Tricalcium phosphate solubilisation by new ...

Tricalcium phosphate solubilisation by new endophyte Bacillus methylotrophicus CKAM isolated from apple root endosphere and its plant growth-promoting activities Preeti Mehta, Abhishek Walia, Nitin Kakkar & C. K. Shirkot

Acta Physiologiae Plantarum ISSN 0137-5881 Acta Physiol Plant DOI 10.1007/s11738-014-1581-1

1 23

Your article is protected by copyright and all rights are held exclusively by Franciszek Górski Institute of Plant Physiology, Polish Academy of Sciences, Kraków. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.

1 23

Author's personal copy Acta Physiol Plant DOI 10.1007/s11738-014-1581-1

ORIGINAL PAPER

Tricalcium phosphate solubilisation by new endophyte Bacillus methylotrophicus CKAM isolated from apple root endosphere and its plant growth-promoting activities Preeti Mehta • Abhishek Walia • Nitin Kakkar C. K. Shirkot

•

Received: 6 February 2014 / Accepted: 7 May 2014 Ó Franciszek Go´rski Institute of Plant Physiology, Polish Academy of Sciences, Krako´w 2014

Abstract Bacillus methylotrophicus CKAM obtained from root endosphere of healthy apple trees was selected on the basis of higher P-solubilisation (687 mg/L), nitrogenase activity (237.6 gmole C2H4 h-1mg-1 protein), IAA (34 lg/mL), siderophore unit (96.4 %) and antifungal activity against F. oxysporum (88.22 %), Phytophthora sp. (70.00 %), D. necatrix (61.73 %), S. rolfsii (44.54 %) and P. aphanidermatum (62.56 %). We investigated the ability of isolate CKAM to solubilise insoluble P via two possible mechanisms: proton excretion by ammonium assimilation and organic acid production. There were no clear differences in pH and P-solubilisation between glucose–ammonium and glucose–nitrate media. P-solubilisation was significantly promoted with glucose compared with fructose. HPLC study showed that isolate CKAM produced

Communicated by A. Krolicka.

mainly gluconic and oxalic acids with small amounts of 2-ketogluconic, formic acids. During the culture, the pH was reduced with increase in gluconic acid concentration and was inversely correlated with soluble P concentration. Analysis of antifungal compounds involved in their antagonistic activity showed that isolate CKAM produced chitinase, proteases, pectinase and the antibiotic lipopeptides surfactin, fengycin and iturin A. It was notable that isolate CKAM exhibited highest protection against S. rolfsii (58 %) followed by F. oxysporum (54.5 %), D. necatrix (52.7 %), P. aphanidermatum (36.3 %) and Phytophthora sp. (21.8 %) in biocontrol trials using the pathosystem tomato. Remarkable increase was observed in seed germination (27.07 %), shoot length (42.33 %) root length (52.6 %), shoot dry weight (62.01 %) and root dry weight (45.7 %) of tomato under net house condition. Isolate CKAM possessed traits related to plant growth promotion, therefore, could be a potential candidate for the development of biofertiliser or biocontrol agent.

P. Mehta (&) DBT-IOC Centre for Advance Bioenergy Research, Research and Development Centre, Indian Oil Corporation Limited, Sector-13, 121 007, Faridabad 110067, New Delhi, India e-mail: [email protected]

Keywords Bacillus methylotrophicus Apple Insoluble phosphate solubilisation Plant growth promotion Antifungal metabolites

A. Walia Forensic Science Laboratory, Sector-14, Rohini 110085, India e-mail: [email protected]

Introduction

N. Kakkar Analytical Department, Jubilant Chemsys Limited, B-34 Sector-58, Noida 20130, India e-mail: [email protected] C. K. Shirkot Department of Basic Sciences, Dr. Y. S. Parmar University of Horticulture and Forestry, Nauni, Solan 173230, Himachal Pradesh, India e-mail: [email protected]

The beneficial plant–microbes interactions in the rhizosphere are determinants of plant health and soil fertility (Jeffries et al. 2003). For sustainable agriculture production, these interactions play a pivotal role in transformation, mobilisation, solubilisation, etc. from a limited nutrient pool in the soil and subsequent uptake of essential plant nutrients by the plants to realise full genetic potential of the crops. Phosphorus is one of the major essential

123

Author's personal copy Acta Physiol Plant

macronutrients for biological growth and for proper plant development. Soils are generally low in P readily available for plant growth. Therefore, a large quantity of soluble forms of P fertilizer is applied to achieve maximum plant productivity. However, the applied P fertilizers are easily precipitated into insoluble forms—CaHPO4, Ca3(PO4)2, FePO4 and AlPO4–, and are not efficiently taken up by the plants, which lead to an excess application of P fertilizer to crop land (Omar, 1998). Overfertilisation of P leads to pollution due to soil erosion and run-off water containing large amounts of soluble P. Furthermore, use of P fertilizers has become a costly affair, and there is a need for alternative sources (Del Campillo et al. 1999). Some micro-organisms are known to be involved in the solubilisation of insoluble P (Vassilev et al. 2006). The application of plant growth-promoting rhizobacteria (PGPR) including phosphate-solubilising bacteria (PSB) as crop inoculants for biofertilisation, phytostimulation and biocontrol would be an attractive alternative to decrease the use of chemical fertilizers which also effect environmental pollution (Ali et al. 2010). PGPRs may stimulate host plant growth: (1) directly, by increasing nutrient and water uptake, thus enhancing plant biomass, through the production of phytohormones, siderophores, organic acids involved in P-solubilisation or the fixation of atmospheric nitrogen; and (2) indirectly, by producing secondary metabolites (such as antibiotics and hydrogen cyanide) that inhibit soil pathogens or by synthesising cell wall-degrading enzymes of phytopathogens or by competing for colonisation sites, nutrients, etc. (Bakthavatchalu et al. 2012). Bacteria belonging to the genera Bacillus are considered to be safe micro-organisms and hold the remarkable abilities of synthesising a vast array of beneficial substances for agronomical and industrial purposes (Stein 2005) and producing endospores, which warrant the prevalence of Bacillus under different environmental cues, its long-term storage and easy development of reliable formulations (Collins and Jacobsen 2003). Many of these bacilli are soilinhabiting bacteria and exist as epiphytes or endophytes (McSpadden Gardener 2004) in environments as diverse as spermosphere, Brassica leaves or compost and may provide plants with protection against pathogen attacks by a blend of diverse modes of action (Romero et al. 2004a, b; Cazorla et al. 2007a, b). These features have led to the increased devising and implementation of antimicrobial active biological products based on Bacillus species or their metabolites as alternative or supplementary methods to chemicals for plant disease control (Ongena et al. 2005). The success of biocontrol strategies will depend to a large extent on the seeking and selection process of potential biological agents, which consider the pathogen to be the target and the cropping system. Recently, we have reported on the isolation of Bacillus sp. which is able to solubilise

123

insoluble P and to inhibit mycelial growth of phytopathogenic fungi (Mehta et al. 2010; Walia et al. 2013). Following this, we attempted to improve the ability of this strain to solubilise insoluble P under shaking culture conditions (Mehta et al. 2013). At present, no studies on P-solubilisation by Bacillus methylotrophicus CKAM isolated from apple and its P-solubilisation mechanism were performed. In this work, we investigated the capability of B. methylotrophicus CKAM to solubilise in vitro insoluble P via two possible mechanisms: proton extrusion by ammonium assimilation and production of organic acids. We also investigated the potential of B. methylotrophicus CKAM as biocontrol agent against soil-borne phytopathogenic fungi and producing plant growth-promoting activities, i.e. indoleacetic acid (IAA), siderophore, hydrogen cyanide (HCN) and enzyme activities such as chitinase, pectinase and protease. Therefore, the main aim of this study was to evaluate the ability to produce plant growth-promoting metabolites by the new isolate Bacillus methylotrophicus CKAM isolated from apple endorhizosphere under in vitro condition, along with changes in the early stages of tomato seedlings growth after inoculation with B. methylotrophicus CKAM under net house.

Materials and methods Isolation and characterisation of endophytic P-solubilising rhizobacteria Nineteen endophytic P-solubilising rhizobacteria were obtained from 20 healthy apple roots of 20-year-old trees collected from five apple orchards located in Shimla, Himachal Pradesh, India, at an altitude of 2,135 m above mean sea level. Briefly, roots were sampled at a distance of 1 m from the trunk and 10 cm from the soil surface. The root samples were gently shaken to remove loosely adhering soil, aseptically transferred to storage bags, then maintained on ice for transportation and kept at -80 °C until processing. Twenty root samples were washed twice in tap water, weighed and homogenised in a laboratory blender for 3 min with 10 mL of sterile phosphate-buffered saline per gram of fresh root material. Bacterial counts were determined by serial dilutions and plated onto nutrient agar amended with cycloheximide (100 lg mL-1) to prevent fungal growth, after 48 or 72 h of incubation at 30 °C. A potential isolates were screened and selected on the basis of halo zone produced in Pikovskaya’s (PVK) agar. Bacillus-like colonies were roughly identified on the basis of their morphology and Gram reaction (Powers 1995). Among 19 P-solubilising endophytes, CKAM which had marked P-solubilising activity on PVK agar/broth and also showed maximum effectiveness of multifarious plant


Dematophora necatrix

61.73 ± 2.89

Fusarium oxysporum

88.22 ± 1.89

Phytophthora sp.

70.00 ± 2.09

sequences, PCRs were carried out in 20 lL reaction buffer containing *50 ng template DNA, 20 pmol of each primer forward (50 -GCAAGTCGAGCGGACAGATGGGAGC-30 ) and reverse primer (50 - AACTCTCGTGGTGTGACGGGC GGTG-30 ), 0.2 mM dNTPs and 1 U Taq polymerase (MP Biomedicals, Santa Ana, CA) in 19 PCR buffer. PCR was carried out as follows: 35 cycles at 94 °C for 30 s, 58 °C for 30 s, 72 °C for 1 min 30 s, followed by final extension at 72 °C for 10 min. The PCR products were analysed on a 1 % agarose gel in 19 TAE buffer, run at 100 V for 1 h. Gels were stained with ethidium bromide and photographed. Amplified PCR products were eluted from the gel using a gel extraction kit (RealGenomics Hi Yield TM Gel/ PCR DNA Extraction Kit); the eluted fragment was then sequenced using PCR primers. Based on 1,375-bp-long 16S rRNA gene sequences, phylogenetically related bacteria were aligned using a BLAST search (Altschul et al. 1997) against the GenBank database. Multiple alignments with sequences of related taxa of the genus Bacillus were implemented using CLUSTAL W. A neighbour-joining phylogenetic tree was constructed using PHYLIP version 3.6. The topology of the phylogenetic tree was evaluated by the bootstrap resampling method of Felsenstein (Felsenstein 1985) with 1,000 replicates. The NCBI GenBank accession number for the isolate is KC287219.

Sclerotium rolfsii Phythium aphanidermatum

44.54 ± 2.01 62.56 ± 3.01

P-solubilisation and organic acid production

Table 1 Plant growth-promoting attributes of isolate CKAM after 72 h of incubation PGP attribute

Activity

Phosphate solubilisation index (PSI)

2.4 ± 1.12

TCP solubilisation (mg/L)

687 ± 3.2

Nitrogenase activity (gmol C2H4 h-1 mg-1 protein)

237.6 ± 3.1

Nitrogen fixation (mg/ha per day)

94.0 ± 4.32

IAA production (lg/mL)

34.0 ± 2.00

Siderophore production Zone (mm) Siderophore units (%)

18.20 ± 1.15 96.4 ± 2.19

Chitinase activity Zone (mm)

35.00 ± 2.11

Chitinase enzyme indexa

8.75 ± 1.34

Protease activity Zone (mm)

13.00 ± 2.21

Protease enzyme index

3.40 ± 1.49

Pectinase activity Zone (mm)

24.00 ± 1.89

Pectinase enzyme index

2.18 ± 2.03

Antagonistic activity (%) against

Lipopeptides production Fengycin

?

Iturin

?

Surfactin

?

± Standard deviation a A/B, where A = diameter (colony ? halo zone); B = diameter colony values are the mean of three replicates

growth-promoting attributes, and broad spectrum of antagonistic activity against common soil-borne phytopathogenic fungi (Table 1) was subjected to further identification according to phenotypic and physiological tests using API 20NE (BioMerieux, France), BIOLOGTM (Biolog Inc., California, USA) systems, whole-cell fatty acids methyl ester (FAME) and 16S rDNA sequence analysis. The isolate was identified based on whole-cell fatty acids, derivatised to methyl esters and analysed by gas chromatography using the Sherlock Microbial Identification System (MIS-MIDI, USA). The FAME profiles were compared with the TSBA50 aerobe library general system software version 5.0. Qualitative and quantitative differences in the fatty acid profiles were used to compute the distance for each strain relative to the strains in the library (Sasser and Wichman 1991). To obtain 16S rDNA

Isolates were first screened on PVK agar plates. The P-solubilisation was exhibited with a clear zone formed around the colony. Further quantitative estimation of phosphorus was done in PVK broth amended with 5.0 g/L tricalcium phosphate (TCP) by the vanadomolybdate method (Sundara Rao and Sinha 1963). To study the mechanism of P-solubilisation, B .methylotrophicus CKAM was grown in the PVK broth supplemented with different combinations of 1.5 % (w/v) carbon source (glucose or fructose) and 0.05 % (w/v) nitrogen source (NH4Cl, (NH4)2SO4, KNO3 or NaNO3). For the analysis of organic acids, bacterial culture was filtrated through 0.2-lm filter (Millipore, GTBP) and 20 ll of filtrates were injected to HPLC (Waters 996 HPLC) equipped with photodiode array detector. The organic acid separation was carried out on RP-18 column (Merck, Germany) with 0.1 % orthophosphoric acid (Merck, Germany) as mobile phase. Retention time of each signal was recorded at a wavelength of 210 nm and compared with the standard acids. Production of indole acetic acid (IAA), ACC deaminase and nitrogenase activity For the production of auxins, each isolate was grown in Luria–Bertani broth (amended with 5 mM L-tryptophan,

123


0.065 % sodium dodecyl sulphate and 1 % glycerol) for 72 h at 37°C under shake conditions. Colorimetric estimation of IAA-like auxins was done using Salkowski reagent (Glick 1995). ACC deaminase activity of the isolate was assessed by quantifying ammonia liberated by the hydrolysis of ACC. ACC deaminase activity was detected on plates with DF minimal medium containing 1-aminocyclopropane-1-carboxylate as the sole source of nitrogen (Penrose and Glick 2003). Nitrogen fixation of isolate was determined in nitrogen-free medium by the acetylene reduction assay (Hardy et al. 1968). Siderophore, hydrocyanic acid and antifungal metabolites production Siderophore activity was determined on Chrome-Azurol S (CAS) medium. CAS plates were spot-inoculated with bacterial strains and observed for development of orange halo against dark blue background around the colonies after 48 h of incubation at 28 °C. A change in colour from blue to orange (hydroxamate-type siderophore) or purple (catechol-type siderophore) was considered as a positive reaction. The production of siderophore in cell-free culture supernatant was determined using spectrophotometric method as described by Schwyn and Neilands (Schwyn and Neilands 1987). HCN production was inferred by the qualitative method of Baker and Schipper (Baker and Schippers 1987). The change in the colour of the filter paper previously dipped in 2 % sodium carbonate prepared in 0.05 % picric acid from yellow to dark brown was rated visually depending on the intensity of the colour change. The rhizobacterial isolate was tested for their ability to inhibit the growth of diverse soil-borne fungal pathogens using the in vitro dual-culture analysis (Romero et al. 2004a, b). A plug of 0.6 cm diameter containing mycelium taken from 5-day-old target fungi was placed at the centre of PDA plates, and single bacterial colonies were patched at a distance of about 3 cm from the fungus. Plates were incubated for 5 days at 25 °C, and inhibition of fungal growth was monitored by recording the diameter of the inhibition zone (mm). The antifungal activity of cell-free supernatants of the selected isolate was evaluated against the target fungi Fusarium oxysporum, Phytophthora sp., Dematophora necatrix, Sclerotium rolfsii and Phythium aphanidermatum using the in vitro test described elsewhere (Romero et al. 2007). Bacteria were grown on PVK at 37 °C, and after 3 days of incubation, cells were removed by centrifugation at 2,500 g for 15 min. Thereafter, the supernatants were extracted with n-butanol, and once the organic phase had evaporated, the remaining residue was dissolved in sterile distilled water. The antifungal activity was finally evaluated using the dual-culture analysis

123

described before, but the bacterial colony was replaced with the antagonistic solution. Production of hydrolytic enzymes and lipopeptides Chitinase activity was tested on LB plates, with the respective substrate added (chitin 0.5 %). Pectinase and protease activities were checked on the media described by Kumar et al. (2005). Aliquots of bacterial culture (10 lL), grown overnight in LB broth, were spot-inoculated onto plates. Plates were incubated for 2–8 days at 30 °C, and formation of a clear zone around the bacterial growth spot was considered as a positive result for enzyme activity. Bacterial culture was grown in PVK for 3 days at 37 °C. Cell-free supernatant was obtained by centrifugation at 2,500 g for 15 min and then extracted with n-butanol. Once n-butanol layers were evaporated to dryness under a vacuum, the residues were dissolved in methanol and fractionated by TLC using purified standards of iturin A, fengycin and surfactin lipopeptides (Romero et al. 2007). Biocontrol assays against tomato root rot Biocontrol trials in the pathosystem tomato/F. oxysporum, Phytophthora sp., D. necatrix, S. rolfsii and P. aphanidermatum were set up as previously described (Cazorla et al. 2007a, b). A third part of 8-day-old PDA plate cultures of tested fungi was homogenised and inoculated in 1-L Erlenmeyer flasks containing 200 mL of Czapek–Dox medium. After growth for 4 days at 28 °C under aeration (110 rev min-1), the fungal material was placed on top of sterile glass wool, and the filtrate was adjusted to 5 9 105 spores mL-1. For soil inoculation, spore suspensions were mixed thoroughly with potting soil to a final concentration of 2 9 106 spores kg-1. Tomato (Solanum lycopersicum L.) seeds were coated with bacteria by dipping the seeds in a mixture of 1 % (w/v) methylcellulose (Sigma, St. Louis, MO, USA) and 109 CFU mL-1 bacteria in PBS buffer. Coated seeds were dried in a sterile stream of air. One seed was sown in each pot of approximately 1.5 cm depth and containing 25 g of soil. Ten sets of 10 plants each were included in each treatment. Seedlings were grown in a greenhouse at 24 °C with 70 % relative humidity and 16 h daylight and were watered from the bottom. The number of diseased plants was determined when a considerable fraction of untreated plants (above 60 %) used as control showed symptoms, usually 18 days after sowing. Plants were removed from the soil and washed, and the plant roots were examined for tomato crown and root rot symptoms. Roots without any disease symptoms were designated as healthy.

Author's personal copy Acta Physiol Plant Table 2 Morphological, biochemical and physiological characterisation of Bacillus sp. CKAM

Morphological characteristics Colony morphology

Creamish white, round wavy, convex rough surface

Grams reaction/cell shape/cell size

?/rods/long

Spore shape/position Physiological characteristics

Oval/central

Growth in NaCl at concentration (2.5–8.5 %)

?

Growth at different temperature (20–40 °C)

?

Growth at different pH (5.5–9.5)

?

Biochemical tests/carbohydrates utilisation Catalase

?

Fructose

?

Erythritol

–

Malonate

–

Dextrose

?

a-Methyl-D-glucoside

?

Voges Proskauer’s

?

Galactose

–

Rhamnose

–

Citrate utilisation

?

Raffinose

–

Cellobiose

–

?

Trehalose

–

Melezitose

?

?

Melibiose

–

?

ONPG

Arginine dihydrolase

–

Sucrose

–

a-Methyl-Dmannoside Xylitol

Hydrogen sulphide production

1

Mannose

–

D-Arabinose

–

Gelatin hydrolysis

?

Inulin

?

Sorbose

–

Starch hydrolysis

?

Sodium glucanate

–

Adonitol

–

Casein decomposition

–

Glycerol

?

Nitrate reduction

Indole production

–

Salicin

?

Esculin hydrolysis

?

Dulcitol

–

? Tested positive/utilised as substrate

Tyrosine utilisation

?

Inositol

–

Lactose

–

Sorbitol

–

- Tested negative/not utilised as substrate

Xylose

?

Arabitol

–

Efficacy of B. methylotrophicus CKAM on plant growth promotion The plant growth promotion ability of the isolate was conducted using tomato seedlings in sterile soil under net house conditions. Soil obtained was sieved through 2-mm sieve and used for pot culture experiment. The sand, soil and farmyard manure was mixed in a ratio of 1:1:1 in order to make the potting mixture. The mixture was then filled in the pots and moistened to one-third saturation capacity. Twenty-five seeds treated or untreated with cell suspension of 1.5 OD were sown at equidistance and covered with moss grass till emergence of plumule. After 3–4 days of seedlings emergence, thinning was done and three plants per pot were maintained. Six replicated pots per treatment with three plants in each pot were placed in a randomized block design in net house. After 2 months, % germination, vigour index and seedling traits were studied (Jackson 1973). The vigour index was calculated using the following formula (Abdul Babi and Anderson 1973): Vigour index ¼ ðmean root length þ mean shoot lengthÞ germination ð%Þ: Germination energy index was computed using the formula:

–

GEI ¼

A1 þ ðA1 þ A2Þ þ ðA1 þ A2 þ A3Þ þ þ ðA1 þ . . . þ AaÞ 100 Nþn

where A1, A2 and A3 are number of seeds newly germinated up to nth day, respectively, N is total number of seeds used for treatment, and n is number of days of observations. Statistical analysis Data were statistically analysed by analysis of variance using the general linear model developed by the SAS Institute (version 9.1; Cary, NC), and means were compared using the least significant difference (LSD) method; P B 0.05 was considered significant.

Results Isolation and characterisation of the bacterial isolate Nineteen endophytic PSBs were isolated from root endosphere of apple trees from five different sites of location Shimla, Himachal Pradesh, and were screened for in vitro

123


Fig. 1 Neighbour-joining phylogenetic dendogram based on 16SrRNA sequences showing relationships between isolate CKAM (sample E) and related taxa. Only the bootstrap percentages higher than 50 % are shown at branching points

P-solubilising activity and PGPTs. Among nineteen PSBs, isolate CKAM showed high P-solubilisation, broad antagonistic activity against soil-borne fungal pathogens and production of multifarious plant growth-promoting attributes in tandem (Table 1). Isolate CKAM was Grampositive, motile rods, round colony configuration having rough surface, convex elevation and wavy margin and creamish white in colour. The isolate was positive for catalase, Voges Proskauer’s reaction, citrate utilisation, ONPG, nitrate reduction, a-methyl-D-glucoside, a-methylD-mannoside, melezitose, gelatin hydrolysis, starch hydrolysis, tyrosine and esculin hydrolysis and could utilise dextrose, fructose, inulin, xylose, glycerol and salicin as sole carbon source (Table 2). The isolate was able to grow up to 8.5 % NaCl between 20 and 40 °C at pH 5.5–9.5.

123

The taxonomic characterisations of strain CKAM were identified using both conventional physiologic and biochemical tests, the Biolog system and FAME analysis. All of the taxonomic characterisations indicated that strain CKAM is closely related to Bacillus methylotrophicus. An appropriate Biolog microplate was used for further determination of relative utilisation capacity of 95 different substrates by strain CKAM (data not shown). The reaction profiles of strain CKAM were found to be most similar to those of B. methylotrophicus with 99 % comparability and 0.87 of the similarity index according to the Biolog system identification. The phylogenetic tree (Fig. 1), isolate CKAM (sample E) clustered closely (99 %) with B. methylotrophicus (JQ023625) with high (99 %) boot strap value which is consistent with the physiologic and biochemical tests, Biolog system characterisation and FAME


analysis. The fatty acids Iso-C14:0, C14:0, Iso-C15:1F, Iso-C15:0, Anteiso-C15:0, C16:1 w7c alcohol, Iso-C16:0, Iso-C17:0, Sum in Feature 3*, C16:0, Iso-C 17:1 w10c, Sum in Feature 4** and C16:1 w11c were present in the isolate (Table 3). The analysis showed the highest similarity of the isolate with B. methylotrophicus as per MIDI system (Microbial Identification System, Inc.). Effect of carbon and nitrogen sources on insoluble P-solubilisation The results (Table 4) show the effect of carbon and nitrogen sources on insoluble P-solubilisation. Regardless of the nitrogen sources used, B. methylotrophicus CKAM was able to solubilise insoluble P using glucose as the sole carbon source. In all cases, insoluble P-solubilisation was accompanied by distinct pH decrease to pH 4.6–4.87. Thus, the solubilisation of insoluble P by B. methylotrophicus

Table 3 Cellular fatty acid composition of Bacillus sp. CKAM Fatty acids

Composition (%)

Iso-C14:0

2.22

C14:0

1.35

Iso-C15:1F

0.76

Iso-C15:0

55.57

Anteiso-C15:0

4.22

C16:1 w7c alcohol

0.92

Iso-C16:0

2.86

C16:1 w11c

11.21

Sum in feature 3*

5.19

C16:0

5.22

Iso-C 17:1 w10c Sum in feature 4**

5.09 2.11

Iso-C17:0

3.29

Strain CKAM is showing similarity with Bacillus methylotrophicus as per MIDI * Summed Feature 3 comprised 16:1 w7c/15 iso 2OH ** Summed Feature 4 comprised 17:1 ISO I/ANTEI B which could not be resolved by MIDI

CKAM was associated with a drop in the pH of the culture medium. Cell growth was higher when ammonium salts (6.81–6.83 log CFU/mL) were used as the nitrogen source as compared to nitrate salts (6.56–6.76 log CFU/mL), respectively. On the other hand, B. methylotrophicus CKAM would solubilise less insoluble P using fructose as the sole carbon source irrespective of the nitrogen sources. The growth of B. methylotrophicus CKAM in the presence of fructose was less to that in the presence of glucose, and the range of the pH of the culture medium varied from 5.45 to 5.94. It was also observed that there was no clear relationship between insoluble P-solubilisation and cell growth. Relationships among pH, organic acid production and P-solubilisation In order to study the relationships between pH, organic acid production and insoluble P-solubilisation, we grew B. methylotrophicus CKAM in the PVK medium containing 1.5 % (w/v) glucose and 0.05 % (w/v) (NH4)2SO4. The organic acids were identified by HPLC in the cultural filtrates after 3 days of incubation. As shown in Fig. 2, HPLC analysis of the culture filtrate revealed eight peaks. Among them, four major peaks were identified as oxalic acid, gluconic acid, formic acid and 2-ketogluconic acid by comparing the retention times with those of standards. By integration of the peak heights, the amounts of oxalic acid, gluconic acid, formic acid and 2-ketogluconic acid were estimated to be 1,907, 4,313, 1,058 and 1,565 mg L-1, respectively. The time courses of pH, soluble P and organic acid in the PVK broth with 1.5 % (w/v) glucose and 0.05 % (w/v) (NH4)2SO4 are shown in Fig. 3. The concentration of gluconic acid in the culture medium increased substantially from 813 mg L-1 at 24 h to 6,769 mg L-1 at 120 h and remained relatively constant thereafter. The culture pH decreased from 6.5 to 4.5 during the period of the linear increase of gluconic acid. P-solubilisation also increased with increase of culture time, reaching a maximum (687 mg/L) at 72 h. On the other hand, oxalic acid, formic

Table 4 Effect of carbon and nitrogen sources on tricalcium phosphate solubilisation of B. methylotrophicus CKAM (NH4)2SO4

NH4Cl

KNO3

NaNO3

(NH4)2SO4

NH4Cl

KNO3

NaNO3

Viable count (log CFU/ mL)

6.83 ± 1.16

6.81 ± 1.08

6.56 ± 1.12

6.76 ± 1.36

6.08 ± 1.19

6.06 ± 2.13

5.56 ± 2.08

5.98 ± 1.81

Final pHa

4.60 ± 0.16

4.75 ± 0.08

4.90 ± 0.12

4.87 ± 0.03

5.62 ± 0.19

5.45 ± 0.13

5.78 ± 0.08

5.94 ± 0.21

Soluble P (mg L-1)

687 ± 2.51

684 ± 2.87

650 ± 3.01

634 ± 3.21

285 ± 2.98

298 ± 2.15

267 ± 3.24

259 ± 2.87

a

Initial pH of the PVK broth is 6.5

Values are the mean of three replicates ± Standard deviation

123


Soluble P (mg/l)

6.5

700

6

600

5.5

500

5

400

4.5

300

4

200

3.5

100

3

0

Final pH

Final pH

Soluble P (mg/l) 800

2.5 0

24

48

72

96

120

144

Incubaton time (h) Gluconic acid formic acid

oxalic acid 2-keto-gluconic acid

8000

organic acid (mg/l)

7000 6000 5000 4000 3000 2000 1000 0 0

Fig. 2 HPLC chromatograms of standard organic acids (a) and culture supernatant of B. methylotrophicus CKAM grown for 3 days in PVK broth (b). OA oxalic acid, GA gluconic acid, FA formic acid, ICA iso citric acid, LA lactic acid, 2-KGA 2-ketogluconic acid

acid and 2-ketogluconic acid concentrations increased gradually as the cultivation time was increased up to 96 days, when it reached about 2,589, 1,479 and 2,062 mg L-1, respectively. Identification of antifungal compounds produced by B. methylotrophicus CKAM B. methylotrophicus CKAM was analysed for their ability to produce hydrolytic enzymes. Isolate exhibited protease, chitinase and pectinase activity (Table 1). In order to evaluate the involvement of other putative antimicrobial compounds in their suppressive effect, the antifungal activity of cell-free supernatant from B. methylotrophicus CKAM was analysed. To do this, we looked for inhibition of the growth of F. oxysporum, Phytophthora sp., D. necatrix, S. rolfsii and P. aphanidermatum in the plate assay. Antagonistic suspension obtained from butanolic extracts of the B. methylotrophicus CKAM cell-free filtrates was able to inhibit the growth of five target fungi (Table 1). In an attempt to identify the putative antifungal compounds occurring in B. methylotrophicus CKAM supernatant, methanolic fraction derived from the butanolic extract of cell-free culture filtrate of the B. methylotrophicus CKAM

123

24

48

72

96

120

144

Incubaton time (h)

Fig. 3 Changes in pH, soluble phosphate and organic acid (b) mediated by B. methylotrophicus CKAM in culture medium containing 1.5 % (w/v) glucose and 0.05 % (w/v) (NH4)2SO4

was initially separated in silica TLC plates, using purified iturin A, fengycin and surfactin as standards. The B. methylotrophicus CKAM strain produced spots with Rf values similar to fengycin (Rf = 0.09), surfactin (Rf = 0.7) and iturin A (Rf = 0.3). Relationship between TCP solubilisation (Y) and final pH (X1), IAA (X2), % siderophore unit (X3), % growth inhibition against F. oxysporum, Phytophthora sp., D. necatrix, S. rolfsii, P. aphanidermatum (X4) in PVK medium. To know the overall impact of P-solubilisation (Y) on final pH (X1), IAA (X2), % siderophore unit (X3) and % growth inhibition (X4) against tested fungal pathogens (F. oxysporum, Phytophthora sp., D. necatrix, S. rolfsii and P. aphanidermatum), a nonlinear regression analysis was carried out. It was found that rYX1, rYX2, rYX3 and rYX4 were significant at 5 % level of significance. To find out the probable value of P-solubilisation (Y) for given value of final pH (X1), IAA (X2), % siderophore unit (X3) and % growth inhibition against tested fungal pathogens (X4), the data obtained on the variable were subjected to the fitting of various mathematical functions, viz., linear, quadratic, cubic, power and inverse functions. On the basis of observed and expected frequencies and finally on the basis


Fig. 4 Relationship between phosphate solubilisation and final pH (a); IAA production (b); per cent (%) siderophore unit (c); and per cent (%) growth inhibition of tested fungal pathogens (d)

of r2 values, it was observed that power function in all the cases gave the best fit. The fitted regression equations along with standard error (SE) of regression coefficients and r2 values have been presented below. Their graphical representations have also been shown in Fig. 4. 1. 2. 3. 4.

Y = 59. 78 X-4.35 ; r2 = - 0.96 (SE of the 1 coefficient = 0.270) Y = 87.75 X2 0.876; r2 = 0.82 (SE of the coefficient = 0.280) Y = 13.78 X3 0.234; r2 = 0.86 (SE of the coefficient = 0.167) Y = 37.68 X4 0.876; r2 = 0.78 (SE of the coefficient = 0.215)

regression regression

These fitted regression lines can be successfully employed to work out the value of P-solubilisation for a given value of final pH, IAA, % siderophore unit and % growth inhibition against inhibition against tested fungal pathogens, and hence, these regression lines can be regarded as an estimation equation. Biocontrol activity of B. methylotrophicus CKAM against soil-borne fungal pathogens

regression regression

B. methylotrophicus CKAM was tested for their biocontrol ability in the pathosystem tomato/F. oxysporum, Phytophthora sp., D. necatrix, S.rolfsii and P. aphanidermatum. As

123


disease incidence (21.8 %) was found in plants infested with Phytophthora sp.

Diseased plants (%)

90 80 70

Plant growth-promoting potential

60 50 40 30

Fig. 5 Biocontrol of tomato foot/root rot caused by F. oxysporum, Phytophthora sp., D. necatrix, S.rolfsii and P. aphanidermatum. Tomato seedlings were scored as healthy or diseased 21 days after bacterization. Control was used without culture. Data were analysed for significance after arc sine square root transformation with analysis of variance, followed by Fisher’s least significant difference test (P = 0.05). Each value represents the mean of five replicates, and the error bars represent the standard deviations of the average

Table 5 Effect of inoculation of Bacillus methylotrophicus CKAM on tomato seedlings after 60 days of sowing Treatments

Control

Germination (%) Germination energy index Vigour index

68.67 ± 1.20 288.33 ± 4.41 1,706.67 ± 12.02

B. methylotrophicus CKAM

CD0.05

87.23 ± 1.45 426.33 ± 7.27

4.18 20.23

2,375 ± 16.07

57.21

Root length (cm)

7.25 ± 0.05

11.07 ± 0.12

1.03

Shoot length (cm)

18.92 ± 0.06

26.93 ± 0.05

0.17

Root dry weight (g)

0.70 ± 0.03

1.02 ± 0.06

0.12

Shoot dry weight (g)

3.08 ± 0.05

4.99 ± 0.13

0.09

Values are means of three replicates of three independent experiments Control was used without culture ± Standard deviation

shown in Fig. 5, 85, 76, 71, 81 and 73 % of untreated plants were diseased after 16 days of growth in soil infested with F. oxysporum, Phytophthora sp., D. necatrix, S.rolfsii and P. aphanidermatum, respectively. Treatment of tomato seeds with cells of B. methylotrophicus CKAM induced a significant reduction in the percentage of diseased plants (around 21–58 %) in comparison with the nonbacterized plants. It was notable that the B. methylotrophicus CKAM exhibited highest protection against fungal pathogen S. rolfsii (58 %) followed by F.oxysporum (54.5 %), D. necatrix (52.7 %) and P. aphanidermatum (36.3 %), respectively. Minimum reduction in per cent

123

The plant growth promotion potential of B. methylotrophicus CKAM was determined in tomato seeds. A significant influence on growth was resulted with treatment of B. methylotrophicus CKAM in tomato seedlings grown in pots under net house conditions (Table 5). Higher per cent germination (87.23 %), germination energy index (426.33) and vigour index (2,375) were recorded for seeds treated with isolate CKAM which was significantly higher than that of untreated seeds. It was observed that the bacterized seedlings recorded 52.6 and 42.33 % higher root and shoot lengths, respectively, compared to uninoculated control. Seed bacterization resulted in greater enhancement of the root growth, as compared to the shoot growth. Increase in shoot dry weight (62.01 %) and root dry weight (45.7 %) was also observed.

Discussion The present investigation is the first report on the P-solubilisation and plant growth-promoting potential of B. methylotrophicus CKAM native to Shimla location of Himachal Pradesh region, isolated from apple rhizosphere root. The rhizosphere of healthy apple trees present in areas affected by soil-borne phytopathogenic fungi could represent a feasible and useful source for isolation of microorganisms with promising antagonistic ability. The in vitro pre-screening test of PGPTs allowed us to select isolate CKAM with noticeable plant growth-promoting attributes including antifungal activity against D. necatrix and other soil-borne phytopathogenic fungi (Table 1). The identity of the isolate in the present investigation was arrived on the basis of biochemical characterisation, FAME and sequencing of rRNA gene analysis. The phylogenetic analysis further reinforced its taxonomic position. BLASTn search of 16S rRNA sequences in the GenBank database indicated that isolate CKAM is closely related to B. methylotrophicus JQ023625 with 99 % homology. Plant growth is often limited by insufficient phosphate availability. The low solubility of common phosphates such as Ca3(PO4)2, hydroxyapatite and aluminium phosphate causes low phosphate availability in agricultural soil. In the present investigation, the isolated bacterium CKAM had a marked insoluble P-solubilising activity as visualised by the clear zone developed around the colony after 3-day incubation at 30 °C. We assayed for the mineral phosphatesolubilising trait of B. methylotrophicus CKAM in liquid culture that contained known amounts of TCP and


analytically measured the levels of P in the medium at different time interval (Fig. 3). The amount of released P in the medium showed a gradual increase and reached a concentration of 687 mgL-1 at 72 h of incubation. Concomitant with the P increase, there was a drastic decrease in the pH of the medium with the bulk of the change occurring during 24 h of growth (Fig. 3a). The pH value dropped to 4.5 from an initial value of 6.5. Regression analysis (Fig. 4a) values showed that strong negative correlation between pH and P-solubilised (r = -0.96) in the present study is similar to negative correlation between pH and P-solubilised. This observation is consistent with earlier reports, which have shown that the solubilisation of mineral phosphate is accompanied by a decrease in pH (Chen et al. 2006; Chatli Anshu et al. 2008). The production of organic acids and their chelation capacity have been implicated as the major mechanism in the solubilisation of inorganic phosphates by micro-organisms (Park et al. 2009). HPLC analysis showed that B. methylotrophicus CKAM produced mainly gluconic and oxalic acids with small amounts of 2-ketogluconic and formic in culture medium containing glucose (Fig. 2). Quantitative analysis also showed that the concentration of soluble P in culture medium was increased with time, and the pH showed a drastic drop (Fig. 3a). In particular, the insoluble P-solubilisation by B. methylotrophicus CKAM was proportional to gluconic acid production. The simultaneous production of different organic acids by B. methylotrophicus CKAM may enhance their potential for solubilising insoluble P. B. methylotrophicus CKAM having a high ability in solubilising insoluble P was used to examine P-solubilisation mechanism. In this study, B. methylotrophicus CKAM would solubilise more insoluble P using glucose as the sole carbon source as compared to fructose (Table 4). On the other hand, it was reported that Citrobacter sp. DHRSS shows P-solubilising activity when provided with fructose as the carbon source (Patel et al. 2008). Park et al. (2009) have also reported the use of fructose and glucose for P-solubilising activity of P. fluorescens and found it to be best on glucose. There were reports that the use of ammonium salt as a nitrogen source produces acid by a proton exchange mechanism (Park et al. 2009). Roos and Luckner (1984) reported that the difference in pH between the ammonium and nitrate media was to be primarily due to the uptake of ammonium ion in the ammonium medium. Contrary to these reports, in the presence of glucose, we observed ammonium and nitrate to be equally effective for insoluble P-solubilisation (Table 4). Though high cell growth was observed in the presence of fructose, B. methylotrophicus CKAM could solubilise less P in the presence or absence of ammonium in media. Thus, our results suggest that proton extrusion by ammonium assimilation is probably of less importance for

P-solubilisation, or another mechanism is involved for P-solubilisation. B. methylotrophicus CKAM produced a wide range of secondary metabolites including siderophore, HCN and IAA and showed potential efficacy not only in antagonizing phytopathogenic fungi but also in inducing plant growth (Table 1). The present study reveals the highly significant positive correlation between P-solubilisation and concomitant production of IAA (r = 0.82) (Fig. 4b), siderophore (r = 0.86) (Fig. 4c) and antagonistic activity against D. necatrix (r = 0.78) (Fig. 4d) which is in agreement with previous study reported by Mehta et al. (2010). Isolate had a broad antagonistic activity which helps in establishing and resisting against deleterious micro-organisms occupying the microbial niche in the rhizosphere (Fig. 5). Further siderophore production and antimicrobials released by the isolate reflect their rhizospheric competitiveness that can be beneficially combined with plant protection and its PGPR traits help the enhanced plant growth. Isolate produced halo zones on LB containing chitin and skim milk agar which indicated B. methylotrophicus CKAM produced different cell wall hydrolytic enzymes (chitinase, pectinase and protease as well as antibiotic lipopeptides, mainly surfactin, iturin and fengycin (Table 1). Lipopeptides represent a group of compounds with relatively low molecular weight that are synthesised in a nonribosomal manner and exhibit amphiphilic features that have engaged attention because of their surfactant and antimicrobial activities. Genes for lipopeptides are common to multiple biocontrol strains that have been commercialised and that genomes with such genes have an enhanced capacity to produce antibiotics that inhibit the growth of fungal root pathogens (Joshi and McSpadden Gardener 2006; Cazorla et al. 2007a, b). Under net house conditions, seedlings raised from seeds treated with isolate CKAM resulted in root length (11.07 cm), root dry weight (1.02 g), shoot length (26.93 cm) and shoot dry weight (4.99 g), which were significantly higher than seedlings raised from uninoculated seeds. A significant increase in % germination in net house from 68.67 to 87.23 % when seeds were treated with isolate CKAM clearly indicates the possible direct effect of seed treatment on germination of tomato seeds in soil. This increase may have been caused by nitrogen fixation and P-solubilisation ability of PGPR. Increased nutrient uptake associated with seed treated plants may be the result of more root–shoot ratio resulting in enhanced nutrition because of seed treatment with bacteria (Kumar et al. 2013). In conclusion, the present study is the first report on B. methylotrophicus strain CKAM isolated from the endorhizosphere of apple showing P-solubilisation, N2 fixation,

123


IAA, siderophore, HCN and biocontrol traits against the soil-borne phytopathogenic fungi F. oxysporum, Phytophthora sp., D. necatrix, S. rolfsii and P. aphanidermatum. Because of the innate potential of producing siderophore, IAA, HCN and fungal antibiosis, B. methylotrophicus CKAM could also be used as a potential biofertiliser as well as a potential biocontrol agent. The good results obtained in vitro cannot always be dependably reproduced under field conditions. Further evaluation of B. methylotrophicus CKAM on soil–plant system is needed to uncover their efficacy as effective plant growth-promoting bacterium. Although antibiosis seems to be the strategy involved in their biocontrol activity, further analysis of their modes of action is currently being undertaken in order to improve their use and implementation under real culture conditions. Production of antibiotics may provide a competitive edge to this strain in rhizosphere. Identification of genes for secondary metabolism and plant growth promotion will open up the avenues for further manipulation of this strain. Author contribution All authors have significantly and equally contributed towards the completion of this research work and for the preparation of manuscript in timely. Author Preeti Mehta has done sampling of soil and roots of apple trees from four different regions, isolation and characterisation of isolates for plant growth-promoting traits, phenotypic and physiological tests using API 20NE, BIOLOGTM systems, glass house trials, 16S rDNA sequence analysis and statistical analysis. Author Abhishek Walia has done biocontrol assays against tomato root rot under glass house as well as helped me in collecting the data regarding seedling traits and in preparing manuscript. Author Nitin Kakkar has done FAME analysis for identification of isolate and HPLC for the detection of organic acids. Author CK Shirkot is my mentor and conceived idea regarding this work. He guided me in completing this work successfully as a part of my Ph.D. programme as well as in writing the manuscript. Acknowledgments The authors would like to thank ICAR (AINP on Soil Biodiversity & Biofertilizer), New Delhi, India, for providing the financial support.

References Abdul Babi AA, Anderson JD (1973) Vigour determination in soyabean seed by multiple criteria. Crop Sci 13:630–633 Ali B, Sabri AN, Hasnain S (2010) Rhizobacterial potential to alter auxin content and growth of Vigna radiata (L.). World J Microbiol Biotechnol 26:1379–1384 Altschul SF, Thomas LM, Alejandro AS, Jinghui Z (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389–3402 Baker AW, Schippers B (1987) Microbial cyanide production in the rhizosphere in relation to potato yield reduction and

123

Pseudomonas spp. mediated plant growth stimulation. Soil Biol Biochem 19:451–457 Bakthavatchalu S, Shivakumar S, Sullia SB (2012) Identification of multi-trait PGPR isolates and evaluation of their potential as biocontrol agents. Acta Biologica Indica 1:61–67 Cazorla FM, Romero D, Garcıa Perez A, Lugtenberg BJJ, de Vicente, Bloemberg G (2007a) Isolation and characterization of antagonistic Bacillus subtilis strains from the avocado rhizoplane displaying biocontrol activity. J Appl Microbiol 103:1950–1959 Cazorla FM, Romero D, Garcia AP, Lugtenberg BJJ, Vincente A, Bloemberg G (2007b) Isolation and characterization of antagonistic B. subtilis strains from the avocado rhizoplane displaying biocontrol activity. J Appl Microbiol 103:1950–1959 Chatli Anshu S, Beri V, Sidhu BS (2008) Isolation and characterisation of phosphate solubilizing microorganisms from the cold desert habitat of Salix alba Linn. in trans Himalayan region of Himachal Pradesh. Indian J Microbiol 48:267–273 Chen YP, Rekha PD, Arun AB, Shen FT, Lai WA (2006) Phosphate solubilizing bacteria from subtropical soil and their tri-calcium phosphate solubilizing abilities. Appl Soil Ecol 34:33–41 Collins DP, Jacobsen BJ (2003) Optimizing a Bacillus subtilis isolate for biological control of sugar beet cercospora leaf spot. Biol Control 26:153–161 Del Campillo SE, Van der Zee S, Torrent J (1999) Modeling longterm phosphorus leaching and changes in phosphorus fertility in excessively fertilized acid sandy soils. Eur J Soil Sci 50:391–399 Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791 Glick BR (1995) The enhancement of plant growth by free living bacteria. Can J Microbiol 41:109–117 Hardy RWF, Holsten RD, Jacken EK (1968) The acetylene ethylene assay for N2- fixation-laboratory and field evaluation. Plant Physiol 43:118–127 Jackson ML (1973) Soil chemical analysis. Prentice Hall, New Delhi, pp 49–95 Jeffries S, Gianinazzi S, Perotto S, Turnau K, Barea JM (2003) The contribution of arbuscular mycorhizal fungi in sustainable maintenance of plant health and soil fertility. Biol Fertil Soils 37:1–16 Joshi R, McSpadden Gardener B (2006) Identification of genes associated with pathogen inhibition in different strains B. subtilis. Phytopathol 96:145–154 Kumar RS, Ayyadurai N, Pandiaraja P, Reddy AV, Venkateswarlu Y, Sakthivel OPN (2005) Characterization of antifungal metabolite produced by a new strain Pseudomonas aeruginosa PUPa3 that exhibits broad-spectrum antifungal activity and biofertilizing traits. J Appl Microbiol 98:145–154 Kumar D, Shivay YS, Dhar S, Kumar C, Prasad R (2013) Rhizospheric flora and the influence of agronomic practices on them—a review. Proc Natl Acad Sci India 83:1–14 McSpadden Gardener BB (2004) Ecology of Bacillus and Paenibacillus spp. in agricultural systems. Phytopathol 94:1252–1258 Mehta P, Chauhan A, Mahajan R, Mahajan PK, Shirkot CK (2010) Strain of Bacillus circulans isolated from apple rhizosphere showing plant growth promoting potential. Curr Sci 98:538–542 Mehta P, Walia A, Chauhan A, Shirkot CK (2013) Phosphate solubilization and plant growth promoting potential by stress tolerant Bacillus sp. isolated from rhizosphere of apple orchards in trans Himalayan region of Himachal Pradesh. Ann Appl Biol 163:430–443 Omar SA (1998) The role of rock-phosphate-solubilizing fungi and vesicular-arbuscular-mycorrhiza (VAM) in growth of wheat plants fertilized with rock phosphate. World J Microbiol Biotechnol 14:211–218 Ongena M, Jacques P, Toure Y, Destain J, Jabrane A, Thonart P (2005) Involvement of fengycin-type lipopeptides in the

Author's personal copy Acta Physiol Plant multifaceted biocontrol potential of Bacillus subtilis. Appl Microbiol Biotechnol 69:29–38 Park KH, Lee CY, Son HJ (2009) Mechanism of insoluble phosphate solubilization by Pseudomonas fluorescens RAF15 isolated from ginseng rhizosphere and its plant growth promoting activities. Lett Appl Microbiol 49:222–228 Patel DK, Archana G, Kumar GN (2008) Variation in the nature of organic acid secretion and mineral phosphate solubilization by Citrobacter sp. DHRSS in the presence of different sugars. Curr Microbiol 56:168–174 Penrose DM, Glick BR (2003) Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria. Physiol Plant 118:10–15 Powers EM (1995) Efficacy of the Ryu nonstaining KOH technique for rapidly determining gram reactions of foodborne and waterborne bacteria and yeast. Appl Environ Microbiol 61:3758–3765 Romero D, Perez-Garcia A, Rivera ME, Cazorla FM, de Vicente A (2004a) Isolation and evaluation of antagonistic bacteria towards the curcurbit powdery mildew fungus Podosphaera fusca. Appl Microbiol Biotechnol 64:263–269 Romero D, Perez-Garcia A, Rivera ME, Cazorla FM, de Vicente A (2004b) Isolation and evaluation of antagonistic bacteria towards the curcurbit powdery mildew fungus Podosphaera fusca. Appl Microbiol Biotechnol 64:263–269 Romero D, de Vicente A, Rakotoaly RV, Dufour SE, Veening JW, Arrebola E, Cazorla FM, Kuipers OP (2007) The iturin and

fengycin families of lipopeptides are key factors in antagonism of Bacillus subtilis towards Podosphaera fusca. Mol Plant Microbe Interact 20:430–440 Roos W, Luckner M (1984) Relationships between protonextrusion and fluxes of ammonium ions and organic acid in Penicillium cyclopium. J Gen Microbiol 130:1007–1014 Sasser M, Wichman MD (1991) Identification of microorganisms through use of gas chromatography and high-performance liquid chromatography. In: Balows A, Hausler WJ, Herrman KL, Isenberg HD, Shadomy HJ (eds) Manual of clinical microbiology. American Society for Microbiology, Washington, DC Schwyn B, Neilands JB (1987) Universal chemical assay for the detection and determination of siderophores. Anal Biochem 160:47–56 Stein T (2005) Bacillus subtilis antibiotics: structures, syntheses and specific functions. Mol Microbiol 56:845–857 Sundara Rao WVB, Sinha MK (1963) Phosphate dissolving microorganisms in the soil and rhizosphere. Indian J Agric Sci 33:272–278 Vassilev N, Vassileva M, Nikolaeva I (2006) Simultaneous P-solubilizing and biocontrol activity of microorganisms: potentials and future trends. Appl Microbiol Biotechnol 71:137–144 Walia A, Mehta P, Chauhan A, Shirkot CK (2013) Effect of Bacillus subtilis strain CKT1 as inoculum on growth of tomato seedlings under net house conditions. Proc Natl Acad Sci India. doi:10. 1007/s40011-013-0189-3

123