Transcriptional Repression by Msx-1 Does Not Require ...

MOLECULAR AND CELLULAR BIOLOGY, Feb. 1995, p. 861–871 0270-7306/95/$04.0010 Copyright q 1995, American Society for Microbiology

Vol. 15, No. 2

Transcriptional Repression by Msx-1 Does Not Require Homeodomain DNA-Binding Sites KATRINA M. CATRON,1,2 HAILAN ZHANG,1,3 SALLY C. MARSHALL,1,2 JUAN A. INOSTROZA,4 JEANNE M. WILSON,1,3 AND CORY ABATE1,2* Center for Advanced Biotechnology and Medicine1 and Department of Neuroscience and Cell Biology,2 Graduate Program in Molecular Genetics and Microbiology,3 and Department of Biochemistry,4 UMDNJ-Robert Wood Johnson Medical School, Piscataway, New Jersey Received 3 October 1994/Returned for modification 10 November 1994/Accepted 15 November 1994

This study investigates the transcriptional properties of Msx-1, a murine homeodomain protein which has been proposed to play a key role in regulating the differentiation and/or proliferation state of specific cell populations during embryogenesis. We show, using basal and activated transcription templates, that Msx-1 is a potent repressor of transcription and can function through both TATA-containing and TATA-less promoters. Moreover, repression in vivo and in vitro occurs in the absence of DNA-binding sites for the Msx-1 homeodomain. Utilizing a series of truncated Msx-1 polypeptides, we show that multiple regions of Msx-1 contribute to repression, and these are rich in alanine, glycine, and proline residues. When fused to a heterologous DNA-binding domain, both N- and C-terminal regions of Msx-1 retain repressor function, which is dependent upon the presence of the heterologous DNA-binding site. Moreover, a polypeptide consisting of the full-length Msx-1 fused to a heterologous DNA-binding domain is a more potent repressor than either the N- or C-terminal regions alone, and this fusion retains the ability to repress transcription in the absence of the heterologous DNA site. We further show that Msx-1 represses transcription in vitro in a purified reconstituted assay system and interacts with protein complexes composed of TBP and TFIIA (DA) and TBP, TFIIA, and TFIIB (DAB) in gel retardation assays, suggesting that the mechanism of repression is mediated through interaction(s) with a component(s) of the core transcription complex. We speculate that the repressor function of Msx-1 is critical for its proposed role in embryogenesis as a regulator of cellular differentiation. tional regulatory regions may influence DNA binding specificity and affinity (1). The complexity afforded by numerous proteins containing multiple functional domains permits a level of specificity unattainable with any individual component. In spite of their tremendous diversity, the unifying feature among transcriptional regulatory proteins is that they function to transduce cellular signalling events to changes in gene expression and thus are pivotal for directing cell growth and differentiation. Accordingly, aberrant expression or mutation of certain genes encoding transcriptional regulators results in developmental abnormalities, oncogenesis, or both (11, 18, 33, 37). In fact, many transcription factors were first identified on the basis of their connection with these abnormal cellular processes. The foremost example of transcriptional regulators that were identified on the basis of their association with developmental malformations are homeobox genes. Members of this gene family were originally identified as mutations that were causal agents of homeotic transformations (18, 76). In accordance with their fundamental role in maintaining appropriate cell growth and differentiation, aberrant expression of certain homeobox genes was subsequently shown to result in cellular transformation (11). The homeobox encodes a DNA-binding domain (the homeodomain) that has been highly conserved with respect to structure and function throughout evolution (35, 76) and is a common component of numerous proteins that regulate transcription during development. Homeodomain proteins have diverse functions which range from global roles in directing pattern formation to more restricted roles in determining specific cell fate (33, 49, 70). Despite its high degree of conservation, the homeodomain plays a significant role in directing functional specificity in vivo (19, 34, 39, 48, 92). Since

Transcription of RNA polymerase II (Pol II) genes in eukaryotic cells requires a multitude of protein factors that fall into two general classes: those that are required for transcription initiation of all Pol II genes (i.e., the general transcription factors [GTFs]) and those that mediate the selective expression of specific target genes (i.e., transcriptional regulatory proteins). The GTFs form the core transcription complex that is generic for transcription initiation of Pol II genes (5, 91). To date, seven GTFs have been identified, and most are composed of multiprotein complexes that assemble in an ordered fashion and recruit Pol II to the site of transcription initiation (5, 91). Regulatory proteins are recruited to the transcriptional control regions of specific target genes via selective protein-DNA or protein-protein interactions (13, 21, 40, 53, 65, 81). These affect the activation or repression of their respective target genes through interactions with other transcription factors or with components of the core transcription complex (32, 36, 41, 82, 87, 91). Typically, transcriptional regulatory proteins are composed of multiple modular domains that mediate DNA binding, multimerization, and/or transcriptional regulation. The presence of modular domains permits simultaneous interactions with DNA and with other protein factors and affords many different combinations of functional complexes. These modular domains may not be mutually exclusive but rather may have overlapping functions. For instance, DNA-binding domains have been shown to affect transcription not only through sequence-specific binding but also via direct proteinprotein interactions (12, 31, 40, 52, 84). Conversely, transcrip-

* Corresponding author. Mailing address: CABM, 679 Hoes Ln., Piscataway, NJ 08854-5638. Phone: (908) 235-5161. Fax: (908) 2354850. 861

862

CATRON ET AL.

homeodomain-containing proteins share similar DNA binding specificities in vitro (35, 76), it is deemed unlikely that their selective functions in vivo are mediated solely through proteinDNA interactions. Rather, it is presumed that the homeodomain serves other functions, namely, as a scaffold for selective protein-protein interactions (64, 66, 81, 88). Furthermore, homeodomain proteins have other modular domains that also influence functional specificity (24, 25), and in some cases, the homeodomain may be dispensable for activity in vivo (3, 16). Specificity is also determined by the precise pattern of spatial and temporal expression of particular homeodomain-containing proteins which dictates their availability to regulate target genes. The combination of multifunctional modular domains within particular homeodomain proteins, and their expression in precise combinational arrays, is likely to provide the necessary complexity required to achieve appropriate cell growth and development. The murine homeobox gene msx-1 has the hallmark features of both an essential developmental regulator (74) and a cellular transforming gene (79). msx-1 is expressed early in development (i.e., from day 7) in cells contributing to the neural folds, the cephalic neural crest (which give rise to craniofacial structures), the heart, and the limbs (26, 43, 45, 68, 89). Although of disparate origin, msx-1-expressing cells share a unifying feature; they are in a developmentally plastic or actively proliferating state. For example, in the developing limb, msx-1 is expressed in the progress zone, a region underlying the apical ectodermal ridge that contains a population of undifferentiated and actively dividing cells (26, 43, 60, 68, 89). In fact, msx-1 appears to be incompatible with differentiation since forced expression in determined myogenic cells results in blocked terminal differentiation, a concomitant down regulation of myogenic factors (e.g., MyoD), and ultimately cellular transformation (79). Moreover, a role for the Msx family in differentiation is further demonstrated by the finding that a single point mutation in the human MSX-2 gene may be the cause of craniosynostosis, a developmental malformation of craniofacial structures stemming from the premature fusion of the calvarial sutures (30). These studies implicate Msx-1, and members of the Msx family, in maintaining the proper differentiation state of specific cell populations during morphogenesis. Given the fact that Msx-1 is a homeodomain protein, the presumption is that it accomplishes this task by controlling gene expression. In this study, we show that Msx-1 is a potent transcriptional repressor in vivo and in vitro and that repression by Msx-1 occurs in the absence of DNA-binding sites for the Msx-1 homeodomain. The repressor function of Msx-1 is contained within multiple domains, including N- and C-terminal regions that are rich in alanine, glycine, and proline residues. These domains, as well as the full-length Msx-1 protein, retain repressor function in the context of a heterologous DNA-binding domain. Finally, we show that Msx-1 also represses transcription in vitro in a purified, reconstituted system and interacts with components of the core transcription complex in gel retardation assays. These findings suggest that repression by Msx-1 is critical for its proposed role as a key developmental regulatory protein that regulates the differentiation state of certain cell populations during development. Moreover, the observation that repression occurs in the absence of homeodomain DNA-binding sites leads to the speculation that under certain circumstances, Msx-1 directly targets a component of the core transcription complex for its transcriptional function.

MOL. CELL. BIOL.

MATERIALS AND METHODS Msx-1 expression plasmids. The sequence corresponding to the entire coding region of msx-1 was obtained by PCR amplification from mouse 11.5-day embryonic cDNA and cloned into the bacterial expression plasmid pDS56 (2). The bacterial expression plasmid encoding Msx-1(157-233) has been described elsewhere (7). Proteins were purified from Escherichia coli cell lysates by nickel affinity chromatography as previously described (2). For expression in eukaryotic cells, the coding sequence of msx-1 was cloned into plasmid pCB61 (61), in which expression is driven by the cytomegalovirus promoter. Sequences corresponding to truncated Msx-1 polypeptides were obtained by PCR amplification using oligonucleotides specific for the desired 59 and 39 sequences and which also contained KpnI and HindIII restriction sites to facilitate cloning. The chimeric gene encoding the Msx-1(157-233)VP16 protein was obtained by ligation of PCR-amplified fragments corresponding to the msx-1 homeobox and the vp16 transcriptional activation domain (72). For fusion of Msx-1 to a heterologous DNA-binding domain, sequences were obtained by PCR amplification from the full-length msx-1 cDNA by using specific oligonucleotides which contained BamHI (59) and HindIII (39) restriction sites to facilitate cloning. The msx-1 sequences were cloned into the eukaryotic expression plasmid pM2 (71) in frame with sequences encoding the Gal4 DNA-binding domain. All constructs were verified by double-stranded DNA sequencing by using a Sequenase Version 2.0 DNA sequencing kit (U.S. Biochemical) according to the manufacturer’s instructions. Reporter plasmids for transient tranfection assays. The parental plasmid was pGL2-promoter (Promega), which contains the simian virus 40 (SV40) early promoter (2135 to 161) driving luciferase gene expression. Reporter plasmids containing the Msx-1 homeodomain DNA-binding site [(CTAATTG)3] or the mutated DNA site [(CTCCGTG)3] were constructed by cloning synthetic oligonucleotides containing the appropriate sequences into the SmaI site of the pGL2-promoter plasmid (for sequences, see below). The reporter plasmid used for activated transcription assays and for the Gal4–Msx-1 fusion assays contained five tandem copies of the 17-bp Gal4 DNA-binding site (85) cloned into the SmaI site of pGL2-promoter. The Inr-luciferase plasmid was constructed by cloning a 70-bp fragment containing the human b-polymerase initiator element (220 to 160) (86) into the KpnI and BglII sites of pGL2-enhancer (Promega). All plasmids were purified by using plasmid kits (Qiagen) according to the manufacturer’s instructions. The oligonucleotide sequence for the Msx-1 consensus DNAbinding site [(CTAATTG)3] is 59AAGAGAAAGCTTCACACTAATTGGAGG CTGTACACACTAATTGGAGGCTGTACACACTAATTGGGGATCCACG GAC39. The oligonucleotide sequence for the mutated DNA site [(CTCCG TG)3] is 59AAGAGAAAGCTTCACACTCCGTGGAGGCTGTACACACTCC GTGGAGGCTGTACACACTCCGTGGGGATCCACGAAC39. Transient transfection in NIH 3T3 cells. NIH 3T3 cells were maintained in Iscove’s modified Dulbecco medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U of penicillin per ml, and 100 mg of streptomycin per ml in a humidified 378C incubator with 5% CO2. Cells (below passage 10) were seeded 16 to 24 h prior to transfection at 105 cells per 35-mm-diameter dish. Cells were transfected by a calcium phosphate precipitation method (73). The amount of DNA present in each precipitate was kept constant by addition of appropriate amounts of the parental expression plasmid pCB61. As an internal control for transfection efficiency, pCMV-bgal (1.0 mg) (80) was also included. Precipitates were left on the cells for 16 to 24 h, and 48 h posttransfection, cells were harvested in 13 Reporter lysis buffer (Promega). b-Galactosidase activity was assayed essentially as described in reference 73. Luciferase activity was measured as counts per minute in a Beckman LS5000TA scintillation counter using a luciferase assay system (Promega) according to the manufacturer’s instructions. Luciferase activities were standardized to b-galactosidase levels to account for differences in transfection efficiencies. Experiments were performed in duplicate and repeated a minimum of three times. Transient transfection in Cos-1 cells and Western blot analysis. Cos-1 cells were maintained in Iscove’s modified Dulbecco medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 U of penicillin per ml, and 100 mg of streptomycin per ml in a humidified 378C incubator with 5% CO2. Cells were seeded 16 to 24 h prior to transfection at 105 cells per 35-mm-diameter dish and transfected by a DEAE-dextran method (59). Duplicate dishes were transfected with appropriate amounts of the msx-1 expression plasmids and pCMV-bgal (1.0 mg) and harvested 48 h posttransfection. Cells in one duplicate dish were lysed in 13 Reporter lysis buffer (Promega), and the extract was assayed for b-galactosidase activity. Cells in the second dish were lysed in sodium dodecyl sulfate (SDS) sample buffer (200 ml), sheared through a broken 22-gauge needle, boiled for 10 min, and spun for 5 min at top speed in an Eppendorf centrifuge prior to loading on an SDS–13.5% polyacrylamide gel. The amount of each extract loaded (25 to 35 ml) was normalized to levels of b-galactosidase activity. After electrophoresis, the proteins were transferred to nitrocellulose (73), and the filter was blocked in a solution containing 10 mM MgCl2, 10 mM KCl, 1 mM CaCl2, 10 mM imidazole, 5% bovine serum albumin (BSA) (fraction V), 0.3% Tween 20, and 0.02% sodium azide and then incubated in the same buffer containing a-Msx-1 antiserum. The a-Msx-1 antiserum (used at 1:3,000) is directed against the purified Msx-1 homeodomain (amino acids 157 to 233) (details will be published elsewhere [28]). Antigen-antibody complexes were visualized using an

VOL. 15, 1995

Msx-1 REPRESSES TRANSCRIPTION SITE-INDEPENDENTLY

863

FIG. 1. Structure of Msx-1. (A) Schematic representation of the Msx-1 protein structure showing the position of the homeodomain (stippled box) and the percentage of prevalent amino acids (i.e., alanine [A], glycine [G], and proline [P]) in other protein regions. (B) The primary sequence of Msx-1 is shown in the single-letter amino acid code; residues are indicated numerically. The position of the homeodomain is shown by the stippled box. The sequence is in agreement with the corrected sequence (54), although it contains four additional residues (shown by the box).

enhanced chemiluminescence Western blotting (immunoblotting) kit (Amersham). Film exposure was for approximately 5 min. In vitro transcription assays. The parental plasmid used as the transcriptional template was pML(C2AT), which contains the adenovirus major late promoter driving a transcript from a G-less cassette (75). This plasmid was modified to contain five tandem copies of the Gal4 DNA-binding site upstream of the major late promoter. Transcription from this plasmid was activated by the addition of 0.03 mM purified Gal4-VP16 protein. To obtain Gal4-VP16, sequences encoding the chimeric activator protein (obtained by PCR amplification from a eukaryotic expression plasmid, a gift of S. Madden and F. J. Rauscher III, Wistar Institute) were cloned into the bacterial expression plasmid pDS56 and purified by nickel affinity chromatography as previously described (2). Preparation of HeLa nuclear extracts and transcription reactions were as described (1). The HeLa transcription system (25 ml) contained 0.5 mg of supercoiled plasmid template, 40 mM N-2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid (HEPES; pH 7.6), 5 mM MgCl2, 70 mM KCl, 1 mM dithiothreitol, 12% (vol/vol) glycerol, 2% (wt/vol) polyethylene glycol 8000, 20 U of RNasin (Promega), 20 U of RNase T1 (Boehringer Mannheim), and 5 ml (;50 mg) of HeLa nuclear extract. RNA synthesis was initiated by the addition of a reaction mix containing 0.5 mM ATP and CTP, 0.01 mM 39-O-methyl-GTP (Pharmacia), and 10 mCi of [a-32P]UTP (800 Ci/ mmol; NEN). Purified Msx-1 was added at 0.5, 1.0, and 2.0 mM, and Msx-1(157233) was added at 0.5 and 1.0 mM. The reconstituted transcription system (40 ml) contained 0.15 mg of supercoiled plasmid template, 20 mM HEPES-KOH (pH 7.9), 8 mM MgCl2, 50 to 60 mM KCl, 10 mM ammonium sulfate, 12% (vol/vol) glycerol, 10 mM 2-mercaptoethanol, 2% (wt/vol) polyethylene glycol 8000, 20 U of RNase T1 (Boehringer Mannheim), 0.6 mM ATP and CTP, and 1 mCi of [a-32P]UTP (800 Ci/mmol; NEN). Transcription was initiated by the addition of the following purified factors: 0.6 mg of TFIIA/J (10), 0.03 mg of recombinant TFIIB (23), 1.15 mg of TFIID (47), 0.05 mg of recombinant TFIIE (63), 0.63 mg of TFIIF/H (17), and 0.25 mg of RNA Pol II (42). Purified Msx-1 and Msx-1(157233) were added at 0.15, 0.3, and 0.6 mM. Reactions were allowed to proceed at 308C for 40 or 60 min, after which time the RNA products were extracted with phenol-chloroform, ethanol precipitated, resolved on a 4.5% acrylamide–6 M urea gel, and visualized by autoradiography. RNA transcript bands were quantitated with a PhosphorImager (Molecular Dynamics). Gel retardation assays with purified general transcription factors. Gel retardation assays with purified general transcription factors and a DNA fragment containing the adenovirus major late promoter were performed as described in reference 47. Binding reactions were carried out in buffer containing 22 mM HEPES (pH 7.9), 4.4 mM MgCl2, 56 mM KCl, 9% (vol/vol) glycerol, 2.2% (wt/vol) polyethylene glycol 8000, 0.1 mM EDTA, 0.3 mM dithiothreitol, 0.5 mg of dGdC, 0.1% Nonidet P-40, and 5 mg of BSA. To buffer (27 ml) on ice were added (in order) 0.27 mM recombinant TBP, 0.2 mM TFIIA, 0.1 mM TFIIB, and

0.55 mM either Msx-1 or Msx-1(157-233). Reactions were then transferred to 308C for 10 min. Protein-DNA complexes were resolved from free DNA by electrophoresis on a 6.5% nondenaturing acrylamide gel (at 48C) and visualized by autoradiography.

RESULTS Characteristics of the Msx-1 protein. Msx-1 has features, in addition to its conserved DNA-binding domain, that are reminiscent of transcriptional regulatory proteins (Fig. 1). The N-terminal region contains a high percentage of alanines, glycines, and prolines (Fig. 1), residues that are frequently associated with transcriptional regulatory domains (24, 25, 38, 46, 55). The C-terminal region is also rich in alanines, and both the N and C termini contain a high percentage of hydrophobic residues (Fig. 1). The homeodomain is located in the central region of the protein and is highly conserved with other members of the msx family (27), in contrast with other protein regions (54). Aside from this domain, Msx-1 shares no apparent similarity with other dimerization or DNA-binding motifs. In a previous study, we characterized the DNA-binding properties of the Msx-1 homeodomain using a truncated polypeptide, Msx-1(157-233), and identified a consensus DNA site that contained the motif CTAATTG (7). Full-length Msx-1 also bound the consensus DNA site identified for the Msx-1 homeodomain (6). Moreover, it exhibited a similar specificity and affinity for this site and for various other DNA sites as tested by gel retardation and DNase I footprint analysis (6). The Msx-1 homeodomain DNA site was therefore used to test the transcriptional properties of Msx-1 in cotransfection assays. Repression of basal transcription by Msx-1 does not require homeodomain DNA-binding sites. To examine the transcriptional properties of Msx-1, cotransfection assays were performed in NIH 3T3 cells. The reporter plasmid contained the

864

CATRON ET AL.

MOL. CELL. BIOL.

FIG. 2. Repression of basal transcription by Msx-1 does not require homeodomain DNA-binding sites. Transfection assays were performed in NIH 3T3 cells using a luciferase reporter plasmid (2 mg) that contained the SV40 promoter (stippled box) and either three tandem copies of the Msx-1 homeodomain consensus DNA site [(CTAATTG)3] or three copies of a mutated DNA site [(CTCCGTG)3]. Expression plasmids contained sequences encoding full-length Msx-1 (pmsx-1), the Msx-1 homeodomain [pmsx-1(157-233)], or a chimeric protein containing the Msx-1 homeodomain fused to the transcriptional activation domain of VP16 [pmsx-1(157233)vp16] and were included at the indicated amounts. A plasmid encoding b-galactosidase (1 mg) was included as an internal control for transfection efficiency. Data are expressed as the fold difference in luciferase activity obtained with the indicated expression plasmid relative to the activity obtained with the expression plasmid containing no insert. All transfection assays were repeated three to five times in duplicate; variability among assays was not more than 20%.

luciferase gene driven by the SV40 early promoter (bp 2135 to 161) (Fig. 2). The plasmid also contained either three tandem copies of the homeodomain DNA site [(CTAATTG)3] or three copies of a mutated site not bound by Msx-1 in vitro (6) [(CTCCGTG)3] (Fig. 2). Both reporter plasmids yielded comparable basal levels of luciferase activity when transfected into NIH 3T3 cells. Expression plasmids (pCB61 [61]) contained sequences encoding Msx-1 (pmsx-1), Msx-1(157-233) [pmsx1(157-233)], or a chimeric protein that contained the Msx-1 homeodomain fused to the transcriptional activation domain of VP16 [pmsx-1(157-233)vp16] (Fig. 2) and were driven by the cytomegalovirus promoter. Western blot analysis confirmed that the proteins were expressed in vivo (see below, Fig. 5B). Cotransfection of pmsx-1 with the luciferase reporter plasmid resulted in a concentration-dependent repression of basal transcriptional activity (Fig. 2). In contrast, pmsx-1(157-233) had no significant effect (Fig. 2). Interestingly, pmsx-1 was equally effective in repressing transcriptional activity from either the reporter plasmid which contained the homeodomain DNA sites or that which contained the mutated sites, suggesting that repression did not require the homeodomain DNAbinding sites [Fig. 2; compare (CTAATTG)3 and (CTCCG TG)3]. In contrast, pmsx-1(157-233)vp16 specifically activated the reporter plasmid which contained the homeodomain DNA sites and had a minimal effect on the plasmid which contained the mutated sites [Fig. 2, compare (CTAATTG)3 and (CTC CGTG)3]. The implication of these findings is that repression by Msx-1 does not require homeodomain DNA-binding sites. This observation is supported by several lines of evidence. (i) Msx-1 repressed transcription of both reporter plasmids to the same degree at all concentrations tested (Fig. 2). Even with amounts as small as 50 ng of pmsx-1, 55 to 60% repression (2.5-fold; Fig. 2) was observed from the plasmids which contained or lacked the homeodomain DNA-binding sites (Fig. 2). (ii) The Msx-1 homeodomain, although expressed in vivo (see Fig. 5B) and targeted to the nucleus (28), had no significant effect on transcription from either reporter plasmid [Fig. 2,

pmsx-1(157-233)]. Therefore, it is unlikely that repression by Msx-1 is due to binding of the homeodomain to the AT-rich TATA box, thereby blocking the binding of TBP. (iii) Msx1(157-233)VP16 specifically activated transcription through the reporter plasmid which contained the homeodomain DNA-binding sites (Fig. 2). This demonstrates that these sites are bound specifically and effectively in vivo by the Msx-1 homeodomain and indicates that Msx-1 is not acting through an internal site in the vector. (iv) Repression of luciferase activity by Msx-1 corresponded to a decrease in luciferase mRNA, confirming that the effect of Msx-1 was at the level of transcription (6). One possible concern is that repression by Msx-1 is actually due to squelching. This phenomenon refers to nonspecific repression due to the sequestering of a component of the core transcription complex by a transcriptional activator present in high concentrations. Although we cannot entirely rule out the possibility that repression by Msx-1 is due to squelching, these data are not consistent with this explanation since the amount of the expression plasmid required for repression is relatively small and within the range that is normally used to measure transcriptional activity in vitro and in vivo (e.g., see references 24, 25, 29, and 46). Moreover, activation by Msx-1 was not observed under any circumstances regardless of the promoter, upstream binding site, or cell type tested (6). Repression of activated transcription by Msx-1 does not require homeodomain DNA-binding sites. The previous data demonstrated that Msx-1 repressed basal transcription in the absence of homeodomain DNA-binding sites. To determine if Msx-1 also had a similar effect on activated transcription, we tested its ability to repress transcription activated by Gal4VP16, a chimeric protein composed of the Gal4 DNA-binding domain and the VP16 transcriptional activation domain (72). For the activated system, the reporter plasmid contained five copies of the Gal4 DNA-binding site (85) cloned upstream of the SV40 promoter (Fig. 3). Transcriptional activation was achieved by cotransfection of a Gal4-VP16-encoding plasmid

VOL. 15, 1995


FIG. 3. Repression of activated transcription by Msx-1 does not require homeodomain DNA-binding sites. Transfection assays were performed in NIH 3T3 cells using a luciferase reporter plasmid (2 mg) that contained the SV40 promoter (stippled box) and five tandem copies of the Gal4 DNA site (5XGal4). Assays were performed in the absence (2) or presence (1) of an activator plasmid encoding Gal4-VP16 (1 ng). Assays also contained the expression plasmid without an insert (pCB61) or the expression plasmid encoding Msx-1 (pmsx-1) or the Msx-1 homeodomain [pmsx-1(157-233)]. In the bottom graph, activity is represented as the relative fold difference in Gal4-VP16-activated transcription in the presence of the indicated amounts of pmsx-1 or pmsx-1(157233). Error bars show the difference between duplicates; variability among assays was in the range of 20%.

which resulted in ;40-fold activation (Fig. 3, top graph). Transfection of 30 or 100 ng of pmsx-1 in the activated transcription system resulted in approximately 4- or 18-fold repression, respectively, of luciferase activity from the reporter plasmid (Fig. 3). In contrast, pmsx-1(157-233) had a minimal effect on luciferase activity (Fig. 3). The presence of homeodomain DNA-binding sites upstream of the Gal4 sites did not enhance repression by pmsx-1 (6), indicating that under these assay conditions, such sites do not serve to concentrate Msx-1 near this area to affect transcriptional activity. These findings demonstrate that Msx-1 repressed activated as well as basal transcription, and in either case, homeodomain DNA-binding sites were not required. Msx-1 represses Inr-directed transcription independently of homeodomain DNA-binding sites. The minimal promoter ele-

865

FIG. 4. Msx-1 represses Inr-directed transcription independently of homeodomain DNA sites. Transfection assays were performed in NIH 3T3 cells using a luciferase reporter plasmid (8 mg) that contained a TATA-less initiator element (Inr) from the human b-polymerase gene (86) and the SV40 enhancer element (enhancer). In the bottom graph, activity is represented as the relative fold difference in luciferase activity assayed in the presence of pmsx-1 or pmsx1(157-233) at the amounts indicated. Error bars show the difference between duplicates; variability among assays was in the range of 20%.

ments required for transcription of RNA Pol II genes are a TATA box and/or an initiator element (Inr) located at or near the transcription start site (91). The experiments described above demonstrate Msx-1 repression through the SV40 promoter which utilizes a TATA box to direct transcription initiation. To determine if Msx-1 also repressed transcription from a promoter which lacked a TATA box, we tested repression of a luciferase reporter plasmid which contained an Inr from the human b-polymerase gene (i.e., bp 220 to 160) (86) (Fig. 4). In cotransfection assays, pmsx-1 completely repressed transcription of the Inr reporter plasmid, whereas pmsx-1(157-233) had no significant effect (Fig. 4). These results are similar to those obtained with the SV40 promoter (Fig. 2 and 3). Moreover, as observed in the previous experiments (Fig. 2 and 3), repression by Msx-1 of the Inr reporter plasmid was achieved in the absence of homeodomain DNA sites (Fig. 4). These results demonstrate that homeodomain DNA-binding sites are not required for Msx-1 repression of TATA-containing and TATA-less promoters. Multiple regions in both the N and C termini of Msx-1 contribute to repression. To define the regions of Msx-1 that

866

CATRON ET AL.

MOL. CELL. BIOL.

FIG. 5. N- and C-terminal regions of Msx-1 contribute to repression. (A) Truncated Msx-1 polypeptides contain the amino acids shown in parentheses and correspond to the protein regions represented by the boxes. Repression was tested with the Gal4-VP16-activated system (as described in the legend to Fig. 3). Expression plasmids were included at the indicated amounts. Results represent the averages from five independent experiments performed in duplicate; variability among assays is indicated by the error bars. The repressor regions are shown by the lightly stippled boxes. (B) Western blot analysis was performed using extracts prepared from Cos-1 cells that were transfected with the expression plasmid without an insert (cell extract) or with the expression plasmids encoding the Msx-1 truncated polypeptides indicated (plasmid amount was as in Fig. 6A). The anti-Msx-1 antiserum is directed against the homeodomain (28), which is contained in each of the Msx-1 truncated polypeptides.

contribute to repression, we constructed a series of expression plasmids that encoded truncated versions of the Msx-1 polypeptide (Fig. 5A). Each of the truncated polypeptides contained the homeodomain but lacked various portions of the N or C terminus (Fig. 5A). Western blot analysis confirmed that each of the truncated polypeptides was expressed in transfected cells (Fig. 5B), and immunofluorescence analysis showed that the homeodomain was sufficient for nuclear localization (28). Although each of the polypeptides was expressed in vivo, those lacking C-terminal sequences were expressed at lower

levels (6). To achieve approximately equivalent levels of expression, plasmids encoding Msx-1 polypeptides lacking Cterminal sequences were transfected at a higher concentration (1,000 ng) with respect to the concentration (200 ng) of those plasmids which contained the C-terminal sequences (as shown in Fig. 5A). The repressor functions of the truncated Msx-1 polypeptides were tested with the activated transcription system (Fig. 5A). These results show that multiple regions of Msx-1 contribute to repression (Fig. 5A, stippled boxes). Two regions within the N terminus are required for maximal repressor function: the first 36 amino acids, since deletion of this region reduced repression approximately twofold [Fig. 5A; compare Msx-1 with Msx-1 (37-297)], and residues contained within amino acids 89 to 132, since their deletion resulted in a loss of repressor function [Fig. 5A; compare Msx-1(89-297) with Msx-1(132-297)]. In addition, sequences within the C terminus also contributed to repression. Therefore, a truncated polypeptide which contained part of the N-terminal repressor domain but lacked the C-terminal region was a significantly less effective repressor than the corresponding polypeptide which contained the Cterminal region [Fig. 5A; compare Msx-1(89-297) with Msx-

VOL. 15, 1995


867

FIG. 6. Msx-1 functions as a repressor in the context of a heterologous DNA-binding domain. Fusion polypeptides contain the Gal4 DNA-binding domain (dotted box) and the Msx-1 amino acids shown in parentheses which correspond to the protein regions represented by the boxes (as in Fig. 5A). HD, the Msx-1 homeodomain. Transfection assays were performed in NIH 3T3 cells using a luciferase reporter plasmid (2 mg) that contained the SV40 promoter (stippled box) and either five tandem copies of the Gal4 DNA-binding site (5XGal4, left graph) or no additional binding sites (right graph). Activity is represented as the relative fold difference in the presence of the Gal4–Msx-1 expression plasmids at the indicated amounts as compared with activity in the presence of the expression plasmid without an Msx-1 insert. Assays were repeated a minimum of three times. Error bars show the difference between duplicates; variability among assays was in the range of 20%.

1(89-233)]. The N- and C-terminal repressor regions are rich in alanine, glycine, and proline residues, hallmarks of transcriptional regulatory domains. Msx-1 functions as a repressor in the context of a heterologous DNA-binding domain. To determine if Msx-1 repressed transcription in the context of a heterologous DNA-binding domain, full-length Msx-1 or the N- or C-terminal region was fused to the Gal4 DNA-binding domain (Fig. 6). The Gal4– Msx-1 fusion polypeptides were tested for their ability to repress transcription of a reporter plasmid in the presence or absence of the Gal4 DNA-binding sites (Fig. 6). Full-length Msx-1 fused to Gal4 was a potent repressor in the presence of the Gal4 sites and also retained the ability to repress transcription in the absence of these sites (Fig. 6, Gal4–Msx-1, right and left graphs). Therefore, targeting Msx-1 to the promoter region through a heterologous DNA-binding domain enhances its ability to repress transcription, although Gal4–Msx-1 still repressed transcription in the absence of Gal4 sites. Both the Nand C-terminal domains of Msx-1 also repressed transcription when fused to Gal4, but only in the presence of the Gal4 DNA-binding sites [Fig. 6, Gal4–Msx-1(1-157) and Gal4–Msx-1 (226-297), right and left graphs]. The N-terminal domain exhibited stronger repressor function than the C-terminal domain, consistent with results obtained from the Msx-1 truncated polypeptide series (compare Fig. 6 and 5A). These data demonstrate that repressor regions are contained within both the N- and C-terminal domains of Msx-1 but that all domains of Msx-1 are required for maximal repressor function. Msx-1 represses transcription in vitro and interacts with general transcription factors. Repression by Msx-1 was tested directly by in vitro transcription assays (Fig. 7). In vitro assays were performed using purified Msx-1 or Msx-1(157-233) protein and tested in an activated transcription system similar to the activated system used in cotransfection assays. The reporter plasmid contained the adenovirus major late promoter driving expression of a G-less cassette (75). The plasmid also contained five tandem copies of the Gal4 DNA-binding site, and transcriptional activation was achieved by addition of purified Gal4-VP16 (Fig. 7). Msx-1 repressed activated transcrip-

tion in vitro in a concentration-dependent manner when tested with crude HeLa nuclear extracts (Fig. 7A). In contrast, equimolar concentrations of Msx-1(157-233) had no significant effect (Fig. 7A). These results are in agreement with those obtained in vivo by transient transfection assays. Moreover, as observed in vivo, reporter plasmids which contained the homeodomain DNA sites were repressed to the same extent as those which lacked the Msx-1 sites (93). These data provide direct evidence that Msx-1 functions as a transcriptional repressor and show that the repressor function does not require homeodomain DNA-binding sites. The crude HeLa nuclear extracts may contain cellular factors which could influence the transcriptional activity of Msx-1 in this system. To test whether repression by Msx-1 occurred in the absence of such cellular factors, we performed in vitro transcription experiments using a reconstituted system composed only of purified GTFs and RNA Pol II (Fig. 7B). With the purified factors, Msx-1 repressed transcription in a concentration-dependent manner, whereas equimolar concentrations of Msx-1(157-233) had no significant effect (Fig. 7B). Shown are results obtained with the activated transcription system (Fig. 7B); Msx-1 exhibited a similar ability to repress basal transcription in the reconstituted system (93). These findings suggest that repression by Msx-1 is mediated via interaction with a component of the general transcription complex. Since homeodomain DNA-binding sites are not required, repression may be mediated through protein-protein interactions. To test whether Msx-1 interacts with components of the general transcription complex, we performed gel retardation assays (Fig. 8). Protein-DNA complexes were formed with a DNA fragment that contained the adenovirus major late promoter (47) in the absence of GTFs (NA) or in the presence of the purified factor TBP (D), TBP and TFIIA (DA), or TBP, TFIIA, and TFIIB (DAB) (Fig. 8). Complexes were formed in the presence or absence of purified Msx-1 or Msx-1(157-233) (Fig. 8). As demonstrated previously (47), the presence of TFIIA significantly enhanced binding of TBP to the major late promoter (Fig. 8, DA), and addition of TFIIB alters the mobility of the complex (Fig. 8, DAB). Msx-1, but not an equimo-

868

CATRON ET AL.

MOL. CELL. BIOL.

FIG. 7. Msx-1 does not require homeodomain DNA-binding sites for repression in vitro. In vitro transcription assays were performed using a reporter plasmid that contained the adenovirus major late promoter (ML) driving a G-less cassette (G-less) (0.5 mg) (75). The reporter plasmid also contained five tandem copies of the Gal4 DNA-binding site (5XGal4). Assays contained crude HeLa nuclear extracts (50 mg) (A) or a reconstituted transcription mix containing purified general transcription factors (B). Transcription was measured in the absence (2) or presence (1) of purified Gal4-VP16 protein (0.03 mM). Assays also contained increasing concentrations of Msx-1 or Msx-1(157-233) (as indicated by triangles). (A) The concentrations of Msx-1 were 0.5, 1.0, and 2.0 mM, and the concentrations of Msx-1(157-233) were 0.5 and 1.0 mM. (B) The concentrations of Msx-1 and Msx-1(157-233) were 0.15, 0.30, and 0.60 mM. Radiolabelled RNA was resolved on a 4.5% acrylamide–6 M urea denaturing gel and visualized by autoradiography.

lar concentration of Msx-1(157-233), retarded the mobility of both the DA and DAB complexes (Fig. 8, asterisks). These data demonstrate that Msx-1 interacts with these GTFs on the adenovirus major late promoter fragment. This interaction may provide one mechanism by which Msx-1 could repress transcription via a protein-protein interaction with a component of the general transcription complex.

FIG. 8. Msx-1 interacts with purified general transcription factors in vitro. Gel retardation assays were performed using a DNA fragment (150 bp) containing the adenovirus major late promoter. Protein-DNA complexes were formed in the absence of GTFs (NA) or in the presence of TBP (D), TBP plus TFIIA (DA), or TBP plus TFIIA plus TFIIB (DAB) as indicated. Binding reactions were performed in the absence (2) or presence (1) of purified Msx-1 or Msx1(157-233) (0.55 mM). Protein-DNA complexes were resolved from free DNA by gel electrophoresis on 6.5% nondenaturing acrylamide gels. The asterisks indicate the shift in the DA-DNA or DAB-DNA complex in the presence of Msx-1.

DISCUSSION The major finding of the present paper is that a homeodomain protein, Msx-1, is a potent transcriptional repressor. However, although Msx-1 exhibits sequence-specific DNAbinding activity, homeodomain DNA-binding sites were not required for its repressor function in vivo or in vitro. Indeed, the presence of homeodomain DNA-binding sites did not increase the ability of Msx-1 to repress transcription in cotransfection assays even when the expression plasmid encoding Msx-1 was present in very small amounts (i.e., 30 to 50 ng). Msx-1 repressed transcription of basal and activated templates and through both TATA-containing and TATA-less promoters. In addition, specific domains of Msx-1 retained repressor function when assayed in the context of a heterologous DNAbinding domain. Msx-1 also repressed transcription in the absence of homeodomain DNA-binding sites in an in vitro reconstituted transcription system composed of purified GTFs and interacted with components of the core transcription complex in gel retardation assays, suggesting that repression results from a direct protein-protein interaction with a component of the general transcription complex. The potential for Msx-1 to repress transcription through protein-protein rather than protein-DNA interactions may be an important feature of its proposed role as a regulator of the differentiation state of specific cell populations during morphogenesis. The observation that Msx-1 can repress transcription in the absence of homeodomain DNA-binding sites adds to a growing body of evidence which indicates that the function of homeodomain proteins in transcriptional regulation may not be limited to their interaction with such sites. In fact, since homeodomain proteins share similar DNA binding specificities (35, 76), it is difficult to explain their selective functions solely on

VOL. 15, 1995


the basis of their DNA binding properties. This ambiguity is fostered by the observation that although these proteins share similar DNA binding properties, the homeodomain mediates functional specificity in vivo (19, 34, 39, 48, 92). Moreover, it has been shown that in some instances, DNA-binding activity may not be required for function in vivo. For example, mutations of critical DNA contacts within the homeodomain of the yeast Mata2 protein do not abolish its repressor function (83). In other instances, proteins lacking all or part of their homeodomain may retain some aspects of function (3, 16, 90). What role does the homeodomain play in transcriptional regulation by Msx-1? Since our data show that homeodomain DNA-binding sites are not required for repression, it is likely that the Msx-1 homeodomain serves an alternative function. For instance, it may mediate interactions with other protein factors (22, 66, 88, 90), or it may provide a scaffold which maintains appropriate tertiary structure of Msx-1 (78). DNAbinding domains have been shown to serve various functions in transcriptional regulation, particularly as surfaces for proteinprotein interactions. For instance, bZip domains mediate functional interactions with steroid hormone receptors (e.g., glucocorticoid receptor) (52), viral proteins (e.g., Tax and E1a) (40, 84), and other transcription factors (e.g., NF-kB and NFATp) (12, 31). There has been ample speculation that the homeodomain also mediates protein-protein interactions, and several functional associations have been described (66, 88, 90). The contribution of the homeodomain as a structural motif has been less well explored, although we have observed that mutations within the homeodomain of Msx-1 affect both structure and stability (14, 78). The observation that Msx-1 represses transcription in the absence of homeodomain DNA-binding sites does not rule out the possibility that DNA binding contributes to its function as a transcriptional regulator. For instance, p53 functions in transcriptional regulation either independently of DNA-binding sites or through its cognate DNA sites, depending upon the circumstances (41, 44, 77). It is possible that in specific cell populations during embryogenesis, Msx-1 binds to a DNA site of alternative sequence or requires a particular protein partner present only in specific cell types to target it to DNA-binding sites in the control regions of specific target genes. An alternative possibility is that DNA binding serves to sequester Msx-1, thus precluding, rather than enhancing, its transcriptional function. Although this idea is somewhat heretical, it is supported by a variety of published observations. We (7, 62) and others (9) have observed that although homeodomain proteins have similar binding specificities, they vary in their affinity for DNA. Interestingly, the potency of particular homeodomains in vivo (4) is inversely correlated with their affinity for DNA (62). Moreover, Han and Manley have noted an inverse correlation between binding affinity and the ability of certain homeodomain proteins to repress transcription (24, 25). Given the fact that homeodomains are notorious for their broad and overlapping binding specificities and the observation that there are numerous potential binding sites in the genome, sequestering homeodomain proteins via DNA binding may provide a mechanism for regulating their function. Repression by Msx-1 requires multiple protein regions which resemble other repressor domains in that they contain a high percentage of alanine, proline, and glycine residues (24, 25, 38, 46). Very little is known about the structure of repressor regions, although Han and Manley have suggested that they consist of short stretches of hydrophobic amino acids in regions that are relatively unstructured (24, 25). At this point, the contribution of particular residues towards repression by Msx-1 is not known, although such studies are in progress.

869

However, maximal repression by Msx-1 appears to be a composite function of its multiple domains since both the N- and C-terminal regions of Msx-1 retain repressor function in the context of the Gal4 DNA-binding domain, yet the full-length Msx-1 fused to Gal4 is the most potent repressor. These domains may provide several unique surfaces for multiple protein-protein interactions, as has been observed for certain activator proteins which contain multiple activation domains (e.g., Sp1) (15, 20, 65). Although the mechanisms that promote transcriptional activation have been extensively studied, only recently has repression emerged as an important mode of regulation, and consequently there is much less known about the mechanisms of repression. A few repressor proteins have been fairly well characterized. These fall into two general classes: those which utilize a sequence-specific DNA binding function to direct target selection (e.g., Kru ¨ppel, Engrailed, Even-skipped, and WT1) (24, 25, 38, 46) and those which lack discernible DNAbinding activities and presumably utilize protein-protein interactions to direct target selection (e.g., Dr1, NC1, and NC2) (29, 50, 51). It is noteworthy that the distinction in mode of target selection reflects how these repressor proteins were identified and characterized. Thus, Kru ¨ppel, Engrailed, Evenskipped, and WT1 were identified on the basis of their sequence-specific DNA binding properties and subsequently shown to function as transcriptional repressors through cognate DNA sites, whereas Dr1, NC1, and NC2 were identified on the basis of their ability to repress transcription in vitro. Perhaps under certain circumstances these repressor proteins are directed to target sites by a mode of selection alternative to that by which they were identified. In fact, Kru ¨ppel can repress transcription of some genes even in the absence of its cognate DNA-binding sites (94). The ability of Msx-1 to associate with protein complexes composed of TBP and TFIIA (DA) and TBP, TFIIA, and TFIIB (DAB) in gel retardation assays suggests that Msx-1 represses transcription through interaction with the core transcription complex. Interestingly, the homeodomain alone did not mediate protein complex formation with GTFs. Therefore, if the homeodomain contributes to repression through proteinprotein interactions, such interactions are not sufficient to sustain protein complex formation. Although the minimal detectable complex was that formed between Msx-1 and DA, we observed that Msx-1 could also associate with a higher-order complex containing several other GTFs and Pol II (93). These findings suggest that Msx-1 impedes the initiation or progression of transcription rather than the assembly of the core transcription complex. This is distinct from Dr1, whose association with TBP blocks its association with other GTFs (29). Since there is limited information available regarding the interactions of other repressor proteins with the core transcription complex, it is not apparent whether either mode of interaction will be of general significance for other repressor proteins. However, it is possible that the differences observed between Msx-1 and Dr1 in the gel retardation assays reflect their unique functions. For instance, Dr1 is presumably a global transcriptional repressor, whereas Msx-1 is presumed to regulate a subset of genes at a particular stage of morphogenesis. The potential for Msx-1 to associate with the core transcriptional complex as it is poised for action would allow rapid onset of transcription once Msx-1 is cleared from the promoter. The transcriptional properties that we have described for Msx-1 on the basis of our biochemical studies are consistent with its proposed biological function as a regulator of the differentiation state of specific cell populations based on both

870

CATRON ET AL.

in vivo expression studies (26, 43, 45, 68, 89) and in vivo bioassays (8, 67, 69, 79). For instance, Msx-1 expression appears to be incompatible with the expression of particular differentiation-specific genes (e.g., myogenic factors, including MyoD). Presumably, the ability of Msx-1 to maintain cells in an undifferentiated state entails repression of several genes simultaneously and this could potentially be accomplished through Msx-1 targeting to the core transcription complex by proteinprotein interactions. Msx-1 is remarkably similar with respect to its transcriptional properties and biological function to another homeodomain repressor protein, SCIP, which has been characterized by Monuki and colleagues (55–58). SCIP, a member of the POU class of homeodomain proteins, is expressed in Schwann cells during embryogenesis only during periods of rapid cell proliferation. SCIP expression precedes that of the myelin-specific genes, and SCIP actively represses their expression. Intriguingly, although the promoter of the major structural protein of myelin contains binding sites for SCIP, these sites are not required for repressor function (56). The authors suggest that SCIP is directed to appropriate target genes via protein-protein interactions rather than via DNA-binding activity. The striking parallel with Msx-1 raises the intriguing possibility that Msx-1 and SCIP represent a novel class of transcriptional regulators whose function is to maintain cells in an undifferentiated state during periods of proliferation. ACKNOWLEDGMENTS We gratefully acknowledge Danny Reinberg for generously providing us with purified transcription factors, for invaluable help in setting up the reconstituted transcription system, and for many helpful discussions. We thank Jill McMahon and Andy McMahon, Harvard University, for the gift of the mouse embryonic cDNA; Chuck Kunsch and Craig Rosen, Human Genome Sciences, for the gift of the plasmid containing the VP16 activation domain; Steve Madden, Jennifer Morris, and Frank J. Rauscher III, Wistar Institute, for the gifts of the pM2 plasmid and the plasmids encoding Gal4-VP16 and b-galactosidase; and Kam Yeung and Danny Reinberg, RWJ Medical School, for the gift of the Inr-luciferase plasmid. We thank Isaac Edery, Tom Curran, Arnold Rabson, Frank J. Rauscher III, Scott Holmes, and Beth Ann Antoni for critical reading of the manuscript. We are especially grateful to Fred Mermelstein for critical reading of the manuscript and valuable discussions. We acknowledge Rita Sweeney and Janet Hansen for excellent preparation of the manuscript and all members of the Abate laboratory for helpful discussions. This work was supported by funds to C.A. from NIH grant HD29446-03 and the New Jersey Commission on Science and Technology. K.M.C. was supported by a postdoctoral training grant from Hoffmann-La Roche. J.M.W. was supported by the Rutgers-UMDNJ Biotechnology Training Program, grant 2-T32-GM08339-06. C.A. is the recipient of a National Science Foundation Young Investigator Award and a Sinsheimer Scholar Award. REFERENCES 1. Abate, C., D. Luk, and T. Curran. 1991. Transcriptional regulation by Fos and Jun in vitro: interaction among multiple activator and regulatory domains. Mol. Cell. Biol. 11:3624–3632. 2. Abate, C., D. Luk, R. Gentz, F. J. Rauscher III, and T. Curran. 1990. Expression and purification of the leucine zipper and DNA-binding domains of Fos and Jun: both Fos and Jun contact DNA directly. Proc. Natl. Acad. Sci. USA 87:1032–1036. 3. Ananthan, J., R. Baler, D. Morrissey, J. Zuo, Y. Lan, M. Weir, and R. Voellmy. 1993. Synergistic activation of transcription is mediated by the N-terminal domain of Drosophila fushi tarazu homeoprotein and can occur without DNA binding by the protein. Mol. Cell. Biol. 13:1599–1609. 4. Bachiller, D., A. Macias, D. Duboule, and G. Morata. 1994. Conservation of a functional hierarchy between mammalian and insect Hox/HOM genes. EMBO J. 13:1930–1941. 5. Buratowski, S. 1994. The basics of basal transcription by RNA polymerase II. Cell 77:1–3. 6. Catron, K. M., and C. Abate. Unpublished data.

MOL. CELL. BIOL. 7. Catron, K. M., N. Iler, and C. Abate. 1993. Nucleotides flanking a conserved TAAT core dictate the DNA binding specificity of three murine homeodomain proteins. Mol. Cell. Biol. 13:2354–2365. 8. Coelho, C. N. D., K. M. Krabbenhoft, W. B. Upholt, J. F. Fallon, and R. A. Kosher. 1991. Altered expression of the chicken homeobox-containing genes GHox-7 and GHox-8 in the limb buds of limbless mutant chick embryos. Development 113:1487–1493. 9. Corsetti, M. T., P. Briata, L. Sanseverino, A. Daga, I. Airoldi, A. Simeone, G. Palmisano, C. Angelini, E. Boncinelli, and G. Corte. 1992. Differential DNA binding properties of three human homeodomain proteins. Nucleic Acids Res. 20:4465–4472. 10. Cortes, P., O. Flores, and D. Reinberg. 1992. Factors involved in specific transcription by mammalian RNA polymerase II: purification and analysis of transcription factor IIA and identification of transcription factor IIJ. Mol. Cell. Biol. 12:413–421. 11. Deschamps, J., and F. Meijlink. 1992. Mammalian homeobox genes in normal development and neoplasia. Crit. Rev. Oncog. 3:117–173. 12. Du, W., D. Thanos, and T. Maniatis. 1993. Mechanisms of transcriptional synergism between distinct virus-inducible enhancer elements. Cell 74:887– 898. 13. Dynlacht, B. D., T. Hoey, and R. Tjian. 1991. Isolation of coactivators associated with the TATA-binding protein that mediate transactivation. Cell 66:563–576. 14. Ebu Isaac, V., and C. Abate. Unpublished data. 15. Emili, A., J. Greenblatt, and C. J. Ingles. 1994. Species-specific interaction of the glutamine-rich activation domains of Sp1 with TATA box-binding protein. Mol. Cell. Biol. 14:1582–1593. 16. Fitzpatrick, V. D., A. Percival-Smith, C. J. Ingles, and H. M. Krause. 1992. Homeodomain-independent activity of the fushi tarazu polypeptide in Drosphila embryos. Nature (London) 356:610–612. 17. Flores, O., I. Ha, and D. Reinberg. 1990. Factors involved in specific transcription by mammalian RNA polymerase II: purification and functional analysis of initiation factor IIB and IIE. J. Biol. Chem. 265:5629–5634. 18. Gehring, W. J. 1987. Homeo boxes in the study of development. Science 235:1245–1252. 19. Gibson, G., A. Schier, P. LeMotte, and W. J. Gehring. 1990. The specificities of Sex combs reduced and Antennapedia are defined by a distinct portion of each protein that includes the homeodomain. Cell 62:1087–1103. 20. Gill, G., E. Pascal, Z. H. Tseng, and R. Tjian. 1994. A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proc. Natl. Acad. Sci. USA 91:192–196. 21. Goodrich, J. A., T. Hoey, C. J. Thut, A. Admon, and R. Tjian. 1993. Drosophila TAFII40 interacts with both a VP16 activation domain and the basal transcription factor TFIIB. Cell 75:519–530. 22. Grueneberg, D. A., S. Natesan, C. Alexandre, and M. Z. Gilman. 1992. Human and Drosophila homeodomain proteins that enhance the DNAbinding activity of serum response factor. Science 257:1089–1095. 23. Ha, I., W. S. Lane, and D. Reinberg. 1991. Cloning of a human gene encoding the general transcription factor IIB. Nature (London) 352:689–695. 24. Han, K., and J. L. Manley. 1993. Functional domains of the Drosophila Engrailed protein. EMBO J. 12:2723–2733. 25. Han, K., and J. L. Manley. 1993. Transcriptional repression by the Drosophila Even-skipped protein: definition of a minimal repression domain. Genes Dev. 7:491–503. 26. Hill, R. E., P. F. Jones, A. R. Rees, C. M. Sime, M. J. Justice, N. G. Copeland, N. A. Jenkins, E. Graham, and D. Davidson. 1989. A new family of mouse homeo box-containing genes: molecular structure, chromosomal location, and developmental expression of Hox-7.1. Genes Dev. 3:26–37. 27. Holland, P. W. H. 1991. Cloning and evolutionary analysis of msh-like homeobox genes from mouse, zebrafish and ascidian. Gene 98:253–257. 28. Iler, N., and C. Abate. Unpublished data. 29. Inostroza, J. A., F. H. Mermelstein, I. Ha, W. S. Lane, and D. Reinberg. 1992. Dr1, a TATA-binding protein-associated phosphoprotein and inhibitor of class II gene transcription. Cell 70:477–489. 30. Jabs, E. W., U. Mu ¨ller, X. Li, L. Ma, W. Luo, I. S. Haworth, I. Klisak, R. Sparkes, M. L. Warman, J. B. Mulliken, M. L. Snead, and R. Maxson. 1993. A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynistosis. Cell 75:443–450. 31. Jaln, J., P. G. McCaffrey, Z. Miner, T. K. Kerppola, J. N. Lambert, G. L. Verdine, T. Curran, and A. Rao. 1993. The T-cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature (London) 365:352–355. 32. Kerr, L. D., L. J. Ransone, P. Wamsley, M. J. Schmitt, T. G. Boyer, Q. Zhou, A. J. Berk, and I. M. Verma. 1993. Association between proto-oncoprotein Rel and TATA-binding protein mediates transcriptional activation by NFkB. Nature (London) 365:412–419. 33. Kessel, M., and P. Gruss. 1990. Murine developmental control genes. Science 249:374–379. 34. Kuziora, M. A., and W. McGinnis. 1989. A homeodomain substitution changes the regulatory specificity of the deformed protein in Drosophila embryos. Cell 59:563–571.

VOL. 15, 1995


35. Laughon, A. 1991. DNA binding specificity of homeodomains. Biochemistry 30:11357–11367. 36. Lee, W. S., C. C. Kao, G. O. Bryant, X. Liu, and A. J. Berk. 1991. Adenovirus E1A activation domain binds the basic repeat in the TATA box transcription factor. Cell 67:365–376. 37. Lewin, B. 1991. Oncogenic conversion by regulatory changes in transcription factors. Cell 64:303–312. 38. Licht, J. D., M. J. Grossel, J. Figge, and U. M. Hansen. 1990. Drosophila Kru ¨ppel protein is a transcriptional repressor. Nature (London) 346:76–79. 39. Lin, L., and W. McGinnis. 1992. Mapping functional specificity in the Dfd and Ubx homeo domains. Genes Dev. 6:1071–1081. 40. Liu, F., and M. R. Green. 1994. Promoter targeting by adenovirus E1a through interaction with different cellular DNA-binding domains. Nature (London) 368:520–525. 41. Liu, X., C. W. Miller, P. H. Koeffler, and A. J. Berk. 1993. The p53 activation domain binds the TATA box-binding polypeptide in holo-TFIID, and a neighboring p53 domain inhibits transcription. Mol. Cell. Biol. 13:3291–3300. 42. Lu, H., O. Flores, R. Weinmann, and D. Reinberg. 1991. The nonphosphorylated form of RNA polymerase II preferentially associates with the preinitiation complex. Proc. Natl. Acad. Sci. USA 88:10004–10008. 43. Lyons, G. E., D. Houzelstein, D. Sasson, B. Robert, and M. E. Buckingham. 1992. Multiple sites of Hox-7 expression during mouse embryogenesis: comparison with retinoic acid receptor mRNA localization. Mol. Reprod. Dev. 32:303–314. 44. Mack, D. H., J. Vartikar, J. M. Pipas, and L. A. Laimins. 1993. Specific repression of TATA-mediated but not initiator-mediated transcription by wild-type p53. Nature (London) 363:281–283. 45. Mackenzie, A., G. L. Leeming, A. K. Jowett, M. W. J. Ferguson, and P. T. Sharpe. 1991. The homeobox gene Hox 7.1 has specific regional and temporal expression patterns during early murine craniofacial embryogenesis, especially tooth development in vivo and in vitro. Development 11:269–285. 46. Madden, S. L., D. M. Cook, and F. J. Rauscher III. 1993. A structurefunction analysis of transcriptional repression mediated by the WT1, Wilms’ tumor suppressor protein. Oncogene 8:1713–1720. 47. Maldonado, E., I. Ha, P. Cortes, L. Weis, and D. Reinberg. 1990. Factors involved in specific transcription by mammalian RNA polymerase II: role of transcription factors IIA, IID, and IIB during formation of a transcriptioncompetent complex. Mol. Cell. Biol. 10:6335–6347. 48. Mann, R. S., and D. S. Hogness. 1990. Functional dissection of Ultrabithorax proteins in D. melanogaster. Cell 60:597–610. 49. McGinnis, W., and R. Krumlauf. 1992. Homeobox genes and axial patterning. Cell 68:283–302. 50. Meisterernst, M., and R. G. Roeder. 1991. Family of proteins that interact with TFIID and regulate promoter activity. Cell 67:557–567. 51. Meisterernst, M., A. L. Roy, H. M. Lieu, and R. G. Roeder. 1991. Activation of class II gene transcription by regulatory factors is potentiated by a novel activity. Cell 66:981–993. 52. Miner, J. N., and K. R. Yamamoto. 1991. Regulatory crosstalk at composite response elements. Trends Biochem. Sci. 16:423–426. 53. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371–378. 54. Monaghan, P. A., D. R. Davidson, C. Sime, E. Graham, R. Baldock, S. S. Bhattacharya, and R. E. Hill. 1991. The Msh-like homeobox genes define domains in the developing vertebrate eye. Development 112:1053–1061. 55. Monuki, E. S., R. Kuhn, and G. Lemke. 1993. Cell-specific action and mutable structure of a transcription factor effector domain. Proc. Natl. Acad. Sci. USA 90:9978–9982. 56. Monuki, E. S., R. Kuhn, and G. Lemke. 1993. Repression of the myelin P0 gene by the POU transcription factor SCIP. Mech. Dev. 42:15–32. 57. Monuki, E. S., R. Kuhn, G. Weinmaster, B. D. Trapp, and G. Lemke. 1990. Expression and activity of the POU transcription factor SCIP. Science 249: 1300–1303. 58. Monuki, E. S., G. Weinmaster, R. Kuhn, and G. Lemke. 1989. SCIP: a glial POU domain gene regulated by cyclic AMP. Neuron 3:783–793. 59. Morris, J. F., S. L. Madden, O. E. Tournay, D. M. Cook, V. P. Sukhatme, and F. J. Rauscher III. 1991. Characterization of the zinc finger protein encoded by the WT 1 Wilms’ tumor locus. Oncogene 6:2339–2348. 60. Muneoka, K., and D. Sassoon. 1992. Molecular aspects of regeneration in developing vertebrate limbs. Dev. Biol. 152:37–49. 61. Patwardhan, S., A. Gashler, M. G. Siegal, L. C. Chang, L. G. Joseph, T. B. Shows, and M. M. Lebeau. 1991. egr3, a novel member of the egr family of genes encoding immediate-early transcription factors. Oncogene 6:917–928. 62. Pellerin, I., C. Schnabel, K. M. Catron, and C. Abate. 1994. Hox proteins have different affinities for a consensus DNA site that correlate with the positions of their genes on the hox cluster. Mol. Cell. Biol. 14:4532–4545. 63. Peterson, M. G., J. Inostroza, M. E. Maxon, O. Flores, A. Admon, and D. Reinberg. 1991. Structure and functional properties of human general transcription factor IIE. Nature (London) 354:369–373. 64. Pomerantz, J. L., T. M. Kristie, and P. A. Sharp. 1992. Recognition of the surface of a homeo domain protein. Genes Dev. 6:2047–2057. 65. Pugh, B. F., and R. Tjian. 1990. Mechanism of transcriptional activation by Sp1: evidence for coactivators. Cell 61:1187–1197.

871

66. Rauskolb, C., M. Peifer, and E. Wieschaus. 1993. extradenticle, a regulator of homeotic gene activity, is a homolog of the homeobox-containing human proto-oncogene pbx1. Cell 74:1101–1112. 67. Robert, B., G. Lyons, B. K. Simandl, A. Kuroiwa, and M. Buckingham. 1991. The apical ectodermal ridge regulates Hox-7 and Hox-8 gene expression in developing chick limb buds. Genes Dev. 5:2363–2374. 68. Robert, B., D. Sassoon, B. Jacq, W. Gehring, and M. Buckingham. 1989. Hox-7, a mouse homeobox gene with a novel pattern of expression during embryogenesis. EMBO J. 8:91–100. 69. Ros, M. A., G. Lyons, R. A. Kosher, W. B. Upholt, C. N. D. Coelho, and J. F. Fallon. 1992. Apical ridge dependent and independent mesodermal domains of GHox-7 and GHox-8 expression in chick limb buds. Development 116: 811–818. 70. Rosenfeld, M. G. 1991. POU-domain transcription factors: pou-er-ful developmental regulators. Genes Dev. 5:897–907. 71. Sadowski, I., B. Bell, P. Broad, and M. Hollis. 1992. GAL4 fusion vectors for expression in yeast or mammalian cells. Gene 118:137–141. 72. Sadowski, I., J. Ma, S. Triezenberg, and M. Ptashne. 1988. Gal4-VP16 in an unusually potent transcriptional activator. Nature (London) 335:563–564. 73. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 74. Satokata, I., and R. Maas. 1994. Msx-1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat. Genet. 6:348–355. 75. Sawadogo, M., and R. G. Roeder. 1985. Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci. USA 82:4394–4398. 76. Scott, P. M., J. W. Tamkun, and G. W. Hartzell III. 1989. The structure and function of the homedomain. Biochim. Biophys. Acta 989:25–48. 77. Seto, E., A. Usheva, G. P. Zambetti, J. Momand, N. Horikoshi, R. Weinmann, A. J. Levine, and T. Shenk. 1992. Wild-type p53 binds to the TATAbinding protein and represses transcription. Proc. Natl. Acad. Sci. USA 89:12028–12032. 78. Shang, Z., V. Ebu Isaac, H. Li, L. Patel, K. M. Catron, T. Curran, G. T. Montelione, and C. Abate. 1994. Design of a ‘‘minimAl’’ homeodomain: the N-terminal arm modulates DNA binding affinity and homeodomain structure. Proc. Natl. Acad. Sci. USA 91:8373–8377. 79. Song, K., Y. Wang, and D. Sasson. 1992. Expression of Hox-7.1 in myoblasts results in inhibition of differentiation and induces cell transformation. Nature (London) 360:477–481. 80. Spaete, R. R., and E. S. Mocarski. 1985. Regulation of cytomegalovirus gene expression: a and b promoters are trans activated by viral functions in permissive human fibroblasts. J. Virol. 56:135–143. 81. Stern, S., M. Tanaka, and W. Herr. 1989. The Oct-1 homeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16. Nature (London) 341:624–630. 82. Stringer, K. F., C. J. Ingles, and J. Greenblatt. 1990. Direct and selective binding of an acidic transcriptional activation domain to the TATA-box factor TFIID. Nature (London) 345:783–785. 83. Vershon, A. (Rutgers University). 1994. Personal communication. 84. Wagner, S., and M. R. Green. 1993. HTLV-1 Tax protein stimulation of DNA binding of bZIP proteins by enhancing dimerization. Science 262:395– 399. 85. Webster, N., J. R. Jin, S. Green, M. Hollis, and P. Chambon. 1988. The yeast UASG is a transcriptional enhancer in human HeLa cells in the presence of GAL4 trans-activator. Cell 52:169–178. 86. Widen, S. G., P. Kedar, and S. H. Wilson. 1988. Human b-polymerase gene: structure of the 59-flanking region and active promoter. J. Biol. Chem. 263:16992–16998. 87. Xu, X., C. Prorock, H. Ishikawa, E. Maldonado, Y. Ito, and C. Gelı´nas. 1993. Functional interaction of the v-Rel and c-Rel oncoproteins with the TATAbinding protein and association with transcription factor IIB. Mol. Cell. Biol. 13:6733–6741. 88. Xue, D., Y. Tu, and M. Chalfie. 1993. Cooperative interactions between Caenorhabditis elegans homeo proteins UNC-86 and MEC-3. Science 261: 1324–1326. 89. Yokouchi, Y., K. Ohsugi, H. Sasaki, and A. Kuroiwa. 1991. Chicken homeobox gene Msx-1: structure, expression in limb buds and effect of retinoic acid. Development 113:431–444. 90. Zappavigna, V., D. Sartori, and F. Mavilio. 1994. Specificity of HOX protein function depends on DNA-protein and protein-protein interactions, both mediated by the homeo domain. Genes Dev. 8:732–744. 91. Zawel, L., and D. Reinberg. 1993. Initiation of transcription by RNA polymerase II: a multi-step process. Prog. Nucleic Acid Res. Mol. Biol. 44:67–108. 92. Zeng, W., D. J. Andrew, L. D. Mathies, M. A. Horner, and M. P. Scott. 1993. Ectopic expression and function of the Antp and Scr homeotic genes: the N terminus of the homeodomain is critical to functional specificity. Development 118:339–352. 93. Zhang, H., and C. Abate. Unpublished data. 94. Zuo, P., D. Stanojevic, J. Colgan, K. Han, M. Levine, and J. L. Manley. 1990. Activation and repression of transcription by the gap proteins hunchback and Kru ¨ppel in cultured Drosophila cells. Genes Dev. 5:254–264.