Triple-strand-forming methylphosphonate oligodeoxynucleotides ...

Proc. Natl. Acad. Sci. USA Vol. 91, pp. 12433-12437, December 1994 Biochemistry

Triple-strand-forming methylphosphonate oligodeoxynucleotides targeted to mRNA efficiently block protein synthesis MARK A. REYNOLDS*t, LYLE J. ARNOLD, JR.*, MELISSA T. ALMAZAN*, TERRY A. BECK*, RICHARD I. HOGREFE*, MICHAEL D. METZLER*, SCOTT R. STOUGHTON*, BEN Y. TSENG*, TINA L. TRAPANEt, PAUL 0. P. Ts'ot, AND TOD M. WOOLF*§ *Genta, Inc., 3550 General Atomics Court, San Diego, CA 92121; and tThe Johns Hopkins University, School of Hygiene and Public Health, 615 North Wolfe Street, Baltimore, MD 21205-2179

Communicated by Randy Schekman, August 29, 1994 (received for review June 24, 1994)

sity for forming triple-stranded complexes due to reduced charge-charge repulsion. Here we report that MPOs containing a mixture of adenine and guanine bases can bind single-stranded RNA in a triple-strand recognition motif. These oligomers inhibit cell-free protein synthesis at submicromolar concentrations. They can also block reverse transcription in a sequence-specific manner.

ABSTRACT Antisense oligonucleotides are ordinarily targeted to mRNA by double-stranded (Watson-Crick) base recognition but are seldom targeted by triple-stranded recognition. We report that certain all-purine methylphosphonate oligodeoxyribonucleotides (MPOs) form stable triple-stranded complexes with complementary (all-pyrimidine) RNA targets. Modified chloramphenicol acetyltransferase mRNA targets were prepared with complementary all-pyrimidine inserts (18-20 bp) located immediately 3' ofthe initiation codon. These modified chloramphenicol acetyltransferase mRNAs were used together with internal control (nontarget) mRNAs in a cell-free translation-arrest assay. Our data show that triple-strandforming MPOs specifically inhibit protein synthesis in a concentration-dependent manner (>90% at 1 IAM). In addition, these MPOs specifically block reverse transcription in the region of their complementary polypyrimidine target sites.

MATERIALS AND METHODS Oligonucleotides. Methylphosphonate oligonucleotides (MPOs) were synthesized and deprotected as described previously (18). The identity of each oligonucleotide was confirmed by electrospray mass spectrometry using a Fisons Trio2000 electrospray mass spectrometer in the positive-ion mode. Purity of some of these oligonucleotides was also demonstrated by 1-H NMR spectroscopy with a Bruker 300-MHz spectrometer located at California Polytechnic University (San Luis Obispo). Unmodified DE oligonucleotides were purchased from Oligos Etc. (Wilsonville, OR). The purity of DE oligonucleotides was confirmed by end-labeling with 32p using [y32P]ATP and T4 polynucleotide kinase followed by PAGE and autoradiography. Synthetic oligoribonucleotides were prepared on a MilliGen model 8750 automated DNA synthesizer with commercially available 2'-O-trimethylsilyl-protected, ,B-cyanoethyl amidite monomers (19). Latex gloves were worn at all times when handling the oligomers to prevent contamination by ribonucleases. Melting Temperature (T.) Determinations. Buffers were made in sterile Millipore grade water that was treated overnight with 2% (vol/vol) diethyl pyrocarbonate and then autoclaved twice. MPOs and their complementary RNA targets were mixed at 2:1 molar ratios in 20 mM potassium phosphate/100 mM NaCl/0.1 mM EDTA/0.03% potassium sarkosylate, pH 7.2 (total strand concentration = 3.6 ,um). Annealing reactions were heated to 80°C and then cooled slowly to 4°C over 4-6 hr. Samples were monitored at 260 nm over an increasing temperature gradient (0.07°C/min) by using a Varian Cary model 3E UV/visible spectrophotometer equipped with a thermostat multicell holder, temperature controller, and temperature probe accessories. Data were recorded and processed using a personal computer interface; Tm values were determined at the midpoint of each thermal denaturation profile. Gel-Shift Assays. Synthetic RNA targets were end-labeled with 32P by using [y32P]ATP and T4 polynucleotide kinase. Molar extinction coefficients were determined for MPOs by hydrolyzing the backbone in 1 M piperidine and correcting

The selective inhibition of mRNA translation by antisense oligonucleotides is proposed to occur through two possible mechanisms: a "steric blocking" mode and a "cleavage" mode (1, 2). In the "steric blocking" mode, the WatsonCrick heteroduplex is thought to form a physical barrier to translation initiation and/or mRNA processing (i.e., splicing, polyadenylylation, etc.). In the "cleavage" mode, the target mRNA is cut by RNase H, an endogenous enzyme that cleaves RNA at the site of a DNA/RNA heteroduplex. Recent cell-free data indicate that normal phosphodiester (DE) oligonucleotides act primarily through the cleavage mode because inhibition is often associated with the appearance of truncated protein products (3-5). Except for phosphorothioates and phosphorodithioates, none of the nuclease-resistant analogs developed to date are substrates for RNase H (6, 7). Thus, much effort has been directed toward developing steric blocking oligonucleotide analogs that bind mRNA with high affinity and specificity (8). Recently, triple-strand base recognition has been proposed as a means of enhancing binding affinity to mRNA target sites while maintaining good sequence specificity (9-13). In this motif, one strand of oligonucleotide binds the mRNA target by Watson-Crick base pairing, and a second strand binds in the major groove of the heteroduplex. The bases in the third strand are proposed to bind through conventional Hoogsteen bonding interactions analogous to those observed in triplestranded DNA (14, 15). Thus, in effect, each base in the target sequence gets "read twice"'. To date, triple-strand binding to mRNA has been demonstrated only with DE oligonucleotides linked together in a hairpin or circular construction (11-13, 15). We and others (16, 17) reasoned that neutral backbone oligonucleotides such as MPOs might have a greater propen-

Abbreviations: CAT, chloramphenicol transferase; MPO, methylphosphonate oligodeoxynucleotide; DE, phosphodiester; Tm, melting temperature. tTo whom reprint requests should be addressed. §Present address: Ribozyme Pharmaceuticals, Inc., 2950 Wilderness Place, Boulder, CO 80301.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

12433

12434

Biochemistry: Reynolds et al.

appropriately for absorbance at 254 nm on the basis of known base compositions. Molar extinction coefficients for RNA targets were determined similarly except that bases were digested with snake venom phosphodiesterase. MPOs and their complementary synthetic RNA targets were mixed at concentrations indicated in the figures and text (below), together with a trace amount of 32P-labeled RNA (-50,000 cpm) in NaTPE8 buffer (10 mM phosphate/40 mM Tris HCl/ 100 mM NaCl/l mM EDTA, pH 8.0; final volume = 10 ul) and annealed over a decreasing temperature gradient from 80°C-4°C as described above. Next, 10 j. of gel-loading buffer [50% (vol/vol) glycerol/NaTPE8/0.1% bromphenol blue] was added to each annealing reaction. Aliquots from the resulting mixtures (10 ul) were loaded immediately onto 15% polyacrylamide gels (0.5 mm thick x 20 cm wide x 40 cm long) and electrophoresed at 500 V for 90 min. Temperature control was achieved by using a submarine-type gel apparatus (Hoefer, model SE 600). Autoradiographs of the dried gels were taken with Kodak type XAR-5 film. UV Mixing Curves. MPOs and their complementary synthetic RNA targets were mixed at different molar fractions ranging from 0.1 to 1.0 in NaTPE8 buffer (total strand concentration = 2.4 ,um) and annealed as described above. Absorbance values were measured at 260 nm for each sample in 1-cm path-length quartz cuvettes at =150C. CD Measurements. CD spectra were obtained on an Aviv (Lakewood, NJ) 60DS spectropolarimeter with 1.5-ml samples in 1-cm quartz fluorescence cuvettes. Total oligonucleotide concentration was 4.8 ,.M. Temperature was maintained at 20 ± 0.10C by using a thermostatically controlled cell holder. Individual scans were recorded at 1-nm intervals over 350 to 205 nm with a constant bandwidth of 0.8 nm. Final spectra are presented as the average of three separate scans. Ae is reported per base residue and was calibrated by using Ae29o = 335 miHlidegrees for 1 mg/ml (1S)-(+)-10-camphorsulfonic acid (20). Baseline correction, scaling, data smoothing, and spectral calculations were done by using the AVIV plot program. A third-order polynomial averaged over a 7-nm bandwidth was used to smooth the observed spectra. Modified mRNA Targets for Cell-Free Translation-Arrest Assays. The polypyrimidine target site complementary to the Pur-alt MPO was inserted into a sequence coding for bacterial chloramphenicol acetyltransferase (CAT) by standard PCR cloning techniques (21). A CAT-containing template (pBR325, Life Technologies, Grand Island, NY) was used to obtain the CAT coding region. PCR was done with the following pair of primers: primer 1, 5'-GGGAAGCTTA CTAGCAACCT CAAACAGACA CCATGCTCTCTCTCTCTCTC ICTAAAGTGG AGAAAAAAAT CACTGG-3'; primer 2, 5'-TTTTTTTTTT TTTTTTTTTT ACTAGTGCGG CCGCGAATTT CTGCCATTCA TCCG-3'. The resulting amplified DNA fragment contained the polypyrimidine insert immediately 3' of the translation initiation codon (note the underlined bases in primer 1). This fragment was then cut with HindlIl and Not I restriction endonucleases and ligated into the HindIII/Not I site of a pRC-CMV expression vector (Invitrogen). Applying this same method, a second modified CAT template was prepared containing a different polypyrimidine insert complementary to the Pur-rndl MPO. A control CAT template was also prepared without a polypyrimidine insert. These templates were then linearized either with Not I to obtain full-length transcripts or with EcoRI to obtain truncated transcripts for use as internal controls (22). Capped mRNA transcripts were prepared from each of the linearized templates with T7 RNA polymerase. Cell-Free Translation-Arrest Assays. Reagents for cell-free translation in the presence of rabbit reticulocyte lysate were purchased from Life Technologies. These reagents were combined on ice together with [35S]methionine (DuPont/ NEN) according to the manufacturer's specifications. For

Proc. Natl. Acad. Sci. USA 91 (1994)

the experiment described in Fig. 4a, aliquots fron the reticulocyte lysate mixture were added directly to tubes on ice containing 10 times concentrations of DE or MPO oligomers (dissolved in sterile water to give final concentrations from 10 nM to 1 ,uM). Next, modified and control CAT mRNAs were added to each tube, and the translation reactions were initiated by warming the tubes to 30°C. For the experiment of Fig. 4b, the oligomers were first preannealed with the target mRNAs. In this case, the oligomers and mRNAs were dissolved in 40 mM potassium acetate buffer (pH 7.0), heated to 70°C, and then cooled slowly to room temperature over a period of -1 hr before adding the reticulocyte lysate mixture. In both experiments, the final concentrations of CAT mRNAs were s30 nM. The reticulocyte lysates also contained endogenous f-globin mRNA that served as an additional internal control. Translation reactions were allowed to proceed for 60 min at 30°C. Then, the protein products were denatured in the presence of Laemmli sample buffer (NOVEX) and separated by gel electrophoresis using precast 10-20% gradient SDS/PAGE gels (also from NOVEX). Reverse Transcriptase Assays. Approximately 1 ,g of each modified CAT mRNA was mixed with test MPO (10 ,uM) and DNA primer (10 ,M, sequence = 5' CCATTGGGATATATC-3') in 20 mM potassium phosphate/0.1 mM EDTA/ 0.03% sarkosyl/100 mM NaCl, pH 7.2. The resulting samples were heated to 70°C, cooled slowly to 4°C over a period of =4-6 hr, and then maintained at 4°C overnight. Next, avian myeloblastosis virus reverse transcriptase (Promega) was combined on ice with 1 mM of each of the four dNTPs and

deoxyadenosine 5'-[y35S]thiotriphosphate (DuPont/NEN) in a buffer containing 50 mM Tris HCl (pH 7), and 3 mM MgCl. Aliquots from this mixture were added to the tubes containing preannealed oligomers, and mRNAs and the tubes were incubated at 30-37°C for 1 hr. Products from the reverse-transcription reactions were separated by gel electrophoresis using an 8% polyacrylamide/7 M urea gel. I

Gi6 (

1.0-

C .1

.1

i

..

cnE

I

I

Q0 c- 0.9 I

I

NND C\J

-F

0.8-

0

z 0.7

1b

2O

30

40

50

60

70 80

Temperature (°C) C,U-insert

ORF

Triple-strand MPOs

MPO/ RNA Pur-aft

Seguence

ITm (2:1 MPO/RNA)

5'-AGAGAGAGAGAGAGAG-3' 3'-UCUCUCUCUCUCUCUC-5'

52°C

Pur-mdl

5'-AGAAAGGGAGAGGGAA-3'

54°C

Pur-md2

5'-GAGGGAAAGAGAAAGG-3' 3'-CUCCCUUUCUCUUUCC-5'

40°C

(CU)-aft (CU)-mdl (CU)-md2

3'-UCUUUCCCUCUCCCUU-5'

FIG. 1. (Top) Thermal denaturation profiles for each of the all-purine MPOs together with its complementary synthetic RNA target. - , Pur-alt sequence; ---, Pur-rndl sequence; *, Pur-rnd2 sequence. (Middle) Schemnatic showing the location of triple-strandforming MPOs targeted to modified CAT mRNAs. Complementary polypyrimidine sequences were inserted immediately adjacent to and downstream of the AUG codon by PCR cloning and in vitro transcription. ORF, open reading frame. (Bottom) Sequences of the three MPOs used are shown along with their complementary synthetic RNA targets. The Tm values are given for each MPO/RNA, 2:1. -



respectively. We were unable to detect the middle (heteroduplex) bands in the gel run at 37°C, however. Because the upper bands were clearly visible in both gels, we conclude that the triple-stranded complexes are stable at physiological temperatures with oligomer concentrations down to 10-9 M. In a separate gel-shift experiment, the binding of Pur-alt MPO to its complementary RNA was compared with a DE oligonucleotide having the same base sequence. Each oligonucleotide (10-6 M) was mixed with the complementary RNA target in either a 1:1 or 2:1 stoichiometric ratio. These mixtures were heated to 80°C, cooled slowly to 4°C over 4-6 hr, and then analyzed by gel electrophoresis (Fig. 2b). Approximately 50% of the single-stranded RNA was shifted to an upper band when the Pur-alt MPO was present in a 1:1 molar ratio. With this same oligomer, essentially all of the single-stranded RNA was shifted in the 2:1 sample, further indicating that the MPO binds RNA in a 2:1 stoichiometry. The DE oligonucleotide quantitatively shifted the same RNA target at a 1:1 molar ratio, suggesting that 2:1 complexes do not form with this oligomer under the conditions of our assay. Presumably, the negatively charged DE oligomer binds less A 0.5

RESULTS AIl-Purine MPOs Form 2:1 Triple-Stranded Complexes with Complementary Synthetic RNA Targets. Three different MPOs were prepared for this study, each containing adenine/ guanine, 50:50 (Fig. 1). One of the MPOs has a uniformly alternating sequence (Pur-alt), whereas the other two MPOs have random sequences (Pur-rndl and Pur-rnd2). The locations of adenine and guanine bases in the Pur-rnd2 sequence are switched with respect to those in the Pur-rndl sequence. Thermal denaturation analysis was conducted with each of these MPOs annealed to its complementary synthetic RNA target (Fig. 1). The Tm values determined for the Pur-rndl, Pur-alt, and Pur-rnd2 sequences were 54°C, 52°C, and 40°C, respectively (2:1 molar ratios). The percent hyperchromic shifts {[A260(800C) - A26o(40C)/A260(40C)J x 100} for each MPO/RNA were almost identical when the MPOs were mixed in 1:1 and 2:1 molar ratios with RNA (data not shown). These data alone failed to provide a strong indication of triple-strand formation, however, because two of the three melting profiles were sigmoidal, whereas the third (Pur-rndl sequence) gave a biphasic melting profile. Gel-shift experiments were conducted with the MPO having an alternating adenine/guanine sequence (Pur-alt). In the first experiment, serial dilutions of a 1:1 mixture of Pur-alt and its RNA complement were heated to 80°C and then quickly cooled to 4°C. The complexes formed during this brief annealing step were separated by nondenaturing PAGE at 6°C and 37°C (Fig. 2a). In the gel run at 6°C, we detected two shifted bands for the more dilute samples (i.e., below -0.1 AM). On the basis of their relative mobilities and subsequent data (shown below), we have assigned these two bands as 1:1 heteroduplex and 2:1 triple-stranded complex,

a

12435

CM CD 0

D

0.4

_

0

0.35 0

0.2

0.4

0.6

0.8

1

Mole Fraction MP-(AG)8

60C

370C

-log[Duplex] C 5.0 6.0 7.0 8.0 9.0

-log[Duplex)

B 10 I

*

-

I

I

I / II. \

C 5.06.0 7.08.0 9.0 .

I

5

Triple Strand _ Double Strand -_Single Strand -_.-

-

-_

.

%'

,

I

240

260

o

_

I

-5 220

200

280

300

3220

wavelength, nm C

MP

DE

MP

10

I

DE 5

b

C

1:1 2:1 1:1 2:1

C 1:1 2:1 1:1 2:1 0

.I.I.

~~~~~~~~~~~~~~~~~~~~~~~~~~~. ,

oligonucleotides

[methyphosph)........... ....

..d .D .h.

200

240

220

.....

260

wavelength,

..:...

.. ... .........

280

300

3220

nm

.....G

:

....

(RNAalone).(a)One-to-onemolar.

.

.

FIG. 3. (A) Spectroscopic mixing curve analysis of the Pur-alt MPO annealed to its complementary (CU)-alt RNA target at different mole fractions from 0 to 1 (total strand concentration = 2.4 ,uM). Mole fraction MP-(AG)8 (concentration MPO)/[(concentration MPO) + (concentration RNA target)]. Extrapolation of the downward and upward sloping portions of the curve gives a transition point -0.66 (corresponding to MPO/RNA, 2:1). (B) CD spectra for single-stranded Pur-alt MPO ( *), (CU)-alt RNA (---), MPO/RNA, 2:1 (-). Total strand concentration = 4.8 SM. Spectra were obtained at 20°C in 0.1 M NaCI/0.01 M phosphate/10-5 M EDTA, CD spectrum for MPO/RNA, 1:1. ---, Calculated pH 8. (C) spectrum determined from weighted sum of the spectra for RNA/ MPO, 1:2 (xO.75) and the single-stranded RNA (xO.25). -

electro pheor des

rtides

the

sspho:a:.

(Cur-alt

and D E]

a td

oa

1:1a

oligonucle

v raious.

Int

hisd

-,

experiment, the

RNA strand concentrations

were

10-6

M.

12436


j#:r7e>zZ

Proc. Natl. Acad Sci. USA 91

tightly as a third strand due to charge repulsion (particularly in the absence of divalent metal ions). No such charge repulsion is possible with an MPO third strand because its backbone is neutral in charge. Further evidence oftriple-strand formation with the Pur-alt MPO was obtained by UV mixing curve and CD experiments (Fig. 3). The UV mixing curve data gave a single transition corresponding to MPO/RNA, 2:1 (Fig. 3A). Lack of a separate transition for the 1:1 complex is consistent with our thermal denaturation data, where a single cooperative melt transition was observed. This result suggests that the heteroduplex is a transitory kinetic intermediate en route to the more thermodynamically stable triple-stranded complex. CD spectra for the MPO and RNA single strands and a 2:1 mixture (MPO/RNA) are shown in Fig. 3B. As shown in Fig. 3C, the observed CD spectrum for MPO/RNA, 1:1, is almost identical to a calculated spectrum where half of the RNA is assumed to be present as a 2:1 triple-stranded complex and the remaining half to be single-stranded. This result is consistent with our gel-shift data (Fig. 2b), where the MPO/ RNA, 1:1 mixture contained about half of the RNA in a single-stranded form. Gel-shift and UV mixing curve experiments were also conducted for the Pur-rndl and Pur-rnd2 MPOs with essentially the same results (data not shown). We conclude that each of these three MPOs binds its complementary RNA target in a 2:1 triple-strand motif. Triple-Strand-Forming MPOs Specifically Inhibit Protein Synthesis in a Cell-Free System. To test the ability of all-purine MPOs to inhibit protein synthesis, modified mRNAs coding for bacterial CAT were prepared by PCR cloning and in vitro transcription. The resulting mRNA transcripts contain a

polypyrimidine insert complementary to one of the all-purine MPOs located immediately adjacent to and downstream of the initiation codon. Truncated versions of each CAT mRNA were also prepared to serve as internal controls. Fig. 4 shows that the all-purine MPOs specifically inhibited protein synthesis in a cell-free system. Concentrationdependent inhibition was observed for the Pur-alt MPO, with >90% inhibition seen at 1 ,uM (Fig. 4a). The levels of protein synthesized from the truncated wild-type CAT and 3-globin mRNAs were essentially unchanged in the presence of the Pur-alt MPO. In contrast, the Pur-alt DE oligonucleotide did not inhibit protein synthesis unless exogenous RNase H was added. Thus, the Pur-alt DE oligonucleotide cannot act in a steric blocking mode under our assay conditions. This result is consistent with our failure to detect triple-strand formation with this oligomer in biophysical assays (Fig. 2b and data not shown). The randomized all-purine MPOs (Pur-rndl and Pur-rnd2) were also tested in the cell-free assay. We were able to observe protein synthesis inhibition only with the Pur-rndl MPO (Fig. 4b), occurring at slightly higher concentrations than required for the Pur-alt MPO (>90% inhibition at 10 AM). Presumably, our failure to see an effect with the Pur-rnd2 MPO is due to its lower binding affinity (Tm = 40°C, compared with 54°C for the Pur-rndl MPO, Fig. 1). By comparison of the relative intensities of protein bands in each lane, the Pur-rndl MPO apparently also inhibits in a sequence-specific manner. A trace level of nonspecific inhibition is evident at 10 ,uM, however, because the nontarget protein bands are slightly fainter than in adjacent lanes. A control MPO having a two-base mismatch (2 mm) with l

12345

a

Pur-alt

E

Full Length -_

zoW

om

a

E

10 nM 0.1 ,M 1 gmM c = o XL UJ X X cL LU ui o z 2 ai 2 a X a: a: z , .¢:. fi =i. .:mx.

.io..' __ihs58C

....

....:.

|; ,' .8S :.

..

ar i'

...

.... .::: ,:

.wt

........

jz

§ik

Si;

3-Globin --. Mr: CAT Control __p_ 10 ,uM

gLm

v-

E

b

0.

E N

'

0.

mmmI I CAT(CU)-Mdl

-0--

P-Globin CAT(CU)-aft

--w--W-

E cm

,.E ~~~~0

X o Xz

I I

FIG. 4. Cell-free translation-arrest assays with methylphosphonate (MP) and DE oligonucleotides in the presence of different modified CAT mRNAs (see Fig. 1). (a) Pur-alt MP or DE oligonucleotides incubated together with a full-length CAT (CU)-alt mRNA and a truncated wild-type CAT mRNA. RNase H (from Escherichia coli) was added to one lane containing 1 MM DE oligomer. These translation reactions were not preannealed. (b) Pur-alt or Pur-rmdl MP oligonucleotides incubated with full-length CAT (CU)-rndl mRNA and truncated CAT (CU)-alt mRNA. Note that truncated CAT (CU)-alt protein migrates farther down the gel than the one of the previous experiment. 2 mm, MPO having the same Pur-rndl sequence except for two A -- T substitutions (sequence = 5'-

AGATAGGGAGIGGGAA-3').

Truncated Fragments

_

Target mRNA

*:so/'

: ::'>

1

5'

,, d!,,;!...

_l

=

CAT(CU)-alt _

(1994)

:.

I l X_

._ _.

I

I Triple strand complex

4

Reverse Transcriptase Primer

3' FIG. 5. Autoradiograph of the cDNA products from avian myeloblastosis virus reverse transcription of modified CAT mRNAs together with various MPOs. Lanes: 1, CAT (CU)-alt mRNA plus control MPO (sequence = 5'-AAGGGGAAGACGGATGGG-3'); 2, CAT (CU)-alt mRNA plus Pur-alt MPO; 3, CAT (C/U)-rndl mRNA alone; 4, CAT (C/U)-rndl plus control MPO (same sequence as in lane 1); 5, CAT (C/U)-rndl plus Pur-rndl MPO.



12437

respect to the Pur-rndl sequence showed no inhibition with any of the mRNA targets. We conclude that randomized all-purine MPOs also have potential for selectively inhibiting protein synthesis. Triple-Strand-Forming MPOs Block Reverse Transcription When Annealed to Complementary mRNA Targets. The two MPOs that inhibited protein synthesis in the cell-free translation arrest assay were also tested for their ability to block cDNA synthesis catalyzed by avian myeloblastosis virus reverse transcriptase. An oligonucleotide primer annealed about 30 nt downstream from the MPO target sites was used to initiate reverse transcription. Fig. 5 shows that the Pur-alt and Pur-rndl MPOs specifically blocked reverse transcriptase. No inhibition was seen in crossover experiments where the MPOs and mRNA targets were switched. A purine-rich control MPO also failed to inhibit transcription from either target. This experiment shows that triple-strand-forming MPOs specifically bind to their intended target sites and can efficiently block the elongation phase of reverse transcrip-

stability of these structures can be explained, at least in part, by a reduction in charge-charge repulsion due the uncharged MPO backbone. This structure appears distinctive in its ability to block protein translation and reverse transcription.

tion.

5. Cazenave, C., Stein, C. A., Loreau, N., Thuong, N. T., Neckers, L. M., Subasinghe, C., Helene, C., Cohen, J. S. & Toulme, J.-J. (1989) Nucleic Acids Res. 17, 4255-4273. 6. Dagle, J. M., Walder, J. A. & Weeks, D. L. (1991) Antisense Res. Dev. 1, 11-20. 7. Agrawal, S., Mayrand, S. H., Zamechnik, P. C. & Pederson, T. (1990) Proc. Natl. Acad. Sci. USA 87, 1401-1405. 8. Milligan, J. F., Matteucci, M. D. & Martin, J. C. (1993) J. Med. Chem. 36, 1923-1937. 9. Gee, J. E. & Miller, D. M. (1992) Am. J. Med. Sci. 304, 366-372. 10. Maher, L. J. 3rd (1992) BioEssays 14, 807-815. 11. Helene, C. & Toulme, J.-J. (1990) Biochim. Biophys. Acta 1049, 99-125. 12. Brossalina, E., Pascolo, E. & Toulme, J.-J. (1993) Nucleic Acids Res. 21, 5616-5622. 13. Rumney, S., IV, & Kool, E. T. (1992) Angew. Chem. Int. Ed. Engl. 31, 1617-1619. 14. Cheng, Y.-K. & Pettit, B. M. (1992) Prog. Biophys. Mol. Biol. 58, 225-257. 15. Sun, J.-S. & Helene, C. (1993) Curr. Opin. Struct. Biol. 3, 345-356. 16. Callahan, D. E., Trapane, T. L., Miller, P. S., Ts'o, P. 0. P. & Kan, L.-S. (1991) Biochemistry 30, 1650-1655. 17. Hausheer, F. H., Singh, U. C., Palmer, T. C. & Saxe, J. D.

DISCUSSION We have shown that two strands of an all-purine MPO are capable of forming high-affinity triple-stranded complexes with complementary single-stranded RNA. These oligonucleotides specifically block protein synthesis by a non-RNase H mechanism when targeted to sites immediately downstream of the initiation codon. Triple-stranded motifs have also been described by other investigators (11-13, 15), with the Watson-Crick and third strands linked together in either a hairpin or circular construction. In these structures, the second and third strands bind in an antiparallel orientation and thus are nonidentical in base sequence. Here we have demonstrated that two identical all-purine MPOs can bind RNA in a 2:1 motif. Our results with randomized all-purine MPOs suggest that the second and third strands can bind in a parallel orientation because the antiparallel orientation permits significantly less hydrogen bonding. We have screened over 35 additional purine-rich antisense MPOs and have found several sequences that also form high-affinity triple-stranded complexes under physiological conditions (M.A.R., T.A.B., M.D.M. and J. A. Jaeger, unpublished results). One such sequence (a 16-mer) contains two thymidines, so it appears that at least one or two pyrimidine bases can be tolerated. We have not been able to observe triple-strand formation with sequences containing a higher percentage of pyrimidines, however. This observation is consistent with earlier studies using mixed-sequence (purine/pyrimidine) MPOs, where concentrations in the range of 20-200 ,uM were required to observe an antisense effect (23, 24). In conclusion, certain polypurine sequences of uncharged MPOs can form stable triple-stranded complexes with singlestranded RNA targets. These complexes are formed in the absence of any protein and do not require the addition of divalent metal ions or multivalent organocations such as spermine or spermidine. Preliminary data indicate that these complexes consist of an unusual triple-strand motif, wherein the two MPO strands bind in a parallel orientation. The

We thank Doreen Bubonovich and Lina Borozdina for preparing some of the synthetic RNA targets used in this study and Timothy Riley, Jody Hasselfield, and Eric Hesselberth of JBL Scientific, San Luis Obispo (a subsidiary of Genta, Inc.) for preparing the MPOs. We also thank Robert Klem, Thomas Adams, John Jaeger, and Robert Brown for scientific support and advice. 1. Milligan, J. F., Mateucci, M. D. & Martin, J. C. (1993) J. Med. Chem. 36, 1923-1937. 2. Bischofberger, N. & Shea, R. G. (1992) Nucleic Acids Targeted Drug Des. 119, 579-612. 3. Walder, R. Y. & Walder, J. A. (1988) Proc. Natl. Acad. Sci. USA 85, 5011-5015. 4. Woolf, T. M., Jennings, C. G., Rebagliati, M. & Melton, D. A.

(1990) Nucleic Acids Res. 18, 1763-1769.

(1990) J. Am. Chem. Soc. 112, 9468-9474. 18. Hogrefe, R. I., Reynolds, M. A., Vaghefi, M. M., Young, K. M., Riley, T. A., Klem, R. E. & Arnold, L. J., Jr. (1993) in Methods in Molecular Biology, Vol. 20: Protocols for Oligonucleotides and Analogs, ed. Agrawal, S. (Humana, Totowa, NY), pp. 143-164. 19. Hogrefe, R. I., McCaffrey, A. P., Borozdina, L. U., McCambell, E. S. & Vaghefl, M. M. (1993) Nucleic Acids Res. 21, 4739-4741. 20. Johnson, W. C. (1985) in Methods ofBiophysical Analysis, ed. Glick, D. (Wiley, New York), Vol. 31, pp. 61-163. 21. Maniatis, T., Fritsch, E. & Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY), 2nd Ed. 22. Melton, D. A. (1984) Nucleic Acids Res. 12, 7035-7056. 23. Smith, C. C., Aurelian, L., Reddy, M. P., Miller, P. S. & Ts'o, P. 0. P. (1986) Proc. Natl. Acad. Sci. USA 83, 2787-2791. 24. Chang, E. H., Miller, P. S., Cushman, C., Devadas, K., Pirollo, K. F., Ts'o, P. 0. P. & Yu, Z. P. (1991) Biochemistry 30, 8283-8286.