VEGETOS
Vol. 25 (2) : 207-217 (2012)
Development of Species Specific Markers For Detection of Trichoderma Species T Prameela Devi*, N. Prabhakaran, Deeba Kamil, Jyoti Lekha Borah and Pankaj Pandey Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi-110 012, India
A set of 72 Trichoderma isolates from India were morphologically and molecularly characterized and confirmed as Trichoderma virens, T. harzianum, T. longibrachiatum and T. asperellum. ITS1 and ITS2 regions were amplified using universal ITS primers. The amplicon size varied from 550 to 600 bp in the isolates studied. Cluster analysis based on amplicon sequence of ITS region could not clearly differentiate the Trichoderma species into distinct group. Thus tef1 was used for differentiating the Trichoderma sp. The sequence analysis based on tef1 gene primers could differentiate T. longibrachiatum, T. virens, T. harzianum and T. asperellum species and the phylogenetic analyses were in conformity with the morphological observations. Species specific tef1primer sets T1F/T1R and T2F/T2R were designed for T. virens and T. longibrachiatum isolates respectively and validated against other species of Trichoderma. T1F/T1R specifically amplified in T. virens giving fragment size of 330 bp and T2F/T2R gave amplification of 452 bp only in T. longibrachiatum. Key Words: Trichoderma, ITS, tef1, primer Received: July 3, 2012 Revised: October 28, 2012
INTRODUCTION The anamorphic fungal genus Trichoderma (Hypocreales, Ascomycota) is frequently found in soil and decaying wood ( Samuels 1996). This genus comprises a major portion of the total fungal biomass (Nelson1982). The genus Trichoderma includes many species which have great economic importance. Some of the species produce industrial enzymes (Kubicek and Penttila 1998) and antibiotics (Sivasithamparam and Ghisalberti 1998), and are also potential biocontrol agents against plant pathogens (Hjeljord and Tronsmo 1998). More recently, species in section Longibrachiatum was identified as opportunistic pathogens of immuno-compromised mammals including humans (Kredics et al. 2003). Several species are commonly present as indoor contaminants (Thrane et al. 2001). Identification of an organism or a species, however, is * Corresponding author Email :
[email protected]
Accepted: November 17, 2012
an important part of systematics. Seifert et al. (2007) have rightly stated that the correct identification of a species leads to its correct biology (viz., ecological roles, physiological and biochemical properties) and its societal risks or benefits. However, due to the homoplasy of characters used, morphological determination of taxa is difficult even for experts. The traditional methods for identifying Trichoderma isolates include various culture techniques, mycelial growth rate and colony appearance, as well as microscopic morphological features including phialides and spores (Rifai 1969 and Bissett 1984, 1991a, 1991b, 1991c, 1992). However, morphology-centric identification systems, like any other components of systematics, have limitations. A few taxonomists can critically identify less than 0.01% of the estimated 10-15 million species (Hebert et al. 2004). Hebert and coworkers (2003a, 2003b) listed four limitations: 1) incorrect 207
T Prameela Devi et al. Table 1. List of Trichoderma isolates included in this study Culture Code
Species
NCBI Gene Bank accession numbers ITS and ITS 2
tef1
V1
T. virens
HM046562
JN039090
V2
T. virens
HM046563
JN039091
V3
T. virens
HM046564
JN039092
V4
T. virens
HM046559
JN039093
V5
T. virens
HM046560
JN039094
V6
T. virens
HM046561
JN039095
V7
T. virens
JN039040
JN039096
V8
T. virens
JN039041
JN039097
V9
T. virens
JN039042
JN039098
V10
T. virens
JN039043
-
V11
T. virens
JN039044
-
Tv1
T. aspereelum
JN104481
JN104496
Tv2
T. asperellum
JN104482
JN104497
Tv3
T. asperellum
JN104483
JN104498
Tv4
T. asperellum
JN104484
JN104499
Tv5
T. asperellum
JN104485
JN104500
Tv6
T. asperellum
JN104486
JN104501
Tv7
T. asperellum
JN104487
JN104502
Tv8
T. asperellum
JN104488
JN104503
Tv9
T. asperellum
JN104489
JN104504
Tv10
T. asperellum
JN104490
JN104505
Tv11
T. asperellum
JN104491
JN104506
Tv12
T. asperellum
JN104492
JN104507
Tv13
T. asperellum
JN104493
JN104508
Tv14
T. asperellum
JN104494
JN104509
Tv15
T. asperellum
JN104495
JN104510
Th1
T. harzianum
JN039045
JN039099
Th2
T. harzianum
JN039046
JN0390100
Th3
T. harzianum
JN039047
JN0390101
Th4
T. harzianum
JN039048
JN0390102
Th5
T. harzianum
--
JN0390103
Th6
T. harzianum
JN039049
JN0390104
Th7
T. harzianum
JN039050
JN0390105 208
Development of Species Specific Markers For Detection of Trichoderma Species Th8
T. harzianum
JN039051
JN0390106
Th9
T. harzianum
JN039052
JN0390107
Th10
T. harzianum
JN039053
JN0390108
Th11
T. harzianum
JN039054
JN0390109
Th12
T. harzianum
JN039055
JN0390110
Th13
T. harzianum
JN039056
JN0390111
Th14
T. harzianum
JN039057
JN0390112
Tp1
T. longibrachiatum
JN039058
JN0390113
Tp2
T. longibrachiatum
JN039059
JN0390114
Tp3
T. longibrachiatum
JN039060
JN0390115
Tp4
T. longibrachiatum
JN039061
JN0390116
Tp5
T. longibrachiatum
JN039062
JN0390117
Tp6
T. longibrachiatum
JN039063
JN0390118
Tp7
T. longibrachiatum
JN039064
JN0390119
Tp8
T. longibrachiatum
JN039065
JN0390120
Tp9
T. longibrachiatum
JN039066
JN0390121
Tp10
T. longibrachiatum
JN039067
JN0390122
Tp11
T. longibrachiatum
JN039068
JN0390123
Tp12
T. longibrachiatum
JN039069
-
Tp13
T. longibrachiatum
JN039070
JN0390124
Tp14
T. longibrachiatum
JN039071
-
Tp15
T. longibrachiatum
JN039072
JN0390125
Tp16
T. longibrachiatum
JN039073
JN0390126
Tp17
T. longibrachiatum
JN039074
JN0390127
Tl1
T. longibrachiatum
JN039075
JN0390128
Tl2
T. longibrachiatum
JN039076
-
Tl3
T. longibrachiatum
JN039077
-
Tl4
T. longibrachiatum
JN039078
Tl5
T. longibrachiatum
JN039079
JN0390129
Tl6
T. longibrachiatum
JN039080
-
Tl7
T. longibrachiatum
JN039081
-
Tl8
T. longibrachiatum
JN039082
JN0390130
Tl9
T. longibrachiatum
JN039083
JN0390131
Tl10
T. longibrachiatum
JN039084
JN0390132
Tl11
T. longibrachiatum
JN039085
JN0390133
Tl12
T. longibrachiatum
JN039086
-
Tl13
T. longibrachiatum
JN039087
JN0390134
Tl14
T. longibrachiatum
JN039088
-
Tl15
T. longibrachiatum
JN039089
209
T Prameela Devi et al. Fig 1. Phylogenetic relationships of 70 isolates of Trichoderma spp. inferred by analysis of ITS 1 &b 2 sequences. The tree was obtained from analysis by the Maximum Parsimony method using MEGA5 program
210
Development of Species Specific Markers For Detection of Trichoderma Species Fig 2. Phylogenetic relationships of 65 isolates of Trichoderma spp. inferred by analysis of tef1 sequences. The tree was obtained from analysis by the Maximum Parsimony method using MEGA5 program. Group-I T. harzianum, Group-II T. virens, Group-III T. aseperellum., Group-IV T. lonibrachiatum
211
T Prameela Devi et al. Fig 3. Trichoderma virens specific primer Amplification 1-10 Trichoderma virens 11. Trichoderma longibrachiatum 12. Trichoderma harzianum 13. Trichoderma hamatum 14. Trichoderma viride 15. Trichoderma pseudokoningii 16. Trichoderma flavofuscum 17. Trichoderma fasiculatum 18. Trichoderma harzianum 19-20. Trichoderma viride 21-22. Trichoderma harzianum 23-24. Trichoderma pseudokoningii 25-26. Trichoderma longibrachiatum 27-29. Trichoderma viride 30-32. Trichoderma harzianum 33-35. Trichoderma pseudokoningii 36-38. Trichoderma longibrachiatum 39-44. Trichoderma viride 45-47. Trichoderma harzianum 48-56. Trichoderma pseudokoningii 57-60. Trichoderma longibrachiatum 61-62. Aspergillus flavus 63. Fusarium oxysporum.
identification due to the phenotypic plasticity and genetic variability in the morphological identification of characters; (2) ineffectiveness in discriminating morphologically cryptic taxa; (3) imperfect identification of pleomorphic organisms based on their poorly known life-cycle; and (4) dependence on a high level of identification expertise.
Recent advances in DNA sequence technologies and analytical methods have revolutionized fungal systematics. There have been several attempts to incorporate molecular data into identification systems. Various gene regions have been employed such as nuclear large ribosomal subunit rDNA (Kurtzman and Robbnett 1998), nuclear small ribosomal sub212
Development of Species Specific Markers For Detection of Trichoderma Species Fig 4. Trichoderma longibrachiatum specific primer Amplification 1-29 Trichoderma longibrachiatum 32-33. Trichoderma viride 36-44. Trichoderma virens 57-63. Trichoderma harzianum 65. Trichoderma harzianum 67. Trichoderma flavofacusm 69. Trichoderma fasiculatum
30-31. Trichoderma virens 34-35. Trichoderma harzianum 45-56. Trichoderma viride 64. Trichoderma virens 66. Trichoderma hamatum 68. Trichoderma viride 70. Trichoderma virens
unit rDNA (Baayen et al. 2001), internal transcribed spacer (Cunnington et al. 2003; Druzhinina et al. 2005), partial β-tubulin gene sequences (O'Donnell et al. 1998) and partial elongation factor 1-alpha (EF-1α) sequences (Geiser et al. 2004, O'Donnell et al. 2008), to identify fungi to the species level. Seifert et al. (2007) examined patterns of sequence divergences in the full COI gene for 38 taxa in the Kingdom Fungi. Many phylogenetic works are based on the internally transcribed spacers (ITS), which is one of the most widely used molecular markers due to their variability in nucleotide sequences (Kindermann et al. 1998; Kubicek et al. 2003; Kullnig et al. 2000). However, in the present study, the ITS sequence analyses have not shown significant nucleotide differences to infer relationships. Because of this, other regions like translation elongation factor1 (tef1) locus was included for drawing phylogenetic relationship. tef1 sequence can be used as a potential 213
T Prameela Devi et al. marker for investigating relationships between fungi at all levels (Roger et al. 1999). tef 1 is highly informative at the species level; its small sequence renders easier and cheaper recovery of the sequences, and the paucity of the repetitive regions which could produce misleading results owing to the comparison of non orthologous sequence pairs. For these reasons, tef1 has become the marker of choice for identification of Trichoderma (Chaverri et al. 2003). Wulff et al. (2010) were also able to distinguish four closely related Fusarium spp. associated with rice bakanae disease, using tef1 primers. Thus, in this study, we employed tef1-α as a potential phylogenetic marker to infer phylogenetic relationships among different Trichoderma spp using nucleotide characters obtained by sequencing a part of the tef1 gene, and an effort was made to develop specific primers to identify Trichoderma virens and T. longibrachiatum.
MATERIALS AND METHODS Collection and isolation of fungal cultures 72 isolates of Trichoderma were obtained for morphological and molecular analysis from different locations of India (Table1). These cultures were purified and single spore isolation were made on potato dextrose agar (PDA) with low sugar medium (Nirenberg, 1976) and deposited in Indian type culture collection (ITCC), Division of Plant Pathology, IARI, New Delhi. Phenotype analysis Phenotypic characterization of all isolates was performed using various culture techniques, mycelial growth rate and colony appearance, as well as microscopic morphological features including phialides and spores (Rifai 1969 and Bissett 1984, 1991a, 1991b, 1991c) in order to unambiguously verify the isolates studied. DNA extraction For the preparation of genomic DNA from Trichoderma isolates, colonies from potato dextrose agar medium were transferred to flasks containing potato dextrose broth medium. The flask cultures were incubated in a stationary state at 25ºC for 5-6 days, then mycelia were harvested and freeze-dried. DNA extraction was performed using CTAB (cetiltrimetilamonium bromide) method (Culling 1992). The DNA pellet was rehydrated in 50 mL TE buffer and allowed to resuspend at 4ºC overnight. The quality and quantity of DNA was estimated using Nanodrop. All DNA samples were diluted to a working concentration of 10 ng/µl. PCR Amplification of ITS and tef1 Region Approximately 650 bp of the Trichoderma ITS region in the rDNA fragments were amplified using universal primers ITS1 (5′ GGAAGTAAAAGTCGTAACAAGG 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) (White et al.
1990). PCR reaction was carried out in a 100 μl PCR Mix containing 10× assay buffer, 200 mM MgCl, 200 mM dNTP mix, 10 pico mole of each primer, 2.5 unit of Taq polymerase (Bangalore Genei, India) and 50 ng DNA. Amplifications were carried out in a PCR thermal cycler (Bioer) using an initial denaturation at 94ºC for 1 min followed by 30 cycles of denaturation for 35 sec at 94ºC, annealing for 1 min at 57ºC and extension for 1 min at 72ºC. This was concluded with a final extension for 10 min at 72ºC. Amplicons were separated in 1.2 % agarose gels in 1X TAE buffer at 50 V for 40 min, stained with ethidium bromide and visualized under UV light. Similar attempt was made to amplify the tef1 gene using the forward primer EF1 (5´- ATGGGTAAGGAGGACAAGAC3) and reverse primer TEF1rev (GCCATCCTTGGAGATACCAGC) (Samuels et al. 2002) with an initial denaturation at 95ºC for 3 min followed by 30 cycles of denaturation for 1min at 95ºC, annealing for 1min at 60ºC, extension for 1 min at 72ºC and final extension for 10 min at 72ºC. Sequencing of ITS region and tef1 gene PCR products of Trichoderma species were purified from agarose gel using QIAquick gel extraction kit (Qiagen, USA) following manufacturer's instruction. Purified PCR products were sequenced using universal primers, ITS4 for ITS and EF1 for tef1 in an automated ABI 3100 Genetic Analyser (Applied Biosystems, USA) by Bangalore Genei (Bangalore, India). Phylogenetic Analysis of the Sequence Data DNA sequences were aligned using the multiple sequence alignment program Clustal-X (Thompson et al. 1997), and then visually adjusted. Single gaps were treated as missing data. Phylogenetic analyses were performed in MEGA5 (Tamura et al. 2011). A parsimony analysis was performed using a heuristic search, with a starting tree obtained via stepwise addition, with random addition of sequences with 1000 replicates. Stability of tree was assessed with 1000 bootstrap replications. Out-group taxa for the individual analyses were determined from a preliminary, broad based phylogenetic analysis of Trichoderma sections and the tree. Development of species specific primer To design species-specific PCR primers, sequences of tef1 gene of Trichoderma longibirachiatum and T. virens were obtained by amplifying the target tef1 gene fragment with conserved primers. After comparing the sequences of the target gene with other Trichoderma species (downloaded from NCBI) (http://www.ncbi.nlm.nih.gov), by alignment with a computer program (e.g. Clustal W at http:// www.ebi.ac.uk/clustalw), the sequences specific to the target Tichoderma species could be found, and subsequently, species-specific PCR primers could be developed using online computer software (e.g. primer3 at http://frodo.wi.mit.edu/cgi 214
Development of Species Specific Markers For Detection of Trichoderma Species -bin/primer3/primer3_www.cgi). Evaluation of Marker Sets The marker sets developed for T. virens and T. longibrachiatum were also tested against other species of Trichoderma viz., T. harzianum, T. hamatum, T. viride, T. pseudokoningii, T. flavofacusm and other fungi viz., Aspergillus flavus and Fusarium oxysporum. PCR amplification was carried out with an initial denaturation at 94ºC for 2 min followed by 30 cycles of denaturation for 30 sec at 94ºC, annealing for 30 sec at 55ºC, extension for 1 min at 72ºC and final extension for 10 min at 72ºC.
RESULTS AND DISCUSSION Morphological Analysis Morphological analysis of 72 isolates of Trichoderma was achieved by detailed microscopic analysis of typical Trichoderma structures. This enabled the identification and grouping of isolates into four Trichoderma species- Trichoderma virens (J.H. Giddens and A.A.Foster), T. harzianum Rifai, T. longibrachiatum Rifai. and T. asperellum (Samuels et al. 2006). Trichoderma in the recent years has gained immense importance due to its multiple uses viz., biocontrol agents against plant pathogens, production of enzymes, antibiotics and disease causing ability. Thus, there was a need to identify, understand the diversity and relationships of species of the genus Trichoderma, which was initially started based on morphological observations by Rifai (1969) and later by Bissett (1984, 1991a, 1991b, 1991c, 1992). However, distinguishing species within the Trichoderma species complex using morphological characters is difficult even for specialists. Phylogenetic analysis of the ITS and tef1 gene The amplified fragment size of the ITS1 and ITS2 regions varied from 550 to 600 bp in the isolates studied. The sequence variation in this region was analyzed. The resulting data subjected to phylogenetic analysis. Phylogenetic tree was constructed using Maximum Parsimony method to graphically represent the genetic relationship in the isolates. However, ITS region could not differentiate the Trichoderma species into distinct group (Fig 1). These results encouraged us to use other genes like tef1. The phylogenetic analysis using tef1 gene was able to differentiate taxa that were not differentiated using the ITS region (Fig 2). The relationships and identifications of isolates used from phylogenetic analyses based on tef1 sequences were in conformity with the morphological observations (T.longibrachiatum, T.virens, T. harzianum and T. asperellum). Several recent studies on the systematics of Hypocrea/ Trichoderma have proposed taxonomy based on the combina-
tion of phenotypic and genotypic characters. So DNA sequence-based identifications and species-specific PCR assays are used to accurately identify species within the complex (Kullnig-Gradinger et al. 2002). Thus, we used speciesspecific PCR and sequence analyses along with morphological identifications. Development of species specific marker The species specific primer sets were designed based on the sequence analysis of tef1 gene. A set of 11isolates of T. virens and 26 isolates of T. longibrachiatum were taken to test the primer sets. These specific primer sets gave amplicons of 330 bp and 452 bp in T. virens and T. longibrachiatum isolates, respectively. The sequence of the specific primer pairs were T1F (5’-CCGTTTGATGCGGGGAGTCTA-3’) and T1R (5’-GGCAAAGAGCAGCGAGGTA-3’) for T. virens and T2F (5’- CCGTGAGTACACACCGAGCTT-3’) and T2R (5’- CGGCTTCCTGTTGAGGGGA-3’) for T. longibrachiatum. Molecular methods are among the most precise tools used for differentiating species and identification of new strains. They differ regarding discriminatory power, reproducibility, ease of use, and interpretation. DNA fingerprinting has been successfully used for many fungi for characterization of individual isolates and grouping them into standard racial classes and groups. This is particularly useful when any unknown fungal sample is to be identified. A comparison at the DNA sequence level provides accurate classification of fungal species and is beginning to elucidate the evolutionary and ecological relationships among diverse species (Mule et al. 2005). Molecular markers demonstrate the variation in DNA sequences within and between the species and provide the basis for a precise identification. Polymerase chain reaction (PCR) has found widespread use throughout pathogen identification and a number of PCR-based assays have been developed for use in the diagnosis and characterization of fungal species (Doohan 1998). Indeed, differences in the nucleotide composition of the variable ITS region have been successfully employed to design specific primer sets that amplify DNA selectively among and within species of plant pathogens (Moricca et al. 1998). However, in the present study the ITS region analysis could not differentiate species accurately and infer the phylogenetic relationship of the Trichoderma isolates. This is due to the presence of non orthologous copies of the ITS in some isolates. Otherwise, this could be possibly due to less sequence variation in the analyzed region or the ITS region in Trichoderma is least subjected to variation in the evolutionary timeline. The inability of ITS region in differentiating species accurately is reported by large group of researchers (Balajee and Marr 2006, O'Donnell et al. 1998, Lieckfeldt and Seifert 2000). However, the ITS region could 215
T Prameela Devi et al. differentiate the Trichoderma genus from other related genera (Druzhinina et al. 2005). The constraints of ITS region therefore led to the use of tef1 gene which could clearly differentiate the Trichoderma isolates into different species. There are several report by other authors that tef1 gene offers advantages over the ITS region in differentiating fungal species (Kullnig-Gradinger et al. 2002, Druzhinina et al. 2005, Chaverri at el. 2003). These research findings also became the basis for choosing tef1 gene for developing species specific markers for unambiguous and quick identification of species. Evaluation of marker sets The marker sets thus developed were evaluated across the other Trichoderma species and other genera. The specific primer set T1F and T1R at annealing temperature of 55ºC amplified DNA fragment of 330 bp in T. virens only (Fig 3). Similarly, the primers set T2F and T2R specifically amplifed T. longibrachiatum DNA fragment of 452 bp at 55ºC annealing temperature (Fig 4). Our results substantiate the utility of tef1 gene in identifying and differentiating Trichoderma species. The two pairs of specific primers designed viz., T1F/T1R and T2F/ T2R exactly matched with the specific DNA sequence of T. virens and T. longibrachiatum respectively and incompletely matched with the sequence of other species. Therefore, a high stringency PCR reaction with primers specific for T. virens and T. longibrachiatum gave a positive signal only for genuine species T. virens and T. longibrachiatum, but not for other fungi. Thus, this study presents an efficient method for identifying Trichoderma at species level. Furthermore, the process of identification by PCR is very simple and convenient to use and also, clearly demonstrates the robustness of molecular markers in differentiating and identifying fungal species. Acknowledgments The authors thank the Head, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi for the help in various aspects of this study. Financial support from Department of Biotechnology, Govt. of India, New Delhi, is gratefully acknowledged.
REFERENCES Baayen RP, O'Donnell K, Breeuwsma S, Geiser DM and Waalwijk C (2001). Molecular relationships of fungi within the Fusarium redolens-F. hostae clade. Phytopath 91: 1037–1044. Balajee SA and Marr KA (2006). Phenotypic and genotypic identification of human pathogenic aspergilli. Future Microbiol 1: 435-445. Bissett J (1984). A revision of the genus Trichoderma I. Sect. Longibrachiatum sect.nov. Can J Bot 62:924–931.
sification. Can J Bot 69:2357–2372. Bissett J (1991b). A revision of the genus Trichoderma III. Sect. Pachybasium. Can J Bot 69: 2373–2417. Bissett J (1991c). A revision of the genus Trichoderma IV. Additional notes on section Longibrachiatum. Can J Bot 69:2418–2420. Bissett J (1992). Trichoderma atroviride. Can J Bot 70:639–641. Buckler ES, Ippolito A,and Holtsford TP (1997). The evolution of ribosomal DNA: divergent paralogues and phylogenetic implications. Genetics 145: 821-832. Chaverri P, Castlebury LA, Samuels GJ and Geiser DM (2003). Multilocus phylogenetic structure within the Trichoderma harzianum/Hyppocrea lexii complex. Mol Phylogen Evol 27: 302-313. Culling KW (1992). Design and testing of a plant specific PCR primer for ecological evolutionary studies. Mol Ecol 1: 233-240. Cunnington JH, Takamatsu S, Lawrie AC and Pascoe IG (2003). Molecular identification of anamorphic powdery mildew fungi. Australasian Plant Pathol 32: 421-428. Doohan FM (1998). Molecular techniques for studying Fusarium ear blight of wheat. Ph.D. thesis, Open University, UK. Druzhinina IS, Kopchinskiy AG, Komo M, Bissett J, Szakacs G and Kubicek CP (2005). An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet Biol 42: 813-828. Geiser DM, Jiménez-Gasco MDM, Kang S, Makalowska I, Veeraraghavan N, Ward TJ, Zhang N and O'Donnell K (2004). FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. European J Plant Pathol 110: 473-479. Hammond P (1992). Species inventory. In: Global biodiversity: status of the earth’s living resources (ed. B. Groombridge). Chapman and Hall, London: Pp 17-39. Hawksworth DL and Kalin-Arroyo MT (1995). Magnitude and distribution of biodiversity.In: Global biodiversity assessment (ed. V.H. Heywood). Cambridge University Press, London. Pp 107-191. Hebert PD, Cywinska A, Ball SL and de Waard JR (2003a). Biological identifications through DNA barcodes. Proc R Soc Lond 270: 313–321. Hebert PD, Ratnasingham S and de Waard JR (2003b). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B (Suppl) 270: S96–S99. Hebert PD, Stoeckle MY, Zemlak TS and Francis CM (2004). Identification of Birds through DNA Barcodes. PLoS Biol 2: e312. Hjeljord L and Tronsmo A (1998). Trichoderma and Gliocladium in biological control: an overview. In: Kubicek, C.P., Harman, G.E. (Eds.), Trichoderma and Gliocladium. Enzymes, Biological Control and Commercial Applications, vol. 2. Taylor and Francis, London, Pp 131–151. Kindermann J, El-Ayouti Y, Samuels GJ and Kubicek CP (1998). Phylogeny of the genus Trichoderma based on sequence analysis of the internal transcribed spacer region 1 of the rDNA clade. Fungal Genetics and Biology 24: 298–309.
Bissett J (1991a). A revision of the genus Trichoderma II. Infrageneric clas-
216
Development of Species Specific Markers For Detection of Trichoderma Species Klein D and Eveleigh DE (1998). Ecology of Trichoderma. In: Kubicek CP, Harman GE, eds. Trichoderma and Gliocladium. Basic biology, taxonomy and genetics. London, UK: Pp 57–74. Kubicek CP and Penttilä ME (1998). Regulation of production of plant polysaccharide degrading enzymes by Trichoderma. In: Kubicek, C.P., Harman, G.E. (Eds.), Trichoderma and Gliocladium. Enzymes, Biological Control and Commercial Applications, vol. 2. Taylor and Francis, London, Pp 49–71.
health equity using household survey data: a guide to techniques and their implementation. World Bank, Washington, DC. Rifai MA (1969). A revision of the genus Trichoderma. Mycol. Papers 116: 1–56. Roger AJ, Sandblom O, Doolittle WF and Philippe H (1999). An evaluation of elongation factor 1α as a phylogenetic marker for eukaryots. Mol Biol Evol 16: 218–233.
Kubicek CP, Bissett J, Druzhinina I, Kullnig-Gradinger C and Szakacs G (2003). Genetic and metabolic diversity of Trichoderma: a case study on South East Asian isolates. Fungal Genet Biol 38: 310–319.
Samuels GJ, Dodd SL, Gams W, Castlebury LA and Petrini O (2002). Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus. Mycologia 94: 146-170.
Kuhls K, Lieckfeldt E, Samuels GJ, Kovacs W, Meyer O, Petrini W, Gams T, Böner T and Kubicek CP (1996). Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina. Proc National Acad Sci USA 93: 7755–7760.
Samuels GJ (1996). Trichoderma: a review of biology and systematic of the genus. Mycol Res 100: 923–935.
Kuhls K, Lieckfeldt E. Samuels M, Meyer GJ, Kubicek CP and Börner T (1997). Revision of Trichoderma section Longibrachiatum including related teleomorphs based on an analysis of ribosomal DNA internal transcribed spacer sequences. Mycologia 89: 442–460. Kullnig CM, Szakacs G and Kubicek CP (2000). Molecular identification of Trichoderma species from Russia, Siberia and the Himalaya. Mycol Res 104: 1117–1125. Kullnig-Gradinger CM, Szakacs G and Kubicek CP (2002). Phylogeny and evolution of the fungal genus Trichoderma—A multigene approach. Mycol Res 106: 757–767. Kurtzman CP and Robnett CJ (1998). Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73: 331–371. Kredics L, Antal Z, Doczi I, Manczinger L, Kevei F and Nagy E (2003). Clinical importance of the genus Trichoderma. A review. Acta Microbiologica et Immunologia Hungarium 50: 105–117. Lieckfeldt E and Seifert KA (2000). An evaluation of the use of ITS sequences in the taxonomy of the Hypocreales. Studies in Mycol 45: 35-44. Mule G, Gonzalez-Jaen MT, Hornok L, Nicholson P and Waalwijk C (2005). Advances in molecular diagnosis of toxigenic Fusarium species: a review. Food Addit Contam 22: 316–323. Nelson EE (1982). Occurrence of Trichoderma in a Douglas-Wre soil. Mycologia 74: 280–284. Nirenberg HI (1976). Untersuchungen uber die morphologische und biologische differnzierung in der Fusarium Sektion Liseola. Mitt Biol Bundesanstalt for Land-Forstw Berlin-Dallem, 169: 1-117. O'Donnell K (1992). Ribosomal DNA internal transcribed spacers are highly divergent in the phytopathogenic ascomycete Fusarium sambucinum (Gibberella pulicaris). Current Genetics 22: 213-220. O'Donnell K, Cigelnik E and Nirenberg HI (1998). Molecular systematics and phylogeography of the Gibberella fujikuroi species complex. Mycologia 90: 465-493.
Samuels GJ (2006). Trichoderma: systematics, the sexual state, and ecology. Phytopath 96: 195–206. Schardl CL, Leuchtmann A, Tsai HF, Collett MA, Watt DM and Scott DB (1994). Origin of a fungal symbiont of perennial ryegrass by interspecic hybridization of a mutualist with the ryegrass choke pathogen, Epichloe typhina. Genetics 136:1307-1317. Schmidt O and Moreth U (2000). Species-specific priming PCR in the rDNA-ITS region as a diagnostic tool for Serpula lacrymans. Mycol Res 04: 69-72. Seifert KA, Samson RA, DeWaard JR, Houbraken J, Levesque CA, Moncalvo JM, Louis-Seize G and Hebert PD (2007). Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case. Proc National Acad Sci USA 104: 3901–3906. Sivasithamparam K and Ghisalberti EL (1998). Secondary metabolism in Trichoderma and Gliocladium. In: Kubicek, C.P., Harman, G.E. (Eds.), Trichoderma and Gliocladium. Basic Biology, Taxonomy and Genetics, vol. 1. Taylor and Francis, London, Pp. 139–191. Tamura K, Peterson D, Peterson N, Stecher G, Nei M and Kumar S (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol 28: 2731-2739. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgins DG (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882. Thrane U, Poulsen SB, Nirenberg HI and Lieckfeldt E (2001). Identication of Trichoderma strains by image analysis of HPLC chromatograms. FEMS Microbiol Lett 203: 249–255. White TJ, Bruns T, Lees S and Taylor J (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Gelfland, D.H., Innis, M.A., Sninsky, J.J., Widden, P., and Abitbol, J.J. 1980. Seasonality of Trichoderma species in a spruce-forest soil. Mycologia 72: 775– 784. Wulff EG, Sorensen JS, Lubeck M, Nielsen KF, Thrane U and Torp J (2010). Fusarium spp. associated with rice Bakanae: ecology, genetic diversity, pathogenicity and toxigenicity. Environ Microbiol 12: 649–657.
O’Donnell, van Doorslaer E, Lindelo¨w M and World B (2008). Analyzing
217
