and CBF) (22). NF-Y is a heteromeric transcription factor, which binds specifically to the CCAAT motifs of a large number of gene promoters (8, 15, 24, 34, 36). It is formed from at least three subunits (NF-YA, NF-YB, and NF-YC), all of which are necessary for DNA binding (13, 25, 42). The same factor(s) is present in extracts from macrophages, and its binding to the same element of the ferritin H-gene promoter significantly increases during the in vitro monocyte-to-macrophage differentiation. Interestingly, NF-Y activity seems to be modulated during differentiation in that freshly isolated monocytes possess the NF-YB but not the NF-YA subunit and do not show detectable NF-Y activity as assessed by electrophoretic mobility shift assay (EMSA). In contrast, macrophages synthesize both NF-YA and NF-YB and exhibit increasing NF-Y binding activity during the differentiation process. We also found an increase in NF-YA subunit but not in NF-YB subunit after heme treatment of FLCs. Our data shed light on the mechanism of transcriptional regulation of the ferritin H-chain gene and indicate that NF-Y plays a major role in this regulation both in heme-treated FLCs and during monocyte-to-macrophage differentiation. MATERIALS AND METHODS Cell cultures and treatments. FLCs were grown in RPMI 1640 supplemented with 5% fetal calf serum (FCS) and antibiotics. F4-12B2 is a thymidine kinasenegative (TK2) FLC clone (kindly provided by W. Ostertag) (18) which was grown in monolayers in minimal essential medium containing 10% FCS and antibiotics. NIH 3T3 cells were grown in Dulbecco modified Eagle medium supplemented with 10% FCS and antibiotics. The cells were treated for the indicated times with 100 mM hemin (Porphyrin Products Inc., Logan, Utah). Hemin stock solution was prepared by dissolving the powder in 0.5 M NaOH followed by buffering at pH 7.4 with Tris. The concentration was evaluated spectrophotometrically at 409 nm in pyridine solution (ε 5 0.163). Isolation and culture of monocytes/macrophages. Peripheral blood mononuclear cells were obtained from 18- to 40-year-old healthy male and female donors and cultivated as previously described (43). Briefly, 1.5 3 107 total cells were seeded in 75-cm2 culture flasks in Iscove’s medium containing 15% FCS (filtered through a 0.22-mm-pore-size filter). After 1 h at 378C, the adherent cells (96% CD141) were extensively washed with medium to remove nonadherent cells, replaced with fresh medium, and cultured at 378C. All the reagents used for monocyte isolation and culture were endotoxin free, as evaluated by the Limulus amebocyte lysate assay (pbi International, Milan, Italy). On various culture days, both nonadherent and adherent cells were recovered and analyzed. Adherent macrophages were recovered with a cell scraper after 60 min of incubation at 48C in the presence of Ca21- and Mg21-free phosphate-buffered saline (Flow Laboratories). This procedure did not affect cell viability, and both adherent and nonadherent cells terminally differentiated to macrophages. Nonadherent and adherent cells were mixed and then processed for preparation of whole-cell or nuclear extracts. Preparation of whole-cell and nuclear extracts. Cells (3 3 107) were washed twice in cold phosphate-buffered saline and then collected by centrifugation. The pellet was resuspended in 300 ml of lysis buffer containing 20 mM HEPES, 50 mM NaCl, 10 mM EDTA, 2 mM EGTA, and 0.5% (vol/vol) Nonidet P-40 (pH 8) supplemented with 0.5 mM dithiothreitol, 10 mM sodium molybdate, 10 mM sodium orthovanadate, 100 mM NaF, 10 mg of leupeptin per ml, and 0.5 mM phenylmethylsulfonyl fluoride (PMSF). After incubation for 30 min on ice, the

MOL. CELL. BIOL. suspension was centrifuged at 10,000 3 g for 10 min. The supernatants were aliquoted and stored at 2808C. To prepare the nuclear exctracts, the cells were lysated in 500 ml of lysis buffer (10 mM Tris [pH 7.4], 10 mM NaCl, 3 mM MgCl2, 0.5% [vol/vol] Nonidet P-40) complemented with 0.5 mM PMSF, 10 mg of leupeptin per ml, 2 mg of pepstatin per ml, and 50 mM NaF, layered on top of 4 ml of sucrose buffer (24% [wt/vol] sucrose), and centrifuged at 1,300 3 g for 10 min at 48C. The nuclei were resuspended in 30 ml of 20 mM Tris (pH 7.6–20 mM KCl–0.2 mM EDTA–1.5 mM MgCl2–25% (vol/vol) glycerol–5 mM 2-mercaptoethanol supplemented with 0.5 mM PMSF, 10 mg of leupeptin per ml, 2 mg of pepstatin per ml, and 50 mM NaF; 120 ml of the same buffer containing 600 mM KCl was then added, and the mixture was incubated for 20 min on ice and then centrifuged at 16,000 3 g for 15 min. The supernatants were dialyzed for 6 h against the same buffer containing 80 mM KCl and centrifuged at 14,000 3 g for 10 min at 48C. Plasmids and mutagenesis. The 2160-bp construct, L5CAT plasmid, containing the chloramphenicol acetyltransferase (CAT) gene under the control of the human ferritin H-chain promoter, has been described previously (20, 21). To generate the construct 277 bp, the L5CAT plasmid was digested with SacI and AvaI to excise nucleotides (nt) 278 to 2160 and religated. The plasmid carrying the mutated CCAAT box (277-bp MUT) was prepared by PCR amplification with the wild-type 277 bp as a template. Two primers were used to amplify this DNA; the one carrying the mutation (GGCTCGGGGCG GGCGGCGCTGATCGGCCGGGGCGGG) was located at the 59 end of the ferritin H promoter, and the other was located at the farthest 39 end region of the CAT cDNA. The amplified fragment was gel purified, subjected to Klenow fragment and kinase treatment (19), and ligated in plasmid pUC19. The nucleotide sequence of each deleted or mutated region was confirmed by the dideoxy DNA sequencing procedure with the Sequenase kit (U.S. Biochemical Corp.). Preparation of probes for the binding assay. To generate the probes for EMSA, the L5CAT plasmid was digested with SacI and BglI to obtain probe A, with SacI and AvaI to obtain probe B, and with AvaI and BamHI to obtain fragment C. The DNA fragments, prepared by digestion with the appropriate restriction enzymes, were gel purified and blunt ended by the filling-in reaction with Klenow or T4 DNA polymerase. DNA EMSA. To measure the association of DNA binding proteins with different DNA sequences, the ferritin H-chain promoter fragments and the synthetic double-stranded oligonucleotides, prepared on an Applied Biosystems DNA synthesizer, were end labeled with [g-32P]ATP by using T4 polynucleotide kinase. The binding-reaction mixture (20-ml final volume) contained labeled oligonucleotide probes (10,000 cpm) in binding buffer (75 mM KCl, 20 mM Tris-HCl [pH 7.5], 1 mM dithiothreitol) containing 5 mg of bovine serum albumin per ml, 14% (vol/vol) glycerol, and 3 mg of poly(dI-dC). Total-cell lysates (10 mg) or nuclear extracts (5 mg) were added, and the reaction mixture was incubated for 20 min at room temperature. Samples were electrophoresed in a 6% polyacrylamide gel in 0.53 Tris-borate-EDTA (TBE) buffer for 2 h at 200 V at 188C. The gels were then dried and subjected to autoradiography. Competition studies were performed by adding unlabeled double-stranded oligonucleotides at a 100fold molar excess over the labeled probe. The DNA sequences of the oligonucleotides used are indicated in Table 1. For supershift analysis, total-cell extracts were incubated with 3 mg of anti-Sp1 (Santa Cruz Biotechnology, Inc.) or 1 mg of anti-NF-YA or anti-NF-YB antibody (a generous gift from D. Mathis, C. Benoist, and R. Mantovani) (31) simultaneously with the addition of binding buffer containing labeled oligonucleotide. After a 1-h incubation on ice, the samples were subjected to electrophoresis as described above. Western blot assay. For Western blot analysis, 60-mg samples of whole-cell extracts were denatured and separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (10% polyacrylamide). Proteins were transferred to nitrocellulose paper, incubated with rabbit anti NF-YA or NF-YB, and detected by the enhanced chemiluminescence system with anti-rabbit horseradish peroxidase-coupled secondary antibody (Amersham). Incubation and washes were carried out as described by Mantovani et al. (31). Transfection of F4-12B2 cells. Cells (107) were grown in 150-mm culture dishes for 18 h. The culture medium was then replaced with 30 ml of fresh medium 4 h prior to the addition of 60 mg of calcium phosphate-precipitated 277-bp–CAT or 2160-bp–CAT constructs (47). At 12 h posttransfection, the cells were split to standardize the transfection efficiency and the growth medium was replaced, and 6 h later the cells were treated with 100 mM hemin for 24 h. The same procedure was used in transfection experiments with the 277-bp–CAT (wt) and the 277-bp–mut-CAT constructs. For cotransfection experiments, 40 mg of reporter plasmid 277-bp–CAT (or its mutant 277-bp–mut-CAT), 20 mg of a NF-YA dominant negative plasmid YA13 m29 (kindly provided by R. Mantovani) (32), and 5 mg of the test plasmid pCH110 b-gal, used as an internal control of transfection efficiency, were used. When necessary an equal amount of pGL2 vector plasmid was used for transfections to equalize the total amount of plasmid DNA. After 12 h, the cells were treated with hemin and processed for RNase protection experiments (see below). RNase protection experiments. Total RNA was isolated from transfected cells by the guanidium cesium chloride method (17) and treated with DNase. Total RNA (20 mg) was hybridized for 18 h to the RNA probes (3 3 105 cpm) at 558C in 25 ml of 80% formamide–0.4 M NaCl–40 mM piperazine-N,N9-bis(2-ethanesulfonic acid) (PIPES; pH 6.8)–1 mM EDTA. Subsequently, samples were incubated with RNase A (40 mg/ml) and RNase T1 (1 mg/ml) for 1 h at 338C and then

VOL. 17, 1997

NF-Y AND FERRITIN H-CHAIN GENE TRANSCRIPTION

1389

TABLE 1. Sequences of oligonucleotides used as probes or competitors in EMSA Sequencesa

Oligonucleotide

Competed bindingb

FF FFmut 4T EE

GGCTCGGGGCGGGCGGCGCTGATTGGCCGGGGCGGG . . . . . . . . . . . . . . . . . . . . . . . . . .G. . . . . . . . . . . . . . . . . . . . . TT. . . . . . . . . . . . .... . . . . . TT . . . . GGGCGGCGCTGATTGGCCGGGGCGGGCCTGA

1 2 1 1

Sp1 cEBP/b NF I a-Globin b-Globin CP2 MuCP1c HuCP1c

ATTCGATCGGGGCGGGGCGAGC TGCAGATTGCACAATCTGCA TTTGGCTTGAAGCCAATATGAG CAAGCACAAACCAGCCAATGAGTAACTGCTCCAAGGGCGTGTCCACCCTGCC GGATCCTAGGGTTGGCCAATCTACTCCCAGGAGCTT GCCCTAACAAGTTTTACTGGGTAGAGCAAGCACAAACCAGCCAATGAGTA GATCGCACAAACCAGCCAATGAGTAACTGCTCCAAG AGCTCAAATTAACCAATCAGCGCACTCTCACAGGAGCT

2 2 2 1 6 2 6 1

a A dot indicates no changes from the FF sequence. Boldface type indicates the CCAAT box in the direct or inverted orientation. Underlining indicates Sp1 consensus binding sites. b Data from Fig. 4 and 6. 1, competition; 6, reduced competition; 2, no competition. c The sequences are derived from the murine (Mu) or human (Hu) a-globin gene promoter.

subjected to proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation. Gel electrophoresis was performed on a standard 8% polyacrylamide–8 M urea sequencing gel. Construction of the pCAT riboprobe has been described previously (9). To generate a 32P-labeled 153-nt antisense RNA probe, the pCAT riboprobe was linearized with ScaI and transcribed with SP6 polymerase. The 434-bp pTRI-GaPDH mouse antisense control template (Ambion, Austin, Tex.) was used as an internal standard to establish the relative amount of RNA loaded. The probe was synthesized by in vitro transcription from the linear template with SP6 polymerase.

This result is in line with the lack of an increased steady-state level of the ferritin mRNA observed after heme treatment of NIH 3T3 cells (results not shown). To determine the functional significance in vivo of the 277-bp fragment (C) of the ferritin H-chain gene promoter in the transcriptional activation by heme, a construct containing this promoter fragment linked to the CAT reporter gene was transiently transfected in F4-12B2, a TK2 FLC clone able to

RESULTS Analysis of the trans-activating factor(s) binding to the proximal region of the ferritin H-gene promoter in hemetreated FLCs. We have previously shown that the treatment of FLCs with heme results in 10- to 15-fold ferritin H-chain mRNA accumulation whereas the same treatment of fibroblastic cell lines gives no appreciable variation in the steady-state level of the ferritin mRNA. This accumulation reflects an increase in the rate of transcription of the ferritin H-chain gene dependent upon a 160-bp segment upstream from the transcription start site of the ferritin H-gene promoter (9). To analyze this region of the ferritin H-chain gene promoter and the regulatory factors able to bind it, both EMSA and transient-transfection experiments were performed. Three radiolabeled probes designated A (237 to 2160; representing approximately the 2160-bp promoter devoid of the TATA box-surrounding sequences), B (286 to 2160), and C (11 to 277), prepared as described in Materials and Methods, were incubated with nuclear extracts from FLCs and NIH 3T3 cells treated with either control medium or 100 mM hemin for 1 h. The complexes formed were resolved by PAGE (Fig. 1). Only constitutive DNA-protein complexes were formed with portion B of the 2160-bp region of the ferritin promoter. Conversely, when fragments A and C were used as probes, the formation of one DNA-protein complex (indicated by an arrow), whose level was enhanced in cell extract from hemetreated FLCs, was observed. The enhanced complex, referred to throughout as heme-responsive factor (HRF), starts to appear 30 min after the heme addition and lasts for several hours (results not shown). The same results were obtained with whole-cell extracts (results not shown). A parallel analysis with cell extracts from the NIH 3T3 fibroblast cell line (Fig. 1) incubated with the same three probes shows the formation of DNA-protein complexes, but none of them appears to be enhanced by the heme treatment.

FIG. 1. Analysis of the proteic factors able to bind to proximal regions of the ferritin H-gene promoter in erythroid (FLCs) and fibroblastic (NIH 3T3) cell lines. Fragments A, B, and C, obtained by digestion of the 2160-bp ferritin H-gene promoter with restriction enzymes (see Materials and Methods), are depicted in the lower part of the figure. Nuclear cell extracts from control cells and cells treated with 100 mM hemin, were analyzed by EMSA (see Materials and Methods). The HRF is indicated by an arrow.

1390

MARZIALI ET AL.

FIG. 2. The 277-bp segment of the proximal ferritin H-gene promoter is sufficient to increase reporter gene expression after heme treatment. F4-12B2 cells were transiently transfected with a construct containing the 2160-bp or the 277-bp ferritin H promoter fragment linked to the CAT reporter gene. After transfection, cells were split and then treated for 24 h with medium alone or 100 mM hemin. RNA was then extracted and analyzed by RNase protection using specific riboprobes for CAT (see Materials and Methods). GAPDH riboprobe was used as an internal control.

grow in monolayer (Fig. 2). After transfection, the cells were split to standardize the transfection efficiency and treated for 24 h with control medium or 100 mM hemin. RNA was then extracted and analyzed by RNase protection with a specific riboprobe for CAT. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) riboprobe was used as an internal control. The results (Fig. 2) indicate that the expression of the 277-bp fragment construct was stimulated by the heme treatment to the same extent as was the expression of the entire 2160-bp fragment construct, confirming that the 277-bp fragment is sufficient for the transcriptional activation by heme. Analysis of sequences required for the binding of the HRF. The minimal sequence required for the binding of the HRF was identified by using double-stranded oligonucleotides spanning different internal regions of the 277-bp fragment (probe C) as specific competitors in EMSA. Fragment FF, spanning nt 242 to 277, was able to specifically compete for the binding of HRF, whereas oligonucleotides spanning either 227 to 246 (FC) or 229 to 11 (FD) did not affect the binding (Fig. 3A). The sequence of the FF region (Table 1) shows a CCAAT box in reverse orientation (in boldface type) surrounded by two Sp1 consensus binding sites (underlined). To determine the relative significance of these two elements for the binding of HRF to the FF fragment, specific competitions and supershift assays were performed. As shown in Fig. 3B, the binding of HRF to FF was not specifically competed by the consensus sequence for Sp1, nor were specific anti-Sp1 antibodies able to supershift the complex. These results suggest that HRF does not contain Sp1 protein; control EMSA with the radiolabeled Sp1 probe showed that the FF sequence was not able to compete for the specific binding of Sp1 to its consensus binding site. In line with these data, oligonucleotide 4T, which represents the FF mutated in the two Sp1 consensus sites, was able to compete for binding. Similar results (not shown) were obtained when the same competitions were performed in EMSA analysis with a longer oligonucleotide (from nt 291 to 225) as the probe. In this probe, the Sp1 sites were not as close to the end as in the FF probe.

MOL. CELL. BIOL.

FIG. 3. A minimal fragment (FF) of the 277-bp segment of the ferritin H gene promoter is sufficient for the binding of HRF. (A) Whole-cell extracts from FLCs treated with 100 mM hemin were incubated with the C labeled probe and analyzed by EMSA. A 100-fold molar excess of unlabeled oligonucleotides FF, FC, and FD, spanning different internal region of the C probe (depicted in the figure), was added where indicated. (B) Whole-cell extracts from hemin-treated FLCs were incubated with end-labeled FF probe in the absence (2) or presence of a 100-fold molar excess of the indicated oligonucleotides and analyzed by EMSA. Polyclonal anti-Sp1 antibodies (Ab) were added where indicated. For Sp1 specificity, a double-stranded oligonucleotide containing the specific binding sites for Sp1 was also used as a probe. The sequences of the used oligonucleotides are indicated in Table 1.

In contrast, the FF oligonucleotide containing a mutation (FF mut) of the central CCAAT residue (CCGAT), known to be critical for CCAAT factor binding (8), was not able to abolish the binding activity of HRF to FF. The transcriptional activity of the 277-bp fragment is dependent on the presence of a functional CCAAT box. To determine the functional significance of the CCAAT element in the activation of ferritin transcription by heme in vivo, the point mutation in the CCAAT residue (CCGAT) able to abolish its binding activity in vitro was introduced into the construct containing the 277-bp promoter fragment. The mutant and the wild-type promoters, linked to the CAT reporter gene, were transiently transfected in the F4-12B2 FLC clone. After 24 h of 100 mM hemin or control medium treatment, CAT mRNA expression was assayed by RNase protection. As shown in Fig. 4, the expression of CAT mRNA resulting from the mutant promoter was reduced to background levels, indicating that the binding of the CCAAT factor is necessary for activity of ferritin gene promoter in response to heme treatment of FLCs. Sequence specificity of the HRF. To test whether the FF fragment (242 to 277) of the ferritin promoter can bind proteins that have been described to interact with the CCAAT motif, specific DNA sequences were used for competition studies. As shown in Fig. 5A, the binding of HRF was specifically competed for by a CCAAT oligonucleotide from the murine a-globin gene promoter (lane a glob) and to a lesser extent, by a CCAAT oligonucleotide from the human b-globin gene promoter (lane b glob). In contrast, oligonucleotides containing the c-EBP/b or the NF-I consensus sequence were unable to compete for the binding. The sequence of the CCAAT oligonucleotide from murine a-globin gene promoter, indicated in Table 1, contains binding

VOL. 17, 1997


FIG. 4. The transcriptional activity of the 277-bp fragment is dependent on the presence of a functional CCAAT box. F4-12B2 cells were transiently transfected with the 277-bp promoter fragment and with the same construct mutated in the CCAAT box (CCGAT). Transfected cells were treated with medium alone or with 100 mM hemin for 24 h, and RNA was extracted and analyzed by RNase protection with specific riboprobe for CAT. GAPDH riboprobe was used as an internal control. Mut, mutant; WT, wild type.

sites for an Sp1-like factor, for CP1 (24) (also known as CBF or NF-Y [22]), and for CP2 (30). Competition experiments with highly specific oligonucleotides for CP2- and CP1-binding sites (Fig. 5A) indicate that consensus sequences specific for CP1, as well as the CP1 consensus sequence present on FF (oligo EE), were able to specifically compete for the HRF

FIG. 5. HRF contains the NF-Y transcription factors. (A) Whole-cell extracts from hemin-treated FLCs were incubated with an FF radiolabeled probe. Competition assays were performed with a 100-fold molar excess of unlabeled oligonucleotides containing the consensus binding sites for cEBP/b, NF-I, and CCAAT oligonucleotides from the human b-globin (b glob) and from the murine a-globin gene promoter (a glob). Additional competition assays were performed with consensus binding sites for HuCP2, HuCP1, MuCP1, EE, and 4T oligonucleotides (for sequences, see Table 1). (B) Whole-cell extracts from hemin-treated FLCs were incubated with the FF or the a-globin gene promoterderived CP1 probes in the absence or presence of polyclonal anti NF-YB serum antibodies or monoclonal anti-NF-YA antibodies (Ab) where indicated.

1391

FIG. 6. SP1 binding activity is not modulated in heme-treated FLCs. Wholecell extracts from FLCs untreated or treated for 1 h with 100 mM hemin were incubated with end-labelled FF, HuCP1, and SP1 double-stranded oligonucleotides as probes and analyzed by EMSA.

binding to FF. Meanwhile sequences comprising the binding site for CP2 were ineffective in competing for the binding activity. To assess if HRF, whose induction by heme correlates with enhanced transcription activity of the ferritin proximal promoter, comprises CP1(CBF/NF-Y) protein, supershift experiments with specific antibodies were performed. EMSA analysis after incubation of total-cell extracts with antibodies able to specifically recognize either subunit A or B of NF-Y (31) showed that both antibodies were able to abolish and/or supershift the FF protein complex (Fig. 5B). NF-Y protein is a constitutive transcription factor; to test if another constitutive transcription factor such as Sp1 is modulated by the heme treatment, control experiments with Sp1 probe were performed. Results shown in Fig. 6 indicate that heme treatment is able to increase the binding of NF-Y to the FF and HuCP1 probes whereas no variation in Sp1 binding to its specific consensus sequence was observed. Transfection of a dominant negative analog of NF-YA inhibits the heme-induced ferritin transcription. The functional significance of NF-YA subunit expression in the activation of ferritin transcription by heme in vivo was tested by cotransfecting F4-12B2 cells with the 277-bp promoter fragment together with an NF-YA dominant negative mutant (32) before the heme treatment. This NF-YA mutant acts as a dominant repressor of NF-Y/DNA complex formation and NF-Y-dependent transcription by sequestering the NF-YB subunit in defective complexes that are no longer able to bind the DNA. As shown in Fig. 7, the heme-induced transcription of the 277-bp ferritin promoter (lane 2) was completely abolished when the transdominant negative mutant of NF-YA was cotransfected (lane 4). As control for transfection efficiency, the expression plasmid pCH110 b-gal, cotransfected with all the constructs, gave equivalent expression of b-galactosidase in all samples (results not shown). NF-Y is induced during the in vitro monocyte-macrophage maturation. The ferritin H gene is ubiquitously expressed but is up-regulated during both erythroid (11) and monocyte-tomacrophage differentiation (43). To investigate the ferritin promoter regulation in monocytes/macrophages, a double-stranded oligonucleotide corresponding to the FF (242 to 277) fragment of the ferritin H-gene promoter was used in EMSA with extracts from monocytes/macrophages on days 0, 3, and 7 of culture. Freshly isolated monocytes (day 0) do not show any nuclear protein able to complex with the FF fragment of the ferritin H-gene promoter. Starting at day 3, and maximally at day 7 of culture, one major activity appears which binds specifically to this region of the ferritin H-gene promoter (Fig. 8A). This complex shows identical electrophoretical mobility to that present in cell extracts from FLCs. To test the speci-

1392

MARZIALI ET AL.

MOL. CELL. BIOL.

FIG. 7. Cotransfection of a dominant negative mutant of NF-YA (YA13m29) inhibits the heme-induced transcriptional activity of the 277-bp ferritin H promoter. F4-12B2 cells were transiently transfected with 277-bp ferritin H gene promoter CAT construct (lanes 1 and 2) or cotransfected with the same construct together with 20 mg of the dominant negative mutant of NF-YA YA13m29 plasmid (lanes 3 and 4). After transfection, cells were treated with medium alone or with 100 mM hemin for 24 h, and RNA was extracted and analyzed by RNase protection with a specific riboprobe for CAT. GAPDH riboprobe was used as an internal control.

ficity of the complex, competition experiments were performed with the same oligonucleotides that were utilized for the experiment shown in Fig. 5A with FLC extracts. In Fig. 8B, the most significant competitions are shown. The binding of the complex at day 7 of cultures is specifically competed for by a CCAAT oligonucleotide from the murine a-globin gene promoter and to a lesser extent by the CCAAT oligonucleotide from the human b-globin gene promoter. Moreover, the CP1 consensus sequence totally competes for the binding as well as oligonucleotides EE (derived from the FF sequence and containing only the consensus sequence for CP-1) and 4T (FF oligonucleotide in which both the Sp1 sites were mutated). Conversely, sequences comprising binding sites for Sp1, cEBP/b, NF I, and the oligonucleotide containing the G mutation in the central CCAAT box are not effective (results not shown). These results and supershift experiments with specific NF-Y antibodies (results not shown) strongly suggest that the activity of the same CCAAT binding factor, NF-Y, is stimulated in heme-treated erythroid cells as well as during the in vitro monocyte-to-macrophage maturation. NF-YA subunit expression is modulated during monocytemacrophage maturation and in heme-treated FLCs. To test whether the induction of NF-Y binding activity observed during monocyte-to-macrophage differentiation and after heme treatment of FLCs could be related to differences in the synthesis and/or availability of one of the components of NF-Y, we evaluated the expression of both NF-YA and NF-YB subunits. Western blot analysis showed that the NF-YB subunit (Fig. 9) is equally strongly expressed in freshly isolated (day 0), maturing (day 3), and fully differentiated (day 7) macrophages. Similarly, control and heme-treated FLCs and NIH 3T3 cells showed comparable amounts of NF-YB. Conversely, the NF-YA subunit (Fig. 9) is undetectable in freshly isolated monocytes, starts to appear on day 3, and further increases on day 7 of culture. An increase in the NF-YA subunit amount was also observed after heme treatment of FLCs. When cell exctracts from the fibroblastic cell line NIH 3T3 were examined, no modulation of the NF-YA subunit was observed. These results are in line with the DNA binding activity of NF-Y shown in Fig. 1 and 8. In fact, the lack of NF-YA in freshly isolated monocytes could account for the absence of the

FIG. 8. The binding of NF-Y to the minimal ferritin H gene promoter increases during monocyte-to-macrophage differentiation. (A) Whole-cell extracts obtained from human primary monocytes on days 0, 3, and 7 of culture were incubated with the FF probe and assayed by EMSA. Whole-cell extracts from FLCs were used as a control. The same complex, identified in FLCs, appears to bind to FF starting on day 3 of culture. (B) Competition assays were performed with a 100-fold molar excess of the indicated unlabelled oligonucleotides corresponding to consensus sequences for the indicated CCAAT binding factors as shown in Fig. 5A.

NF-Y–DNA complex on day 0, whereas low basal levels of NF-YA are observed in untreated FLCs where a DNA binding complex is present. DISCUSSION In this study, we have analyzed the transcriptional regulation of the proximal region of the ferritin H-gene promoter and the transactivating factor(s) able to bind this region in hemetreated FLCs and during monocyte-to-macrophage differentiation. Regulation of ferritin expression has been extensively studied, and the induction of ferritin biosynthesis and/or intracel-

VOL. 17, 1997


FIG. 9. NF-YB and NF-YA isoforms at the protein level. Western blot analysis of whole-cell extracts from day 0, 3, and 7 cultures of monocytes and from NIH 3T3 cells and FLCs treated with control medium or 100 mM hemin, where indicated, was performed as indicated in Materials and Methods. Samples (60 mg) were probed with an affinity-purified antibody against NF-YB or against NF-YA. The doublet which presumably corresponds to the long and short forms of NF-YA is indicated.

lular accumulation by iron is well documented for a variety of tissues and cultured cells (14, 16, 39, 40, 44). The translational control exerted by iron and heme is probably the best-characterized level of regulation. However, additional control mechanisms have been suggested. A small but significant iron-dependent increase in the level of ferritin mRNA has been observed in rat liver (46), HeLa (6), and K562 (33) cells. This increase was substantially smaller than the increase in ferritin biosynthesis, reflecting the predominant role of translational control in these cells. In contrast, we showed that in FLCs, transcriptional control is a relevant mechanism for the regulation of ferritin expression both in differentiating and in nondifferentiating cells (9–11). Similarly, a marked increase in both H- and L-ferritin mRNA levels is observed during monocyte-to-macrophage differentiation (43). Despite the extensive analysis and identification of the mechanisms and factors involved in the translational regulation, very little is known about the transcriptional regulation of ferritin gene expression. We have previously identified (9) a 160-bp segment upstream from the transcription start site of the ferritin H gene that confers transcriptional regulation by heme to a reporter gene. Here, we have extended the analysis of this segment of the ferritin H-gene promoter and identified a 77-bp sequence in the proximal region that is sufficient to confer the transcriptional regulation by heme to the reporter CAT gene when transiently transfected in FLCs. By using EMSA, we have shown the formation of one major activity (HRF) which binds specifically to this region and whose level is significantly increased in cell extracts from heme-treated FLCs and during monocyte-to-macrophage differentiation. A minimal region (FF fragment from nt 277 to 242) is sufficient for the HRF binding. The FF fragment contains two Sp1 consensus binding sites spanning a reverse CCAAT box. Sp1 protein is apparently not involved in the formation of the complex with FF, as suggested by competition with Sp1-specific oligonucleotides and by supershift experiments with specific antiSp1 antibodies (Fig. 3B). These data are also in line with the results of footprinting experiments published by Bevilacqua et al. (3), showing a binding of Sp1 to the most distal consensus sequence (from nt 2109 to 2132) of the ferritin promoter but

1393

no protection in the region of the ferritin H-gene promoter corresponding to our construct. In contrast, we demonstrated that a point mutation in the reverse CCAAT box is able to abolish both the binding of the HRF and the transcriptional activation of the CAT reporter gene. These results are consistent with the requirements for an intact CCAAT motif to sustain ferritin H-gene transcription by heme. The relevance of this CCAAT box for the transcriptional activation of the ferritin H gene has also been demonstrated in differentiated Caco-2 cells, a human colon cell line able to differentiate into enterocyte-like cells (4). To date, a multiplicity of CCAAT box-binding activities have been identified, some of which are tissue specific whereas others are expressed ubiquitously (23). For both heme-treated FLCs and monocyte/macrophage cells, the binding of HRF to the FF fragment is specifically competed for by a CCAAT oligonucleotide from the human a-globin gene promoter and partially by an oligonucleotide containing the CCAAT motif from the murine b-globin gene promoter but not by sequences comprising binding sites for other known CCAAT-binding factors such as NF-I and cEBP/b. The a-globin-derived oligonucleotide contains a high-affinity binding site for CP1 protein, with an affinity that is at least five times higher than that of the b-globin oligonucleotide (8). Using specific antibodies (31) that recognize the A and B subunits of the NF-Y protein, we have demonstrated the presence of NF-Y in HRF (Fig. 5B). Furthermore, the NF-Y requirement for the heme-dependent stimulation of ferritin H-chain gene transcription was confirmed by transfection experiments with a transdominant repressor of NF-YA–DNA complex formation and NF-Y-dependent transcription (Fig. 7). NF-Y is a ubiquitous and evolutionarily conserved heteromeric complex formed by at least three subunits (A, B, and C), all of which are necessary for DNA binding (13, 25, 42). It binds specifically to the CCAAT motifs found in direct or inverted orientation in the 59 promoter region of a wide variety of genes (8, 15, 24, 34, 36). Although NF-Y is constitutive and ubiquitous, it also participates in the regulation of some promoters by controlling gene expression in a lineage- and activation-specific manner (e.g., albumin or class II major histocompatibility complex). However, it remains to be proved whether NF-Y contributes to this restricted pattern of expression (2). Two recently published papers report that NF-Y activity is modulated by the depletion of intracellular calcium (41) and is serum dependent in IMR-90 diploid fibroblasts (7). This modulated activity of NF-Y correlates with the induction of the glucose-regulated protein (grp/78) transcription in calcium-depleted cells and with the induction of the human TK gene expression in serum-stimulated IMR-90 cells. The serumdependent enhanced binding of NF-Y on the distal CCAAT box of the human TK gene has been explained by differences in NF-YA but not NF-YB subunit expression induced by serum deprivation. Similarly, we have observed that the level of the NF-YA subunit increases in heme-treated FLCs and during the monocyte-to-macrophage differentiation process whereas NF-YB subunit levels do not change. These observations suggest that NF-Y activity could be modulated during cell differentiation and/or heme treatment depending on the relative amounts of the two NF-Y subunits. Thus, the specificity for this activation in different tissues could be provided either through association with other cell-specific factors or through the differential expression of NF-YA. Moreover, different isoforms of NF-YA have been described to arise from differential splicing of a single transcript to give long and short NF-YA polypeptides (29). Both of these two different isoforms are able to bind DNA, and the transcrip-

1394

MARZIALI ET AL.

tional activation is induced equally by the long and short forms. According to our Western blot data, the short NF-YA isoform is more prevalent in FLCs and macrophages while the long species of NF-YA is more prevalent in the fibroblastic cell line, where neither transcriptional regulation nor modulation of NF-Y-binding activity has been detected. From these observations, it is tempting to suggest that the functional differences between these cellular systems could be also explained by the alternative species of the protein present in different cell types. In conclusion, the transcriptional control of ferritin gene expression seems to be a relevant mechanism in a few specialized cell types such as those of erythroid origin, which must incorporate high levels of iron to sustain hemoglobin synthesis, and in macrophages, which are physiologically involved in iron storage. This transcriptional control is mediated by a minimum region of 77 nt upstream of the TATA box. This cis element binds the ubiquitous and constitutive NF-Y protein, which plays a major role in mediating the observed transcriptional activation. The mechanism involved in cell specificity activation remains to be exactly defined. ACKNOWLEDGMENTS We gratefully acknowledge R. Mantovani for providing us with the YA13m29 plasmid. We thank D. Mathis, C. Benoist, and R. Mantovani for providing monoclonal and polyclonal antibodies against NF-Y. We thank S. Mochi for oligonucleotide preparation and S. Tocchio for editorial assistance. We are grateful to R. Mantovani for a critical reading of the manuscript and for suggestions. This work was supported in part by Consiglio Nazionale delle Ricerche-Progetto Finalizzato ACRO grant 95.00545.39 to A.B. and U.T. REFERENCES 1. Arosio, P., T. G. Adelman, and J. W. Drysdale. 1978. On ferritin heterogeneity. Further evidence for heteropolymers. J. Biol. Chem. 253:4451–4458. 2. Benoist, C., and D. Mathis. 1990. Regulation of major histocompatibility complex class-II genes: X, Y, and other letters of the alphabet. Annu. Rev. Immunol. 8:681–715. 3. Bevilacqua, M. A., M. Giordano, P. D’Agostino, C. Santoro, F. Cimino, and F. Costanzo. 1992. Promoter for the human ferritin heavy chain-encoding gene (FERH): structural and functional characterization. Gene 111:255–260. 4. Bevilacqua, M. A., M. C. Faniello, P. D’Agostino, B. Quaresima, M. T. Tiano, S. Pignata, T. Russo, F. Cimino, and F. Costanzo. 1995. Transcriptional activation of the H-ferritin gene in differentiated Caco-2 cells parallels a change in the activity of the nuclear factor Bbf. Biochem. J. 311:769–773. 5. Boyd, D., C. Vecoli, D. M. Belker, S. K. Jain, and J. W. Drysdale. 1985. Structural and functional relationships of human ferritin H and L chains deduced from cDNA clones. J. Biol. Chem. 260:11755–11761. 6. Cairo, G., L. Bardella, L. Schiaffonati, P. Arosio, S. Levi, and A. B. Zazzera. 1985. Multiple-mechanisms of iron-induced ferritin synthesis in HeLa cells. Biochem. Biophys. Res. Commun. 133:314–321. 7. Chang, Z.-F., and C.-J. Liu. 1994. Human thymidine kinase CCAAT-binding protein is NF-Y, whose A subunit expression is serum-dependent in human IMR-90 diploid fibroblasts. J. Biol. Chem. 269:17893–17898. 8. Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp. 1988. Human CCAAT-binding proteins have heterologous subunits. Cell 53:11–24. 9. Coccia, E. M., V. Profita, G. Fiorucci, G. Romeo, E. Affabris, U. Testa, M. W. Hentze, and A. Battistini. 1992. Modulation of ferritin H-chain expression in Friend erythroleukemia cells: transcriptional and translational regulation by hemin. Mol. Cell. Biol. 12:3015–3022. 10. Coccia, E. M., E. Stellacci, E. Perrotti, G. Marziali, and A. Battistini. 1994. Differential regulation of ferritin expression in Friend leukemia cells by iron. J. Biol. Regul. Homeostatic Agents 8:81–87. 11. Coccia, E. M., E. Stellacci, R. Orsatti, U. Testa, and A. Battistini. 1995. Regulation of ferritin H-chain expression in differentiating Friend leukemia cells. Blood 86:1570–1579. 12. Coulson, R. M. R., and D. W. Cleveland. 1993. Ferritin synthesis is controlled by iron-dependent translational derepression and by changes in synthesis/ transport of nuclear ferritin RNAs. Proc. Natl. Acad. Sci. USA 90:7613– 7617. 13. Coustry, F., S. N. Maity, and B. de Crombrugghe. 1995. Studies on transcription activation by multimeric CCAAT-binding factor CBF. J. Biol. Chem. 270:468–475.

MOL. CELL. BIOL. 14. Doolittle, R. L., and G. W. Richter. 1981. Isoferritins in rat Kupffer cells, hepatocytes, and extrahepatic macrophages. Biosynthesis in cell suspensions and cultures in response to iron. Lab. Invest. 45:567–574. 15. Dorn, A., J. Bollekens, A. Staub, C. Benoist, and D. Mathis. 1987. A multiplicity of CCAAT box-binding proteins. Cell 50:863–872. 16. Drysdale, J. W., and H. N. Munro. 1986. Regulation of synthesis and turnover of ferritin in rat liver. J. Biol. Chem. 241:3630–3637. 17. Glisin, V., R. Crkvenjakov, and C. Byus. 1974. Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13:2633–2637. 18. Greiser-Wilke, I., W. Ostertag, P. Goldfarb, A. Lang, M. Furusawa, and J. F. Conscience. 1981. Inducibility of spleen focus forming virus by BrdUrd is controlled by the differentiated state of the cell. Proc. Natl. Acad. Sci. USA 78:2995–2999. 19. Hemsley, A., N. Amheim, M. D. Toney, G. Cortopassi, and D. J. Galas. 1989. A simple method for site-directed mutagenesis using the polymerase chain reaction. Nucleic Acids Res. 17:6545–6551. 20. Hentze, M. W., S. Keim, P. Papadopoulos, S. O’Brien, W. Modi, J. Drysdale, W. J. Leonard, J. B. Harford, and R. D. Klausner. 1986. Cloning, characterization, expression and chromosomal localization of a human ferritin heavy chain gene. Proc. Natl. Acad. Sci. USA 83:7226–7230. 21. Hentze, M. W., S. W. Caughman, T. A. Rouault, J. Barriocanal, A. Dancis, J. B. Harford, and R. D. Klausner. 1987. Identification of the iron-responsive element for the translational regulation of human ferritin mRNA. Science 238:1570–1573. 22. Hooft van Huijsduijnen, R., X. J. Li, D. Black, H. Matthes, C. Benoist, and D. Mathis. 1990. Co-evolution from yeast to mouse: cDNA cloning of the two NF-Y(CP-1/CBF) subunits. EMBO J. 9:3119–3127. 23. Johnson, P. F., and S. McKnight. 1989. Eukaryotic transcriptional regulatory proteins. Annu. Rev. Biochem. 58:799–839. 24. Kim, C. G., and M. Sheffery. 1990. Physical characterization of the purified, CCAAT transcription factor, a CP1. J. Biol. Chem. 265:13362–13369. 25. Kim, I.-S., S. Sinha, B. de Crombrugghe, and S. N. Maity. 1996. Determination of functional domains in the C subunit of the CCAAT-binding factor (CBF) necessary for formation of a CBF-DNA complex: CBF-B interacts simultaneously with both the CBF-A and CBF-C subunits to form a heterotrimeric CBF molecule. Mol. Cell. Biol. 16:4003–4013. 26. Klausner, R. D., T. A. Rouault, and J. B. Harford. 1993. Regulating the fate of mRNA: the control of cellular iron metabolism. Cell 72:19–28. 27. Kuhn, L. C., and M. W. Hentze. 1992. Coordination of cellular iron metabolism by post-transcriptional gene regulation. J. Inorg. Biochem. 47:183–195. 28. Kwak, E. L., D. A. Larochelle, C. Beaumont, S. V. Torti, and F. M. Torti. 1995. Role of NF-kB in the regulation of ferritin H by tumor necrosis factor-a. J. Biol. Chem. 270:15285–15293. 29. Li, X.-Y., R. Hooft van Huisjduijnen, R. Mantovani, C. Benoist, and D. Mathis. 1992. Intron-exon organization of the NF-Y genes. J. Biol. Chem. 267:8984–8990. 30. Lim, L. C., L. Fang, S. L. Swendeman, and M. Sheffery. 1993. Characterization of the molecularly cloned murine a-globin transcription factor CP2. J. Biol. Chem. 268:18008–18017. 31. Mantovani, R., U. Pessara, F. Tronche, X.-Y. Li, A.-M. Knapp, J. L. Pasquali, C. Benoist, and D. Mathis. 1992. Monoclonal antibodies to NF-Y define its function in MHC class II and albumin gene transcription. EMBO J. 11:3315–3322. 32. Mantovani, R., X.-Y. Li, U. Pessara, R. Hooft van Huijsduijnen, C. Benoist, and D. Mathis. 1994. Dominant negative analogs of NF-YA. J. Biol. Chem. 269:20340–20346. 33. Mattia, E., J. den Blaauwen, G. Ashwell, and J. van Renswoude. 1989. Multiple post-transcriptional regulatory mechanisms in ferritin gene expression. Proc. Natl. Acad. Sci. USA 86:1801–1805. 34. Oikarinen, J., A. Hatamochi, and B. de Crombrugghe. 1987. Separate binding sites for nuclear factor 1 a CCAAT DNA binding factor in the mouse a 2 (I) collagen promoter. J. Biol. Chem. 262:11064–11070. 35. Padmanaban, G., V. Venkateswar, and P. N. Rangarajan. 1989. Haem as a multifunctional regulator. Trends Biochem. Sci. 14:492–496. 36. Raymondjean, M., S. Cereghini, and M. Yaniv. 1988. Several distinct “CCAAT” box binding proteins coexist in eukaryotic cells. Proc. Natl. Acad. Sci. USA 85:757–761. 37. Reuben, R. C., R. A. Rifkind, and P. A. Marks. 1980. Chemically induced murine erythroleukemic differentiation. Biochim. Biophys. Acta 605:325– 346. 38. Rice, D. W., G. G. Ford, J. L. White, J. M. A. Smith, and P. M. Harrison. 1983. Comparative aspects of ferritin structure, metal binding, and immunochemistry, p. 11–16. In I. Urushizaki, P. Aisen, I. Listowsky, and J. W. Drysdale (ed.), Structure and function of iron storage and transport proteins. Elsevier Biomedical Press, Amsterdam, The Netherlands. 39. Rittling, S. R., and R. C. Woodworth. 1984. The synthesis and turnover of ferritin in rat L-6 cells. Rates and response to iron, actinomycin D, and desferrioxamine. J. Biol. Chem. 259:5561–5566. 40. Rogers, J., and H. N. Munro. 1987. Translation of ferritin light and heavy subunit mRNAs is regulated by intracellular chelatable iron levels in rat hepatoma cells. Proc. Natl. Acad. Sci. USA 84:2277–2281. 41. Roy, B., and A. S. Lee. 1995. Transduction of calcium through interaction of

VOL. 17, 1997


the human transcription factor CBF with the proximal CCAAT regulatory element of the grp/BiP promoter. Mol. Cell. Biol. 15:2263–2274. 42. Sinha, S., S. N. Maity, J. Lu, and B. de Crombrugghe. 1995. Recombinant rat CBF-C, the third subunit of CBF/NFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP 2 and HAP 3. Proc. Natl. Acad. Sci. USA 92:1624–1628. 43. Testa, U., M. Petrini, M. T. Quaranta, E. Pelosi-Testa, G. Mastroberardino, A. Camagna, G. Boccoli, M. Sargiacomo, G. Isacchi, A. Cozzi, P. Arosio, and C. Peschle. 1989. Iron upmodulates the expression of TfRs during monocytemacrophage maturation. J. Biol. Chem. 264:13181–13187.

1395

44. Theil, E. C. 1987. Ferritin: structure, gene regulation, and cellular function in animals, plants, and microorganisms. Annu. Rev. Biochem. 56:289–315. 45. Wagstaff, M., M. Worwood, and A. Jacobs. 1978. Properties of human tissue isoferritins. Biochem. J. 173:969–977. 46. White, K., and H. N. Munro. 1988. Induction of ferritin subunit synthesis by iron is regulated at both the transcriptional and translational levels. J. Biol. Chem. 263:8938–8942. 47. Wigler, M., R. Sweet, G. K. Sim, B. Wold, A. Pollicer, E. Lacy, T. Maniatis, S. Silverstein, and R. Axel. 1979. Transformation of mammalian cells with genes from procaryotes and eucaryotes. Cell 16:777–785.