Transposition of the nematode Caenorhabditis ... - Semantic Scholar

82

Research Paper

Transposition of the nematode Caenorhabditis elegans Tc3 element in the zebrafish Danio rerio Erez Raz*, Henri G.A.M. van Luenen† , Barbara Schaerringer‡, Ronald H.A. Plasterk† and Wolfgang Driever* Background: Transposable elements of the Tc1/mariner family are found in many species of the animal kingdom. It has been suggested that the widespread distribution of this transposon family resulted from horizontal transmission among different species. Results: To test the ability of Tc1/mariner to cross species barriers, as well as to develop molecular genetic tools for studying zebrafish development, we determined the ability of the Tc3 transposon, a member of the Tc1/mariner family, to function in zebrafish. Tc3 transposons carrying sequences encoding the green fluorescent protein (GFP) were able to integrate in the fish genome by transposition. Integrated transposons expressed the GFP marker after germline transmission, and were capable of being mobilized upon introduction of transposase protein in trans.

Addresses: *Department of Developmental Biology, Institute for Biology 1, University of Freiburg, Hauptstrasse 1, D-79104 Freiburg, Germany. †The Netherlands Cancer Institute, Division of Molecular Biology, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands. ‡CVRC Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts 02129, USA. Correspondence: Erez Raz E-mail: [email protected] Received: 4 September 1997 Revised: 20 October 1997 Accepted: 17 November 1997 Published: 12 December 1997

Conclusions: Our findings support models of horizontal transmission of Tc1/mariner elements between species. The work also establishes the basis for a novel method of transposon-mediated genetic transformation and for transposon-mediated genetic screens in zebrafish and other organisms.

Background Members of the Tc1/mariner transposon family are widespread among many species from different phyla such as platyhelminthes, nematodes, arthropods and chordates [1–5]. Interestingly, distantly related species have been shown to carry closely related mariner sequences, whereas more closely related species may contain less conserved elements [1,4,6,7]. These findings are likely to reflect horizontal interspecies transmission of Tc1/mariner transposons during evolution [8,9]. The best characterized elements of this family are the closely related Tc1 and Tc3 transposons of the nematode Caenorhabditis elegans. Molecular cloning of both elements allowed their structure to be determined [10,11], and facilitated detailed functional analyses of the cis and trans requirements for transposition [12–17]. The apparent wide host distribution of Tc1/mariner transposons and the finding that purified transposase can facilitate transposition of Tc1/mariner elements in vitro [14,18] suggest that these elements could promote DNA mobilization in species other than those from which they were originally isolated. Indeed, in a recent report [19], the mariner element from Drosophila has been shown to transpose within the protozoan Leishmania. Such demonstrations of function of specific Tc1/mariner elements in vivo across evolutionarily distant species provide substantial support for models of the horizontal transmission of this class of mobile elements.

Current Biology 1997, 8:82–88 http://biomednet.com/elecref/0960982200800082 © Current Biology Ltd ISSN 0960-9822

short generation time, high fecundity and the optical clarity of its embryos (reviewed in [20]). These properties of the zebrafish have enabled large-scale chemical mutagenesis screens to be performed in which hundreds of developmentally important genes have been mutated ([21,22]; reviewed in [23–25]). An alternative to chemical mutagenesis in zebrafish was made available when it was found that pseudotyped retroviral vectors are able to infect zebrafish cells and that the integrated virus can be transmitted through the germ line [26,27]. Further improvement of the infection efficiency made insertional mutagenesis screens in zebrafish feasible, albeit at a much lower efficiency than that of the chemical mutagenesis screens [28–30]. Virus-mediated mutagenesis provides a tag that facilitates the very rapid cloning of insertionally mutated genes, compared with the more time-consuming effort required to clone chemically induced mutations (reviewed in [31]). Nevertheless, because genes inserted within the proviral genome apparently cannot be expressed after germ-line transmission in zebrafish, genetrapping and enhancer-trapping approaches are currently not possible with this system. Furthermore, insert-size limitations, deletions and rearrangements of the proviral sequence [29] may to some extent limit the usefulness of retroviral vectors for general transgenesis.

Results and discussion The zebrafish Danio rerio has become a popular model system for studying vertebrate development because of its

In this work, we tested the ability of the C. elegans Tc3 transposon to function in zebrafish D. rerio. We constructed

Research Paper Tc3 in zebrafish Raz et al.

a Tc3 transformation vector (pTc3GFP) in which the Xenopus EF1α promoter and the gene encoding the green fluorescent protein (GFP) were cloned between the Tc3 inverted repeats (Figure 1a). One-cell-stage zebrafish embryos were co-injected with the pTc3GFP vector and mRNA encoding the Tc3A transposase that had been transcribed in vitro. The injected fish were raised and their progeny screened by the polymerase chain reaction (PCR) for germ-line transmission of the pTc3GFP DNA. Founder fish whose progeny were identified as being positive for germ-line transmission in the PCR screen were crossed again to wild-type fish and the subsequent progeny were screened for expression of GFP. Of the 40 fish that were co-injected with pTc3GFP and mRNA encoding the Tc3A transposase, three founder fish that transmitted transposon-derived sequences through their germ line were isolated. High levels of non-legitimate integrations of multiple tandem copies, which are frequently not expressed, commonly occur in fish [32–34]. In order to demonstrate that legitimate transposition events had occurred, we identified fish that were positive for transposon sequences but lacked plasmid-derived sequences. Indeed, F1 progeny of one integration (termed 3-2) demonstrated lack of plasmid sequences as determined by both Southern blot analysis (Figure 1b) and PCR (data not shown). Similar analyses of the other two integrations revealed vector sequences in the fish genomic DNA (data not shown). The lack of or the segregation of

83

non-legitimate integrations in the case of the 3-2 integration facilitated further molecular analysis of this line. The original 3-2 transgenic female transmitted the transgene to 7% of its progeny (8 out of 113 embryos expressed GFP) and the transgenic progeny transmitted the transposon in a simple mendelian fashion, typical for a single integration. Next, we went on to determine the molecular nature of the 3-2 integration. The analysis of hundreds of Tc3 integrations in C. elegans has revealed that, in all cases, the transposon integrated into the dinucleotide sequence TA [35]. According to the

(a)

E

pUC18

(b)

E E EF1α GFP unc- Tc3 IR A B 22 WT

3-7 3-2

WT

E pA

pUC18 Tc3 IR unc22

0.5 kb

3-7 3-2

kb

8.75– 3.7– 1.9– 1.4–

Figure 1 Germ-line transformation of zebrafish by a Tc3 transposon. (a) Structure of pTc3GFP. This construct contains the promoter and enhancer of the Xenopus EF1α gene [45] and is followed downstream by coding sequences for GFP (the Ser65→Thr mutant [46]) and an SV40 polyadenylation signal (pA). The expression cassette is flanked by the Tc3 inverted repeats (Tc3 IR 462 base pairs (bp) each) and unc-22 sequences into which the Tc3 transposon transposed in the nematode. Gray boxes, Tc3 sequences internal to the inverted repeats; E, EcoRI sites in the plasmid (pUC18). (b) Lack of pUC18 DNA sequences in transgenic progeny of line 3-2. Southern blot analysis was performed on genomic DNA from wild-type fish (WT), transgenic fish generated by injecting pTc3GFP without any transposase source (line 3-7) and transgenic fish generated by co-injection of pTc3GFP with mRNA encoding Tc3A transposase (line 3-2). Genomic DNA was digested with EcoRI and probed with pUC18 probe (plasmid probe) or with a fragment including the transposon sequences (transposon probe). (c) The Tc3GFP transposon integrates at a TA dinucleotide and leads to target duplication. The DNA flanking the two terminal inverted repeats of the 3-2 integration was cloned by inverse PCR and sequenced. DNA from both line 3-2 and wild-type fish was sequenced. The genomic sequence flanking the transposon revealed a TA dinucleotide sequence on either side of the transposon inverted repeats. The TA nucleotides flanking the transposon represent target duplication when compared with the wild-type sequence. (d) Integration of Tc3GFP as a single copy DNA cassette. Genomic DNA from non-transgenic fish, or line 3-2 fish that were homozygous for the Tc3GFP transposon insertion, was analyzed by PCR using the A–B internal primer pair or primers corresponding to the DNA flanking the transposon (C–D). DNA size markers are in kilobases (kb).

Plasmid probe

Transposon probe

(c) TC3GFP ...TTGTCAACGTACAGTGT... ...ACACTGTATGTCTACAT...

...GGGTGATTGTCAACGTATGTCTACATGTTGTTAA.. (d)

C

Genomic DNA Tc3 IR

A B EF1α GFP

D pA

Tc3 IR Genomic DNA

A–B C–D WT 3-2 WT 3-2 kb 3.6– 1.8– 0.9– 0.4– 0.1– Current Biology

84

Current Biology, Vol 8 No 2

Figure 2 (a)

C

Genomic DNA Tc3 IR

Transposase PCR primers kb 1.86– 0.93– 0.38– 0.12– (b)

A B EF1α GFP pA

D Tc3 IR Genomic DNA

– + + – A–B C–D A–B C–D

0.129

E

pUC18

A B F EF1α GFP pA Tc3 IR uncunc- Tc3 IR 22 22

Transposase

+

PCR primers

pUC18

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

kb 1.86– 0.93– A–B 0.38– 0.12– 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

+

1.86– 0.93– E–F 0.38–

0.816

*

0.12– 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

–

The Tc3GFP transposon can be excised from the zebrafish genome when supplied with the Tc3A transposase. (a) An example of the result of the PCR assay for Tc3GFP excision from the genome. Single haploid embryos of the 3-2 line were injected with transposase mRNA, and 24 h later were subjected to PCR analysis using transposon-specific primers (A–B) or primers corresponding to the DNA flanking the transposon (C–D). The locations of the primers used are designated on the transposon map and the expected 0.129 kb fragment is marked on the gel. (b) Progeny of line 3-7 heterozygous transgenic fish crossed to wild-type fish were injected with transposase RNA, or with Xenopus EF1α RNA (lower two panels). DNA was prepared from individual embryos and subjected to PCR analysis using the A–B or E–F primer pairs. The number above each lane in the gel corresponds to a specific embryo; the product of PCR amplification with the A–B and E–F primer pairs were loaded in the same order in each gel, as indicated. Embryos 2, 3, 6, 7, 8, 10, 11, 13, 16, 18, 19, 24, 25, 27, 29, 30, 31, 32, 34, 38, 39, 41 and 43 carry transposon sequences in their genome, but only those injected with transposase mRNA show the 0.816 kb excision product. PCR with primer pair E–F resulted in background amplification of a smaller fragment (marked *)

1.86– 0.93– A–B 0.38– 0.12– 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

–

1.86– 0.93– E–F 0.38– 0.12–

* Current Biology

model proposed for Tc3 transposition [16], the 3′ hydroxyl group at either end of the transposon attack the phosphate bonds on both strands 5′ of each thymidine of the TA target. Following subsequent DNA repair, a duplication of the TA target is generated. The DNA flanking the transposon inverted repeats in the 3-2 insertion was cloned and sequenced. In order to determine the sequence of the DNA before the integration event, DNA from this region was also cloned and sequenced from non-transgenic fish. The sequence TA was found on both sides of the inverted repeats in line 3-2 (Figure 1c) and represents a duplication of the endogenous TA target. Furthermore, the inverted repeats of the Tc3GFP transposon were intact, implying

legitimate cleavage of the substrate plasmid DNA. These findings demonstrate that the Tc3 transposase can function in zebrafish to facilitate germ-line transformation. The integrity of the transposon and the fact that, in contrast to non-legitimate DNA transformation in zebrafish [32–34], only one copy of the element was integrated, was shown by PCR using primers corresponding to the genomic sequences flanking the transposon (Figure 1d). While the Tc3GFP transposon was able to excise correctly from the plasmid and integrate into the fish genome, horizontal transmission of Tc3 transposons would require that the integrated transposon serve as a substrate for


subsequent jumps. In addition, for many applications other than transgenesis, it is important that the transposition substrate functions as a pre-integrated transposon. For example, insertional mutagenesis and enhancer-trap screens in Drosophila were carried out by mobilization of endogenous P-element transposons [36–39]. Thereafter, reversion of the phenotype by precise excision of the preintegrated element provides evidence linking the observed phenotype to a specific insertion event [36]. Other important potential applications for which mobilization of pre-integrated transposons is required include the generation of deletions by inducing transposon excision and the generation of targeted alterations in endogenous genes by localized induction of DNA repair, as demonstrated in Drosophila and C. elegans [40,41]. As a first step towards achieving the above goals, we examined the possibility of mobilizing Tc3 elements that are integrated in the chromosome, using two lines of fish. Line 3-7 represented a case of nonlegitimate plasmid integration resulting from injection of pTc3GFP with no source of transposase (in this case, the Tc3 transposon was flanked by sequences of the nematode unc-22 gene; Figure 1a). In line 3-2, the Tc3 transposon integrated without any vector sequences, and therefore the inverted repeats were flanked by zebrafish genomic DNA (Figure 1c). Fish heterozygous for the Tc3GFP transgene were in-crossed (for the 3-7 integration), or fertilized in vitro with sperm that had been inactivated by ultraviolet radiation, so as to generate haploid embryos (for the 3-2 integration), and one-cell embryos were injected with transposase mRNA. DNA was prepared from individual 24-hour-old embryos and excision events were detected by PCR using oligonucleotides that anneal to sequences flanking the transposon. Under the PCR conditions used (short elongation period), the large PCR product that includes the full transposon cannot be detected. In cases where the transposon was excised, a smaller PCR product corresponding to the predicted size was observed — 813 bp for the 3-7 line and 126 bp for the 3-2 line. For both lines, excisions were detected in embryos injected with transposase mRNA (9 out of 11 embryos for the 3-2 integration and 30 out of 36 embryos for the 3-7 integration), whereas the transposon was not excised in the non-injected embryos (no excisions detected in 53 control embryos; Figure 2a,b). Thus, the Tc3 transposon was mobilized from its original site in the chromosome when flanked by nematode DNA sequences, as well as when it was flanked by zebrafish genomic DNA. In order to verify that the excision observed was precise, as expected from a transposition event, amplification products of putative excision events were sequenced (Figure 3). Transposons frequently leave small insertions or ‘footprints’ when they excise from a genomic site. In all of the putative excision events, a small footprint was

85

Figure 3 TC3GFP 3-2

TGTCAACGTACAGTGT....

.....ACACTGTATGTCTAC

Transposase or TGTCAACGTACAGTATGTCTAC TGTCAACGTACTGTATGTCTAC

TC3GFP 3-7

AGTCACTACAGTGT....

.....ACACTGTATCAATAT

Transposase or AGTGTCACTACAGTATCAATAT AGTGTCACTACTGTATCAATAT Current Biology

Excision of the Tc3GFP transposon leaves a characteristic footprint. For both lines 3-2 and 3-7 following transposition, the genomic sequence at the excision site was amplified by PCR, cloned and sequenced. The sequences corresponding to the Tc3GFP transposon are boxed (yellow) and the duplicated TA nucleotides are in red in the sequence of the excision product.

found, which consisted of the Tc3 terminal sequence flanked by the duplicated TA dinucleotides, similar to the footprints observed after Tc3 excision in the nematode. Nevertheless, whereas the nematode footprint usually consists of a CA or a GT dinucleotide flanked by the TA nucleotides (resulting from removal of the two protruding nucleotides from one side during repair of the doublestrand break), the common footprint observed in zebrafish included the three terminal nucleotides (CAG or CTG were found in four and seven independent excision events, respectively) flanked by the TA duplicated sequence. The explanation that we favor for the distinct footprint observed in zebrafish is that it reflects a difference between the zebrafish and the nematode in the way in which the double-strand DNA breaks are repaired. It is possible that, in zebrafish, only one base is frequently removed from one side, compared with the removal of two, which is the usual case in the nematode. Alternatively, in zebrafish, the Tc3A transposase may generate three protruding nucleotides at the end of the transposon instead of the two formed in the nematode case. Although we cannot rule out the second possibility, we consider it less likely for the following reasons. First, the Tc3A transposase has been shown to generate a 2 bp overhang in the nematode during excision events. In order for DNA cleavage activity to be altered, some species-specific molecule would have to interact with the transposase; no evidence for such an interaction is present for Tc1/mariner transposases, some of which have been shown to function in vitro. Second, although in the majority of the cases the footprint of Tc3 excisions in C. elegans includes only two terminal bases from the inverted repeat, footprints of three bases and other footprints have also been found, all of which can be explained by slight differences in exonuclease activity. We therefore favor the explanation that

86


Figure 4 The GFP marker flanked by Tc3 inverted repeats continues to be expressed after three generations of germ-line transmission. Wildtype (a–c) and transgenic embryos of line 3-7 (d–f) and line 3-2 (g–j) at different stages of development were visualized with a fluorescein filter set. Before completion of epiboly (a,d,g), GFP was expressed uniformly in the transgenic animals (note that, under the conditions used, the yolk was autofluorescent). Later, at the 21-somite stage (b,e,h), expression was weak overall in embryos of both the 3-2 and 3-7 lines; stronger expression was seen in anterior parts of the nervous system, in the eyes and, in the case of the 3-2 line, in the somites. At day 2 of development (c,f,i), uniform weak expression of GFP was observed in the 3-7 line with residual higher expression in the eye. The 3-2 line continued to express high levels of GFP with higher levels observed in the eye, in the midbrain and in muscle. Line 3-2 continued to express GFP after 5 days of development with very high levels in the eye (j).

differences in the double-strand repair process between the nematode and the zebrafish are responsible for the different footprints. We have thus far shown that the nematode Tc3 elements (that is, the Tc3 inverted repeats) can function in a vertebrate system when supplied with the transposase in trans. These findings support models of horizontal transfer of Tc1/mariner elements between species. In nature, however, for the transposon to survive stochastic loss and vertical inactivation [42], the transposase should be expressed from within the mobile element. In addition, it is crucial to demonstrate that DNA sequences flanked by the transposon inverted repeats are expressed, in order to assess the usefulness of Tc3 transposon technology to enhancer-trap or gene-trap screens in zebrafish and of Tc3 transposons as transformation vectors. We therefore incorporated the gene encoding GFP downstream of the Xenopus EF1α promoter in our transformation vector to allow us to examine this point. Transgenic fish from both the legitimate (3-2) and non-legitimate (3-7) lines expressed GFP after three generations of germ-line

transmission (Figure 4). GFP expression in both the 3-2 and 3-7 lines of transgenic fish was first observed at 60–70% epiboly (Figure 4d,g). At day 1 of development, both lines still showed GFP expression (Figure 4e,h), but fluorescence in the 3-7 line was significantly lower by day 2 (Figure 4f,i). Whereas expression in the 3-7 line faded with age, in a similar way to that previously described for non-legitimate EF1αGFP transgenic lines [43], strong GFP expression was still detected in line 3-2 after five days of development (Figure 4j). In addition, whereas the 3-2 line showed constant levels of GFP expression through the three generations, the 3-7 integration showed a reduction in the intensity of GFP expression in the F2 and F3 generations. Thus, in contrast with virusmediated transgenesis, DNA sequences cloned into the Tc3 transposon can be expressed after germ-line transmission. This observation paves the way for expressionbased transposon screens in zebrafish, as well as for transposon-mediated gene transfer. The ability to deliver a single copy of DNA that will be expressed after germ-line transmission is an important


improvement over the existing options for gene delivery in fish, especially considering that up to 40 kb of DNA can be delivered by the Tc3 transposon with little effect on transposition efficiency (H.G.A.M.v.L. and R.H.A.P., unpublished observations). This property of the transposon stands out when compared with the stringent sequence and size limitations of retroviral vectors. In this study, we have demonstrated that Tc1/mariner elements can function across wide evolutionary gaps. Transgenesis may be further improved by optimizing the concentrations of transposase and target plasmids and by generating fish lines expressing the Tc3A transposase under the control of germ-line-specific promoters. By crossing such ‘jump starter’ fish with fish carrying multiple chromosomal transposons, we will be able to evaluate the potential of this system for gene-trap screens in zebrafish. The excision of chromosomal transposon sequences is the first example of inducible manipulation of the fish genome. Use of Tc3 elements should allow the inducible removal of DNA sequences from integrated constructs, in a similar way to the Cre–lox system in mice [44].

Conclusions In this work, we show that the Tc3 transposons from C. elegans can be used as transformation vectors in zebrafish; they are likely to function in other vertebrate model systems as well. Our findings support models suggesting horizontal transmission as the basis for the abundance of Tc1/mariner elements throughout the animal kingdom.

Materials and methods Embryo injection A solution containing 25 ng/ml pTc3GFP DNA and 50 ng/ml in vitro transcribed capped mRNA (mMessage mMachine, Ambion) encoding Tc3A transposase was injected into one-cell-stage TL embryos. The injection solution included 0.1% phenol red (Gibco) and an approximate volume of 5 nl of the solution was injected.

DNA preparation and PCR analysis For detection of transgenic founder fish, genomic DNA was prepared from pools of 24 h old F1 progeny. The DNA was amplified using primers specific for the transposon (Figure 1a). Primer A was 5′-GATGTCATGGTTAATCCCCG-3′. Primer B was 5′-TGGAACAGGTAGCTTCCCAG3′. The cycling conditions were: an initial 2 min denaturation step at 94°C followed by 35 cycles of 94°C for 45 sec, 58°C for 1 min and 72°C for 1 min. The duration of the extension step was increased by 3 sec after each cycle. For detection of excision events of integrated transposons, two lines were used, 3-2 and 3-7. In the case of the 3-7 transgene, the small PCR product was detected only if the transposon was excised. In the case of the 3-2 integration, a fragment close in size to that of the expected excision product was always amplified from the non-transgenic chromosome. For this reason, haploid embryos were used in this case. Excision was determined only in diploid (37) or haploid (3-2) individuals in which transposon sequences were detected by PCR using the A and B primers. The PCR primers homologous to the genomic sequences flanking the 3-2 insertion were 5′-CTGTGTGTTTTAGCGGGTGA-3′ (primer C) and 5′CGACTTAGCAATGCCCTAGC-3′ (primer D), and for the 3-7 integration were 5′-GTGCTGCAAGGCGATTAAGT-3′ (primer E) and 5′-TGTGGAATTGTGAGCGGATA-3′ (primer F).

87

For the long-template PCR, the expand long-template PCR system 3 (Boehringer Mannheim) was used. Cycling conditions were: an initial 2 min denaturation step at 94°C followed by 10 cycles of 94°C for 10 sec, 57°C for 30 sec, 68°C for 3 min and 20 cycles of 94°C for 10 sec, 58°C for 30 sec, 68°C for 4 min (the duration of this extension step was increased by 20 sec after each cycle).

Acknowledgements We thank Michael Artinger, Ajay Chitnis and Michal Reichman for comments on the manuscript. This work was supported by grants IBN-9317469 (NSF), RO1-HD29761-05 (NIHCD) and the University of Freiburg to W.D. E.R. was supported by a Human Frontiers Science Program fellowship. R.H.A.P. and H.G.A.M.v.L. are supported by grant 5 RO1 RR10082 (NIH NCRR) and by a PIONIFR grant of the Netherlands Organization for Scientific Research (NWO).

References 1. Garcia-Fernàndez J, Marfany G, Baguñà J, Saló E: Infiltration of mariner elements. Nature 1993, 364:109-110. 2. Radice AD, Bugaj B, Fitch DH, Emmons SW: Widespread occurrence of the Tc1 transposon family: Tc1-like transposons from teleost fish. Mol Gen Genet 1994, 244:606-612. 3. Robertson HM: The Tc1-mariner superfamily of transposons in animals. J Insect Physiol 1995, 44:99-105. 4. Ivics Z, Izsvák Z, Minter A, Hackett PB: Identification of functional domains and evolution of Tc1-like transposable elements. Proc Natl Acad Sci USA 1996 93:5008-5013. 5. Oosumi T, Belknap WR, Garlick B: Mariner transposons in humans. Nature 1995, 378:672. 6. Robertson HM: The mariner transposable element is widespread in insects. Nature 1993, 362:241-245. 7. Maruyama K, Hartl DL: Evidence for interspecific transfer of the transposable element mariner between Drosophila and Zaprionus. J Mol Evol 1991, 33:514-524. 8. Hurst GD, Hurst LD, Majerus ME: Selfish genes move sideways. Nature 1992, 356:659-660. 9. Kidwell MG: Voyage of an ancient mariner. Nature 1993, 362:202. 10. Rosenzweig B, Liao LW, Hirsh D: Sequence of the C. elegans transposable element Tc1. Nucleic Acid Res 1983, 11:4201-4210. 11. Collins J, Forbes E, Anderson P: The Tc3 family of transposable genetic elements in Caenorhabditis elegans. Genetics 1989, 121:47-55. 12. Vos JC, van Luenen HGAM, Plasterk RH: Characterization of the Caenorhabditis elegans Tc1 transposase in vivo and in vitro. Genes Dev. 1993, 7:1244-1253. 13. Vos JC, Plasterk RH: Tc1 transposase of Caenorhabditis elegans is an endonuclease with a bipartite DNA binding domain. EMBO J 1994, 13:6125-6132. 14. Vos JC, De Baere I, Plasterk RH: Transposase is the only nematode protein required for in vitro transposition of Tc1. Genes Dev 1996, 10:755-761. 15. van Luenen HGAM, Colloms SD, Plasterk RH: Mobilization of quiet, endogenous Tc3 transposons of Caenorhabditis elegans by forced expression of Tc3 transposase. EMBO J 1993, 12:25132520. 16. van Luenen HGAM, Colloms SD, Plasterk RH: The mechanism of transposition of Tc3 in C. elegans. Cell 1994, 79:293-301. 17. Colloms SD, van Luenen HGAM, Plasterk RH: DNA binding activities of the Caenorhabditis elegans Tc3 transposase. Nucleic Acid Res 1994, 22:5548-5554. 18. Lampe DJ, Churchill ME, Robertson HM: A purified mariner transposase is sufficient to mediate transposition in vitro. EMBO J 1996, 15:5470 -5479. 19. Gueiros-Filho FJ, Beverley SM: Trans-kingdom transposition of the Drosophila element mariner within the protozoan Leishmania. Science 1997, 276:1716-1719. 20. Kimmel CB: Genetics and early development of zebrafish. Trends Genet 1989, 5:283-288. 21. Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, et al.: The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 1996, 123:1-36. 22. Driever W, Solnica-Krezel L, Schier AF, Neuhauss SCF, Malicki J, Stemple DL, et al.: A genetic screen for mutations affecting embryogenesis in zebrafish Development 1996, 123:37-46.

88


23. Eisen JS: Zebrafish make a big splash. Cell 1996, 87:969-977. 24. Roush W: A new embryo zoo. Science 1996, 274:1608-1609. 25. Holder N, McMahon A: Genes from zebrafish screens. Nature 1996, 384:515-516. 26. Burns JC, Friedmann T, Driever W, Burrascano M, Yee JK: Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: Concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc Natl Acad Sci USA 1993, 90:8033-8037. 27. Lin S, Gaiano N, Culp P, Burns JC, Friedmann T, Yee JK, et al.: Integration and germ-line transmission of a pseudotyped retroviral vector in zebrafish. Science 1994, 265:666-669. 28. Gaiano N, Amsterdam A, Kawakami K, Allende M, Becker T, Hopkins N, et al.: Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 1996, 383:829-832. 29. Gaiano N, Allende M, Amsterdam A, Kawakami K, Hopkins N: Highly efficient germ-line transmission of proviral insertions in zebrafish Proc Natl Acad Sci USA 1996, 93:7777-7782. 30. Schier AF, Joyner A, Lehmann R, Talbot WS: From screens to genes: prospects for insertional mutagenesis in zebrafish. Genes Dev 1996, 10:3077-3080. 31. Postlethwait JH, Talbot WS: Zebrafish genomics: from mutants to genes.Trends Genet 1997, 13:183-190. 32. Stuart GW, Vielkind JR, McMurray JV, Westerfield M: Stable lines of transgenic zebrafish exhibit reproducible patterns of transgene expression. Development 1990, 109:577-584. 33. Culp P, Nusslein-Volhard C, Hopkins N: High-frequency germ-line transmission of plasmid DNA sequences injected into fertilized zebrafish eggs. Proc Natl Acad Sci USA 1991, 88:7953-7957. 34. Bayer T, Campos-Ortega J: A transgene containing lacZ is expressed in primary sensory neurons in zebrafish. Development 1992, 115:421-426. 35. van Luenen HGAM, Plasterk RH: Target site choice of the related transposable elements Tc1 and Tc3 of Caenorhabditis elegans. Nucleic Acids Res 1994, 22:262-269. 36. Cooley L, Kelley R, Spradling A: Insertional mutagenesis of the Drosophila genome with single P elements. Science 1988, 239: 1121-1128. 37. Bier E, Vaessin H, Shepherd S, Lee K, McCall K, Barbel S, et al.: Searching for pattern and mutation in the Drosophila genome with a P-lacZ vector. Genes Dev 1989, 3:1273-1287. 38. Bellen HJ, O'Kane CJ, Wilson C, Grossniklaus U, Pearson RK, Gehring WJ: P-element-mediated enhancer detection: a versatile method to study development in Drosophila. Genes Dev 1989, 3:1288-1300. 39. Wilson C, Pearson RK, Bellen HJ, O’Kane CJ, Grossniklaus U, Gehring WJ: P-element-mediated enhancer detection: an efficient method for isolating and characterizing developmentally regulated genes in Drosophila. Genes Dev 1989, 3:1301-1313. 40. Gloor GB, Nassif NA, Johnson-Schlitz DM, Preston CR, Engels WR: Targeted gene replacement in Drosophila via P element-induced gap repair. Nature 1991, 253:1110-1117. 41. Plasterk RH, Groenen JT: Targeted alterations of the Caenorhabditis elegans genome by transgene instructed DNA double strand break repair following Tc1 excision. EMBO J 1992, 11:287-290. 42. Hartl DL, Lozovskaya ER, Nurminsky DI, Lohe AR: What restricts the activity of mariner-like transposable elements? Trends Genet 1997, 13:197-201. 43. Amsterdam A, Lin S, Hopkins N: The Aequorea victoria green fluorescent protein can be used as a reporter in live zebrafish embryos. Dev Biol 1995, 171:123-129. 44. Sauer B, Henderson N: Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci USA 1988, 85:5166-5170. 45. Heim R, Cubitt AB, Tsien RY: Improved green fluorescence. Nature 1995, 373:663-664. 46. Johnson AD, Krieg PA: pXex, a vector for efficient expresion of cloned sequences in Xenopus embryos. Gene 1994, 147:223-226.

Because Current Biology operates a ‘Continuous Publication System’ for Research Papers, this paper has been published on the internet before being printed. The paper can be accessed from http://biomednet.com/cbiology/cub — for further information, see the explanation on the contents page.