Tumor Necrosis Factor- Inhibits Leydig Cell

0013-7227/98/$03.00/0 Endocrinology Copyright © 1998 by The Endocrine Society

Vol. 139, No. 6 Printed in U.S.A.

Tumor Necrosis Factor-a Inhibits Leydig Cell Steroidogenesis through a Decrease in Steroidogenic Acute Regulatory Protein Expression* CLAIRE MAUDUIT, FRANC ¸ OISE GASNIER, CATHERINE REY, ` S CHAUVIN, DOUGLAS M. STOCCO, PIERRE LOUISOT, MARIE-AGNE MOHAMED BENAHMED

AND

INSERM U407 (C.M., M.-A.C., M.B.), Centre Hospitalier Lyon-Sud, 69 495 Pierre Be´nite cedex, France; INSERM U189 (F.G., C.R., P.L.), Faculte´ de Me´decine Lyon-Sud, BP 12, 69 921 Oullins, France; and Department of Cell Biology and Biochemistry (D.M.S.), Texas Tech University Health Sciences Center, Lubbock, Texas 79430 ABSTRACT The aim of the present study was to identify the sites of the inhibitory action of TNFa (tumor necrosis factor alpha) on LH/hCGstimulated testosterone formation. By using cultured porcine Leydig cells as a model, TNFa was shown to inhibit testosterone secretion when testicular cells were stimulated with hCG but not when incubated with 22R-hydroxycholesterol (a cholesterol substrate derivative that readily passes through cell and mitochondrial membranes). Such an observation suggested that the cytokine may affect cholesterol transport and/or availability to cytochrome P450scc in the mitochondria. Specifically, we report here that TNFa reduced in a dose- and

time-dependent manner hCG-induced StAR (steroidogenic acute regulatory protein) levels. The maximal and half-maximal effects were obtained with 20 ng/ml (1.2 nM) and 1.6 ng/ml (0.09 nM) of TNFa, respectively. Maximal inhibitory effects of TNFa on StAR messenger RNA and protein levels were obtained after 48 h of treatment. Additionally, the presence of TNFa receptors P55 in terms of protein (identified through cross-linking experiments) and messenger RNA (identified through RT-PCR analysis) suggested that the effects of the cytokine are directly exerted on the testicular steroidogenic cell type. (Endocrinology 139: 2863–2868, 1998)

I

these TNFa treated male rats would indicate that the detrimental effects of the cytokine are primarily exerted on the testis; 3) by using an in vitro model (i.e. cultured purified Leydig cells) we have shown that TNFa exerted a profound inhibitory effect on LH/hCG stimulated-testosterone formation (10). Together, although these data strongly suggested that TNFa is an inhibitor of testosterone formation under gonadotropin control, the sites of action of the cytokine and the expression of TNFa receptors supporting a direct interaction between the cytokine and the testicular cell type still remain to be identified in Leydig cells. The steroidogenesis process involves at least two mechanisms: 1) transport of cholesterol substrate in the inner mitochondrial membrane, a process that involves probably several mediators and particularly StAR (steroidogenic acute regulatory protein) (11); 2) transformation of cholesterol into testosterone which results from different steroidogenic enzyme activities (12). By using cultured porcine Leydig cells, as an experimental model, we report here that TNFa exerts its inhibitory action on Leydig cell steroidogenesis mainly through a decrease in StAR expression and that such an inhibitory action is probably mediated by TNFa receptor p55 expressed in the testicular cells.

N THE PAST few years, a framework of data has suggested an inhibitory action for tumor necrosis factor -a (TNFa) in male gonadal function, particularly in Leydig cell steroidogenesis. The TNFa that affected Leydig cells could originate from interstitial macrophages (1) and/or from the circulatory system (2). Interstitial macrophages might be activated during an immune challenge or chronic inflammatory diseases, resulting in production of elevated levels of TNFa in the vicinity of the Leydig cells (3). Elevated TNFa levels in the circulatory system have been observed in patients with critical illness, burns, and sepsis (3–5). It is of interest to note that those patients have depressed gonadal function (6, 7). Additionally, more direct observations indicate that TNFa is probably involved in the decrease in male gonadal activity: 1) a severe hypogonadism was observed in male rats injected ip (8) or iv (9) with endotoxin, a substance known to stimulate TNFa production; 2) recombinant human TNFa (2–4 3 105 U/kgz24 h) administration by continuous infusion to male Wistar rats induced a dramatic decline in testosterone concentration and severe seminiferous epithelium damage (2). The increase in LH and FSH levels in Received November 12, 1997. Address all correspondence and requests for reprints to: Claire Mauduit, INSERM U407, Baˆt 3B, Centre Hospitalier Lyon-Sud, 69 495 Pierre Be´nite cedex, France. E-mail: [email protected]. * This work was supported by Institut National de la Sante´ et de la Recherche Me´dicale (INSERM U407 and U189), Ministe`re de l’Education Nationale, de l’Enseignement Supe´rieur et de la Recherche Scientifique (MENESRS), and in part by European Society of Pediatric Endocrinology (ESPE research Fellowship), sponsored by Novo Nordisk A/S (to C.M.). Also acknowledged is NIH Grant HD-17481 (to D.M.S.).

Materials and Methods Materials Human CG (hCG CR 121 13450 IU/mg) was a gift of Dr R. E. Canfield (Rockford, IL). DME-Ham’s F-12 medium, M-MLV and TRIzol were obtained from Life Technologies (Eragny, France). Collagenase/dispase was obtained from Boehringer (Mannheim, Germany), human recom-

2863

2864

TNFa INHIBITS StAR EXPRESSION IN LEYDIG CELLS

binant TNFa was obtained from Prepro Tech (Canton, MA). 22Rhydroxycholesterol (5-cholestene-3b, 22(R)-diol: 22R-hydroxycholesterol), insulin, transferrin, vitamin E, HEPES, and deoxyribonuclease type I (DNase) were purchased from Sigma Chemical Co. (St. Louis, MO). Na125I (IMS 30) and [a32P] dCTP were purchased from Amersham (Aylesbury, UK). Iodo-Gen and disuccinimidyl suberate were obtained from Pierce (Rockford, IL), Taq polymerase from Appligene-Oncor (Illkirch, France), and oligonucleotides primers from Genset (Paris, France).

Endo • 1998 Vol 139 • No 6

ments, cultured Leydig cells were incubated at 4 C for 4 h with 125I-TNFa in a total volume of 0.2 ml. At the end of the incubation, cells were washed three times with ice-cold PBS and incubated with disuccinimidyl suberate (2 mm). After 30 min at 4 C, the cells were washed with PBS and scraped off with scraping buffer (Tris 10 mm, pH 7, sucrose 0.25 m, EDTA 1 mm, PMSF 1 mm, leupeptin 10 mg/ml). After centrifugation (300 3 g, 10 min) proteins were extracted with a triton buffer (Tris 10 mm pH 7, EDTA 0.1 mm, Triton X100 1%, PMSF 1 mm, leupeptin 50 mg/ml) 40 min at 4 C. After a second centrifugation, proteins were analyzed by SDS-PAGE. Dried gels were exposed 15 days to Kodak film.

Leydig cell preparation and culture Leydig cells were prepared from immature porcine testes (2–3 weeks old) by collagenase treatment (13). Briefly, decapsulated testes were minced and washed in DME/Ham’s F-12 medium (1:1). After collagenase dissociation (0.5 mg/ml, 90 min at 32 C), cells were washed by centrifugation (200 3 g for 10 min). The pellet was then resuspended and submitted to two successive sedimentations of 5 and 15 min. The crude interstitial cells were recovered from the supernatants, and Leydig cells were prepared from this fraction by Percoll gradient centrifugation. The purity of Leydig cells was more than 90%, as determined by histochemical 3b-hydroxysteroid dehydrogenase staining. Leydig cells were plated in Falcon (Los Angeles, CA) 24-multiwell plates (0.5 3 106 cells/ dish) and cultured at 32 C in a humidified atmosphere of 5% CO2, 95% air in DME/Ham’s F-12 medium (1:1) containing sodium bicarbonate (1.2 mg/ml), 15 mm 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES), and gentamicin (20 mg/ml). This medium was supplemented with insulin (2 mg/ml), transferrin (5 mg/ml), and a-tocopherol (10 mg/ml).

Testosterone measurement Testosterone levels were measured in the culture medium by using a previously reported specific RIA (14).

Western blot analysis StAR protein contents in whole Leydig cells and in isolated mitochondria were identified through Western blot analysis. For isolation of mitochondria, the harvested cells were pelleted by centrifugation at 200 3 g for 10 min. The pelleted cells were resuspended in ice-cold buffer A consisting of 275 mm sucrose, 10 mm Tris-HCl, pH 7.4, 1 mm EDTA (0.5 ml of buffer/75 3 106 cells), and homogenized with a Teflon homogenizer. Cellular fragments and nuclei were removed from homogenates by centrifugation at 960 3 g for 15 min. The pellet was resuspended in buffer A, homogenized, and centrifuged under the same conditions. The supernatants were pooled and centrifuged at 8,600 3 g for 15 min to yield the mitochondrial pellet. To purify mitochondria, the crude mitochondrial pellet was suspended in isolation buffer and centrifuged at 960 3 g for 3 min. The resultant supernatant was centrifuged twice at 8,600 3 g for 15 min. Proteins from whole Leydig cells and isolated mitochondria were resolved on 12% SDS/polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes using 25 mm Tris, 185 mm glycine, pH 8.3, containing 20% methanol. The transfer was performed at a constant voltage of 100 V for 45 min. Following transfer, the membrane was incubated in a blocking buffer (TBS buffer containing 10% nonfat dry milk) overnight at 4 C. The membrane was rinsed three times with TBS/Tween 0.1% (3 3 10 min), then incubated with an antibody raised against a ten amino acid peptide (88 –98) of the 30 kDa StAR protein (1/1000 dilution in TBS containing 2% nonfat dry milk) for 1 h at room temperature. The membrane was rinsed with TBS/Tween 0.1% (3 3 10 min) and then incubated with horseradish peroxidase-labeled goat antirabbit IgG (CovalAb, 1/1000 dilution in TBS containing 2% nonfat dry milk) for 1 h at room temperature. The membrane was thoroughly washed with TBS/Tween 0.1% (3 3 10 min) and then with TBS. Bound antibodies were detected by chemiluminescence using a CovalAb detection kit and Biomax MR film from Kodak. Protein concentration was determined by the Bradford assay (15).

I-TNFa binding and affinity cross-linking experiments

125

TNFa was labeled with carrier-free Na125I by the Iodo-Gen method (16) and had a specific activity of 1700 Ci/mmol. For binding experi-

RNA extraction Total RNAs were extracted from porcine Leydig cells with TRIzol reagent, a mono-phasic solution of phenol and guanidine isothiocyanate. This reagent is an improvement to the single-step RNA isolation developed by Chomczynski and Sacchi (17). The amount of RNA was estimated by spectophotometry at 260 nm.

RT-PCR analysis Single stranded complementary DNAs (cDNAs) were obtained from reverse transcription of 3 mg of total RNAs using random hexanucleotides as primer (5 mm), in the presence of dNTP (0.2 mm), dithiothreitol (10 mm) and M-MLV (10 U/ml), 1 h at 37 C. cDNA (1 ml of RT mixture) were amplified by PCR with Taq polymerase (0.01 U/ml), dNTP (50 mm), and specific primers (2 mm). The mixture was first heated at 92 C for 3 min and then 25 cycles of 92 C for 30 sec, 57 C for 30 sec, 70 C for 30 sec, then 70 C for 5 min. PCR products were analyzed on 2% agarose gel and visualized using a UV (254 nm) table (Applige`ne). Intensities bands were estimated by densitometric scanning using the BioImage scanner (BioImage, Cheshire, UK). The data were expressed as StAR/bactin messenger RNAs (mRNAs) ratio. The oligonucleotides primers for StAR were: 59TGGAGAGGCTTTATGAGGAGC39 (forward), 59GCCAGGTGAGTTTGGTCTTCG39 (reverse). StAR amplified products were 337 bp. The oligonucleotides primers for bactin were (18): 59TTGCTGATCCACATCTGCTG39 (forward), 59GACAGGATGCAGAAGGAGAT39 (reverse). bactin amplified products were 146 bp. The oligonucleotides primers for TNFa R55 were: 59TGCTGCACCAAGTGCCACAAAG39 (forward), 59CAGATGGTGTCCTGTTTCTTC39 (reverse). R55 amplified products were 326 bp. The oligonucleotides primers for TNFa R75 were: 59CTCTTCCAGTTGGACTGATTG39 (forward), 59TCTCCAGGGAGCTGCTGCTG39 (reverse). R75 amplified products were 221 bp. PCR analysis for StAR and bactin were carried out from the logarithmic phase of amplification. PCR amplified products were checked by restriction enzymes. RT-PCR primers were designed inside separate exons to avoid any bias due to residual genomic contamination. Moreover, for all primers, no amplification was observed when PCR was performed on RNA preparations. For the figures, scanned images were inverted.

Northern blot analysis About 15 mg of total RNA (denaturated 15 min at 65 C in the presence of formaldehyde 2.2 m, formamide 12.5 m, 1 3 3(N-morpholino)propanesulfonic acid: MOPS) were electophoresed on 1.2% agarose/2.2 m formaldehyde gel. After migration in 0.02 m MOPS running buffer, RNAs were transferred to nitrocellulose membrane Hybond-C extra (Amersham, UK) in 10 3 SSC (1.5 m NaCl, 0.15 m sodium citrate) and fixed at 80 C for 2 h. cDNA probes (StAR, 1.6 kb NotI-SalI and GAPDH, 1.7 kb PstI) were labeled with 30 mCi of [a32P] dCTP (SA, 109 dpm/mg DNA) using a random primed labeling kit (Promega, Madison, WI). Labeled probes were separated from free nucleotides by a G50 spin column. After 3 h of prehybridation at 42 C, filters were hybridized with labeled probe (1– 4 3 106 cpm/ml) overnight at 42 C in 50% formamide, 5 3 SSPE (0.9 m NaCl, 50 mm sodium phosphate, 5 mm EDTA, pH 7.4), 5 3 Denhardt’s solution (1 g Ficoll, 1 g polyvinylpyrrolidone, 1 g BSA/ liter), 1% SDS and 100 mg/ml herring sperm DNA. Afterward, membranes were washed four times in 2 3 SSC, 0.1% SDS (20 min, RT), followed by 40 min at 55 C. Filters were exposed to Kodak X-OMAT S films at 270 C for 1–2 days. Intensities of autoradiographic bands were estimated by densitometric scanning using the BioImage scanner (BioImage). The data were expressed as StAR/GAPDH mRNAs ratio.


2865

Data analysis All experimental data are presented as the mean 6 sd of triplicate determinations of three replicate cultures within each treatment group. All experiments reported here were repeated at least three times with independent cell preparations. A representative experiment of each series of experiments is presented. Statistical significance between groups was determined by Student’s t test using the StatWorks (Hyden and Son Ltd, London, UK) package on a Macintosh computer. Differences are accepted as significant at P , 0.05.

Results TNFa inhibited cholesterol mobilization

In cultured Leydig cells, TNFa (20 ng/ml, 72 h) had no effect on basal testosterone secretion (Fig. 1). The cytokine inhibited (90% decrease, P , 0.001) testosterone production when Leydig cells were stimulated with LH/hCG (3 ng/ml, 3 h), but not when incubated with a cholesterol substrate derivative, which readily passes through cell and mitochondrial membranes (22R-hydroxycholesterol, 5 mg/ml, 2 h) (Fig. 1). These data suggest that the inhibitory action of TNFa resulted from an antagonistic interaction with the steroidogenic activity of LH/hCG. The disappearance of the inhibitory action of the cytokine in the presence of a cholesterol substrate derivative, which is readily diffusable to the inner mitochondrial membrane, without any active transport, suggests that TNFa may exert an inhibitory action on cholesterol transport. Together these observations make StAR a potential target for TNFa action in Leydig cells.

FIG. 2. Dose effect of TNFa on StAR mRNA expression. Leydig cells were cultured for 48 h in the presence of increasing concentrations of TNFa (0 – 60 ng/ml) before being stimulated with hCG (3 ng/ml, 6h). RT-PCR experiments were conducted as described in Materials and Methods. Upper panel, Data obtained by scanning three RT-PCR and expressed as StAR/bactin mRNA ratios. Values are the means 6 SD (n 5 3); lower panel, a representative RT-PCR is shown.

TNFa effects on StAR mRNA

TNFa inhibited in a dose-dependent manner StAR mRNA levels as shown through RT-PCR (Fig. 2) approach. The maximal inhibitory (P , 0.001) effect of the cytokine was observed with 20 ng/ml, 1.17 nm (Fig. 2), and the IC50 was obtained with 1.6 ng/ml (0.09 nm). Such an inhibitory effect of the cytokine (20 ng/ml, 48 h) was also observed when StAR was identified through Northern blot analysis (mRNA size: 4.4 kb, 2.7 kb, Fig. 3). As expected, hCG induced a rapid (2 h) significant (P , 0.001) enhancement of StAR mRNA levels (Fig. 4). As depicted in Fig. 4, TNFa had no effect on hCG-induced StAR expression between 0.5 and 6 h. However, long-term treatment with TNFa (20 ng/ml) resulted in a time-dependent

FIG. 3. Effect of TNFa on StAR mRNA expression. Leydig cells were cultured for 48 h in the presence of TNFa (20 ng/ml) before being stimulated with hCG (3 ng/ml, 6 h). Total cellular mRNAs were then extracted and Northern blotting was performed using 15 mg total RNA per lane. Membranes were successively hybridized with StAR and GAPDH cDNA. Upper panel, Data obtained by scanning three autoradiographs and expressed as StAR/GAPDH mRNA ratios. Values are the means 6 SD (n 5 3); lower panel, a representative Northern blot is shown. FIG. 1. Effect of TNFa on testosterone production. Leydig cells were cultured in the absence (basal) or presence of TNFa (20 ng/ml, 72 h) before being incubated with 22R-hydroxycholesterol (Chol, 5 mg/ml, 2h) or hCG (3 ng/ml, 3 h). The results represent the mean 6 SD of three separate determinations in three different dishes.

decrease of StAR mRNA. The effect of the cytokine was detected at 24 h (P , 0.01) and was maximal at 48 h (P , 0.004) (Fig. 5).

2866


FIG. 4. Short-term time course study of TNFa on StAR mRNA expression. Leydig cells were cultured in the absence or presence of TNFa (20 ng/ml) and in the presence of hCG (3 ng/ml) for 0.5 to 6 h. RT-PCR experiments were conducted as described in Materials and Methods. Upper panel, Representative RT-PCR is shown; lower panel, data obtained by scanning three autoradiographs and expressed as StAR/bactin mRNA ratios. Values are the means 6 SD (n 5 3).

Endo • 1998 Vol 139 • No 6

FIG. 6. Effect of TNFa on StAR protein expression. A, Integrated intensities of StAR protein (from whole Leydig cells, 200 mg in each sample) Western blotted from four individual experiments are presented (ND, not detectable). Amplitudes of integrated intensities may vary with exposure time between blots, thus all four experiments are shown. For the experiments, Leydig cells were cultured in the absence or presence of TNFa (20 ng/ml, 48 h) and incubated in the absence or presence of hCG (3 ng/ml, 3 h). B, Representative Western blot from whole Leydig cells is shown. C, Representative Western blot from mitochondrial proteins (50 mg, in each sample) is shown.

FIG. 5. Long-term time course study of TNFa on StAR mRNA expression. Leydig cells were cultured in the absence or presence of TNFa (20 ng/ml) for 6 –72 h before being stimulated with hCG (3 ng/ml, 6 h). RT-PCR experiments were conducted as described in Materials and Methods. Upper panel, Data obtained by scanning three autoradiographs and expressed as StAR/bactin mRNA ratios. Values are the means 6 SD (n 5 3); lower panel, representative RT-PCR is shown.

TNFa effects on StAR protein

Figure 6A gives a summary of immunoblot analysis of StAR protein accumulation in porcine Leydig cells treated with hCG, TNFa, and their combination. As expected, StAR protein levels were markedly increased (at least 3-fold in the four experiments) in hCG-treated cells compared with untreated control cells. TNFa treatment of Leydig cells abolished the hCG-induced increase in StAR expression (the inhibition reaching at least 63% in the four experiments). TNFa, after 48 h of treatment, inhibited hCG-induced StAR protein expression with a similar pattern in whole Leydig cells (Fig. 6B) and isolated mitochondria (Fig. 6C). Maximal inhibitory effects of TNFa on StAR protein were obtained after 48 h of treatment (data not shown). TNFa receptors

TNFa receptors were identified in terms of proteins and mRNAs. Cross-linking experiments showed a unique band of 72 kDa (Fig. 7A, lane 1). This band was specific in that it disappeared in the presence of an excess (50 nm) of unlabeled

FIG. 7. Characterization of TNFa receptors in Leydig cells. A, Leydig cells were incubated at 4 C for 4 h in the presence of saturating amounts of 125I-TNFa and without (lane 1) or with TNFa (lane 2, 50 nM). After cross-linking reaction, proteins extracted from cells were analyzed by SDS-PAGE and subjected to autoradiography. B, After extraction of RNA from cultured Leydig cells, RT-PCR experiments were conducted as described in Materials and Methods.

TNFa (Fig. 7A, lane 2). According to the observation of Hohmann et al. (19), cross-linked products were generated by a single cross-linking reaction involving one (17 kDa) of the three TNFa molecules of the bound trimer and the receptor protein. This suggests, therefore, a molecular mass of about 55 kDa (for the 72 kDa cross-linked product in Fig. 7A), which is related to the p55 form of the cytokine receptor. In these experiments, no other cross-linked product giving rise to a higher molecular mass receptor was detected even after a longer exposure (60 days). The p55 receptor was also detected in terms of mRNA.


Indeed, RT-PCR for p55 receptor demonstrates the presence of a single band in Leydig cells (Fig. 7B). By using RT-PCR analysis, we were not able to detect transcripts for p75 receptor in this testicular cell type (Fig. 7B). Discussion

Although the conversion of cholesterol into pregnenolone has been considered as the rate limiting step of steroidogenesis for a long time, recent findings suggest that the rate limiting step is the delivery of the cholesterol substrate to P450scc. Cholesterol transport can be thought of as occurring in two separate processes. The first part of the process is the mobilization of cholesterol from cellular stores to the outer mitochondrial membrane, whereas the second part consists of the transfer of cholesterol from the outer to the inner mitochondrial membrane (for review, see Ref. 11). Different mechanisms have been involved in the transport of cholesterol. For the mobilization of cholesterol from cellular stores to the mitochondrial outer membrane, cytoskeleton and particularly intermediate filaments (20) have been implicated, as well as SCP2 (Sterol Carrier Protein 2), a nonspecific lipid transfer protein (21). While not completely understood, the mitochondrial step has received considerable enlightenment over the past few years. Three proteins seem to be at play: SAP (steroidogenesis activator peptide), a peptide isolated from mitochondria may play a role in cholesterol transfer (22), PBR (peripheral benzodiazepine receptor), and VDAC (voltage dependent anion channel) may associate at particular areas of mitochondria, the contact sites, to favor cholesterol transfer (23) and StAR (steroidogenic acute regulatory protein), a mitochondrial protein that favors the translocation of cholesterol across the intermembrane space (24). StAR seems to have a great importance in cholesterol transportation because this protein is under both acute (25) and chronic regulation by hCG, its expression is restricted to steroidogenic tissues and a nonsense mutation leads, in humans, to an absence of steroid production (congenital lipoid adrenal hyperplasia, 26) The aim of the present study was to clarify whether the anti-LH action of TNFa on testosterone formation was related to a regulatory action on StAR expression. Indeed, we (10) and others (27–29), using Leydig cells from porcine (10), mouse (27, 28), and rat (29) testis, have reported that TNFa inhibited LH/hCG-induced (10) or cAMP-induced (27, 28) testosterone production. Indeed, to inhibit LH-induced testosterone production, TNFa has been shown to involve different mechanisms such as redistribution of the cytoskeleton elements (our unpublished data), and steroidogenic enzymes (for example P450scc and P450c17 in mouse/rat Leydig cells, 27–29). That an inhibitory action on cholesterol transport was probably also involved in TNFa action was suggested by the fact that incubation of Leydig cells with 22R-hydroxycholesterol (a cholesterol substrate derivative that readily passes through cell membranes) reversed most of the inhibitory effects of TNFa. According to these observations, we have identified, in the present study, StAR as a target for TNFa action in Leydig cells. Indeed, TNFa decreased hCG-induced StAR mRNA and protein levels in Leydig cells. In previous experiments, we show that TNFa maximal inhibitory effect

2867

on hCG-induced testosterone production was obtained after 48 h of treatment (10). TNFa inhibitory action on StAR levels (the present study) and on testosterone production (10) were kinetically similar (48 h), reinforcing the idea that the decrease in StAR expression is a crucial target of the cytokine during its inhibitory action on Leydig cell steroidogenesis. TNFa must be considered now as one of the major factors involved in the regulation of StAR expression, including also insulin-like growth factor I (30) and LPS (31). Indeed, insulinlike growth factor I, a growth factor involved in maturation and differentiation of granulosa cells, increases steroidogenesis in those cells by enhancing, synergistically with FSH, StAR mRNA and protein expression (30). As for endotoxin, ip injection of LPS to male mouse induces a rapid (within 2 h) and a prolonged (up to 9 days) decrease in serum testosterone level (31). The early depression of serum testosterone seems to be associated with a decrease in StAR protein levels only while the prolonged decrease corresponds to a inhibition of P450c17 protein and mRNA levels in Leydig cells (31). These discrepancies between action of LPS (31) and TNFa (our present study) on StAR expression are not known. However, it could be due to species specificity (mouse vs. pig) because in mouse Leydig cells TNFa inhibited LH-induced testosterone production by decreasing P450c17 expression (27), whereas in porcine Leydig cells, TNFa decrease StAR protein and mRNA expression (the present study). TNFa inhibitory action on StAR levels occurred at a concentration (0.09 nm) compatible with the Kd range of the cytokine binding sites found on Leydig cells (10). These observations suggest a direct action of TNFa on Leydig cells. Indeed, it is reported here that TNFa may use the p55 receptor (rather the p75 receptor) in porcine Leydig cells because protein and mRNA of this receptor type were found in this testicular cell type. P55 receptors have been implicated in many biological processes triggered by TNFa including cytokine production in fibroblasts (32) and anti-FSH action in Sertoli cells (33). The p75 receptors have also been associated, at high abundance, with cell death (34). With regard to the mechanisms involved in the negative effect of TNFa on StAR mRNA levels, it might be due to a decrease in the transcriptional activity and/or mRNA stabilization. TNFa may affect StAR gene expression through interactions, with transcriptional factors that might bind to the StAR gene promoter (35, 36). In this context, TNFa may antagonize the cAMP production and/or the cAMP action, i.e. induction of proteins that regulate StAR gene transcription such as SF-1 (steroidogenic factor-1), which has been shown to regulate, in human, StAR gene expression (36, 37). Indeed, in the experimental model used here, we have previously shown that TNFa inhibited both cAMP formation induced by LH/hCG and cAMP action (through 8-bromocAMP, 10). As TNFa activates different intracellular signaling pathways (protein kinase C, sphingomyelinase, NFkB, 34), it remains to be determined which of these pathways (negatively) cross-talks with the cAMP pathway under the control of LH/hCG. In summary, by using a model of cultured porcine Leydig cells, we have shown that the inhibitory action of TNFa on LH/hCG-induced testosterone formation might be exerted

2868


through a decrease in StAR expression, probably, mediated via the p55 receptor type. References 1. Moore C, Hutson JC 1994 Physiological relevance of tumor necrosis factor in mediating macrophages-Leydig cell interactions. Endocrinology 134:63– 69 2. Mealy K, Robinson B, Millette CF, Majzoub J, Wilmore DW 1990 The testicular effects of tumor necrosis factor. Ann Surg 211:470 – 475 3. Damas P, Reuter A, Gysen P, Demonty J, Lamy M, Franchimont P 1989 Tumor necrosis factor and interleukin-1 serum levels during severe sepsis in humans. Crit Care Med 17:975–978 4. Calandra T, Baumgartner JD, Grau GE, Wu MM, Lambert PH, Schellekens J, Verhoef J, Glauser MP 1990 Kinetics and prognostic values of tumor necrosis factor/cachectin, interleukin-1, a-interferon and g-interferon in the serum of patients with septic shock. J Infect Dis 161:982–987 5. Cannon JG, Thompkins RG, Gelfand JA, Michie HR, Stanford GG, van der Meer JWM, Endres S, Lonnemann G, Corsetti J, Chernow B, Wilmore DW, Wolff SM, Burke JF, Dinarello C 1990 Circulating interleukin-1 and tumor necrosis factor in septic shock and experimental endotoxin fever. J Infect Dis 161:79 – 84 6. Vogel AV, Peake GT, Rada RT 1985 Pituitary-testicular axis dysfunction in burned men. J Clin Endocrinol Metab 60:658 – 665 7. Woolf PD, Hamill WR, McDonald JV, Lee LA, Kelly M 1985 Transient hypogonadotropin hypogonadism caused by critical illness. J Clin Endocrinol Metab 60:444 – 450 8. Tulassay Z, Viczian M, Bojthe L, Czeizel A 1970 Quantitative histological studies on the injury of spermatogenesis induced by endotoxin in rats. J Reprod Fertil 22:161–164 9. Christeff N, Auclair M, Benassayag C 1987 Endotoxin-induced changes in sex steroid levels in male rats. J Steroid Biochem 26:67–71 10. Mauduit C, Hartmann DJ, Chauvin MA, Revol A, Morera AM, Benahmed M 1991 Tumor necrosis factor a inhibits gonadotropin action in cultured porcine Leydig cells: site(s) of action. Endocrinology 129:2933–2940 11. Stocco D, Clark B 1994 Regulation of the acute production of steroids in steroidogenic cells. In: Verhoeven G, Habenicht U-F (eds) Molecular and Cellular Endocrinology of the Testis. Springer-Verlag, Berlin, pp 67–98 12. Payne AH 1990 Hormonal regulation of cytochrome P450 enzymes, cholesterol side-chain cleavage and 17a-hydroxylase/C17–20lyase in Leydig cells. Biol Reprod 42:399 – 404 13. Benahmed M, Morera AM, Chauvin MA, de Peretti E 1987 Somatomedin C/insulin-like growth factor 1 as a possible intratesticular regulator of Leydig cell activity. Mol Cell Endocrinol 50:69 –77 14. Forest MG, Cathiard AM, Bertrand J 1973 Total and unbound testosterone levels in the newborns and normal hypogonadal chidren: use of sensitive radio-immunoassay for testosterone. J Clin Endocrinol Metab 36:1132–1142 15. Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248 –254 16. Tyszywski GP, Knight LC, Kornecki E, Srivastava S 1983 Labeling of platelet surface proteins with 125I by the iodogen method. Anal Biochem 130:166 –170 17. Chomczynski P, Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156 –159 18. Chatelain G, Brun G, Michel D 1995 Screening of homozygous transgenic mice by comparative PCR. Biotechniques 18:959 –961

Endo • 1998 Vol 139 • No 6

19. Hohmann HP, Brockaus M, Baeuerle PA, Remy R, Kolbeck R, van Loon APGM 1990 Expression of the types A and B tumor necrosis factor (TNF) receptors is independently regulated, and both receptors mediate activation of the transcription factor NF-kappa B. J Biol Chem 265:22409 –22417 20. Almahbobi G, Williams LJ, Han X-G, Hall PF 1993 Binding of lipid droplets and mitochondria to intermediate filaments in rat Leydig cells. J Reprod Fertil 98:209 –217 21. Vahouny GV, Dennis P, Chanderbhan R, Fiskum G, Noland BJ, Scallen TJ 1984 Sterol carrier protein2 (SCP2)-mediated transfer of cholesterol to mitochondrial inner membranes. Biochem Biophys Res Commun 122:509 –515 22. Pedersen RC, Brownie AC 1987 Steroidogenesis-activator polypeptide isolated from a rat Leydig cell tumor. Science 236:188 –190 23. Papadopoulos V 1993 Peripheral-type benzodiazepine/diazepam binding inhibitor receptor: biological role in steroidogenic cell function. Endocr Rev 14:222–240 24. Clark BJ, Wells J, King SR, Stocco DM 1994 The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells. Characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 269:28314 –28322 25. Clark BJ, Soo SC, Caron KM, Ikeda Y, Parker KL, Stocco DM 1995 Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol Endocrinol 9:1346 –1355 26. Lin D, Sugawara T, Strauss III JF, Clark BJ, Stocco DM, Saenger P, Rogol A, Miller WL 1995 Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 267:1828 –1831 27. Xiong Y, Hales DB 1993 The role of tumor necrosis factor-alpha in the regulation of mouse Leydig cell steroidogenesis. Endocrinology 132:2438 –2444 28. Li X, Youngblood GL, Payne AH, Hales DB 1995 Tumor necrosis factor-a inhibition of 17a-hydroxylase/C17–20 lyase gene (Cyp17) expression. Endocrinology 136:3519 –3526 29. Lin T, Wang D, Nagpal ML, Chang W 1994 Recombinant murine tumor necrosis factor-alpha inhibits cholesterol side-chain cleavage cytochrome P450 and insulin-like growth factor I gene expression in rat Leydig cells. Mol Cell Endocrinol 101:111–119 30. Balasubramanian K, Lavoie HA, Garmey JC, Stocco DM, Veldhuis JD 1997 Regulation of porcine granulosa cell steroidogenic acute regulatory protein (StAR) by insulin-like growth factor I: synergism with follicle-stimulating hormone or protein kinase A agonist. Endocrinology 138:433– 439 31. Bosmann HB, Hales KH, Li X, Liu Z, Stocco DM, Hales DB 1996 Acute in vivo inhibition of testosterone by endotoxin parallels loss of steroidogenic acute regulatory (StAR) protein in Leydig cells. Endocrinology 137:4522– 4525 32. Vandenabeele P, Declercq W, Beyaert R, Fiers W 1995 Two tumor necrosis factor receptors: structure and function. Trends Cell Biol 5:392–399 33. Mauduit C, Jaspar JM, Poncelet E, Charlet C, Revol A, Franchimont P, Benahmed M 1993 Tumor necrosis factor a antagonizes follicle-stimulating hormone action in cultured porcine Sertoli cells. Endocrinology 133:69 –76 34. Bazzoni F, Beutler B 1996 The tumor necrosis factor ligand and receptor families. N Engl J Med 334:1717–1725 35. Caron KM, Ikeda Y, Soo SC, Stocco DM, Parker KL, Clark BJ 1997 Characterization of the promoter region of the mouse gene encoding the steroidogenic acute regulatory protein. Mol Endocrinol 11:138 –147 36. Sugawara T, Holt JA, Kiriakidou M, Strauss III JF 1996 Steroidogenic factor 1-dependent promoter activity of the human steroidogenic acute regulatory proteine(StAR) gene. Biochemistry 35:9052–9059 37. Sugawara T, Kiriakidou M, McAllister JM, Holt JA, Arakane F, Strauss III JF 1997 Regulation of expression of the steroidogenic acute regulatory protein (StAR) gene: a central role for steroidogenic factor 1. Steroids 62:5–9