kines tumor necrosis factor-or (TNF-a), interleuldn-l [3 (IL-1t9), and interleuldn-6 (IL-6). ... Esophagus. 2. 1. 2 ... ulin secretion (18), and production of acute-phase.
Digestive Diseases and Sciences, Vol, 37, No. 6 (June 1992), pp. 818-826
Tumor Necrosis Factor-a, Interleukin- 113, and Interleukin-6 Expression in Inflammatory Bowel Disease CHRIS STEVENS, MD, GERD WALZ, MD, CHANDER SINGARAM, MD, MARK L. LIPMAN, MD, BERND ZANKER, MD, ALDO MUGGIA, MD, DONALD ANTONIOLI, MD, MARK A. PEPPERCORN, MD, and TERRY B. STROM, MD
The etiology of ulcerative colitis (UC) and Crohn's disease (CD) remains enigmatic. Infiltrating intestinal macrophages are capable of producing the proinflammatory cytokines tumor necrosis factor-or (TNF-a), interleuldn-l [3 (IL-1t9), and interleuldn-6 (IL-6). We investigated the presence of lL-6, TNF-a and IL-l fl mRNA transcripts in inflammatory bowel disease (IBD), normal, and other inflammatory intestinal specimens utilizing the polymerase chain reaction (PCR). TNF-a mRNA levels did not vary between inflammatory bowel disease and control specimens. IL-l fl mRNA levels were highest in active UC and noninflammatory bowel disease inflammatory specimens while IL-6 mRNA levels were highest in active IBD specimens. Infiltrating T cells, macrophages, and B cells were identified as sources of IL-6 protein in inflammatory bowel disease specimens by immunofluorescent staining. IL-6 transcripts were elevated only in active inflammatory bowel disease specimens, suggesting that IL-6-mediated immune processes are ongoing in the inflammatory mucosal environment of CD and UC. KEY WORDS: Crohn's disease; ulcerative colitis; polymerase chain reaction; interleukin-6; interleukin-I ; tumor necrosis factor.
The mucosal inflammatory response in IBD is thought to be either an appropriate reaction to an as yet unidentified antigen(s) or is the result of an aberrant immune system. Whatever the instigating factors, the observed result seen within the bowel wall is a prominant cellular infiltrate composed of Manuscript received June 17, 1991; revised manuscript received December 18, 1991; accepted December 27, 1991. From the Department of Medicine, Center for Inflammatory Bowel Disease, Beth Israel Hospital and Harvard Medical School, Boston, Massachusetts 02215. Supported by grants from the NIH, Crohn's and Colitis Foundation of America, Inc., Medical Research Council of Canada, and Deutsche Forschungsgemeinschaft. Address for reprint requests: Dr. Chris Stevens, Beth Israel Hospital, Departments of Gastroenterology and Clinical Immunology, Dana Bldg., Room 501, 330 Brookline Ave., Boston, Massachusetts 02215.
818
neutrophils, plasma cells, mast cells, lymphocytes, and macrophages. The activation products of these inflammatory cells contribute to the epithelial intestinal damage and ultimate clinical disease. Elevation in prostaglandins (1), leukotrienes (2), active oxygen species (3), and the finding of anti-colon antibodies (4) and cytotoxic lymphocytes in the involved intestine have been identified in IBD patients (5). Peripheral blood monocytes isolated from IBD patients manifest increased motility and phagocytosis, and elaborate lysosomal enzymes, indicating that circulating monocytes are activated in IBD patients (6). Interleukin-1 (IL-1), interleukin-6 (IL6), and tumor necrosis factor (TNF) are three immune modulators termed cytokines produced by Digestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
0163-2116/92/0600-0818506.50/09 1992PlenumPublishingCorporation
CYTOKINES IN INFLAMMATORY BOWEL DISEASE TABLE 1. INTESTINAL SPECIMENS ANALYZED FOR EACH CYTOKINE IN STUDY GROUPS Medicationt Specimen
IL-6
IL-l fl
TNF-a
S/E*
Crohn's active Ileum Duodenum Crohn's inactive Ileum Colon UC active
5 4 1 6 4 2 12
4 3 1 4 4 0
5 4 1 6 4 2 12
4/1
UC inactive Non-IBD inflammatory Esophagitis Gastritis Duodenitis Appendicitis Normals total Colon Esophagus Antrum Duodenum
7 9 3 3 2 1 10 5 2 2 1
7 2 9 3 3 2 1 6 5 1 0 0
7 9 3 3 2 1 10 5 2 2 1
C
S
M
2 0/1 2/2 0/2 3/9 3/4 0/7 1/8 0/3 0/3 0/2 1/0 2/8 2/3
4 4 3 0
*Surgery/endoscopy. tC, corticosteroids; S, sulfasalazine; M, mesalamine enemas. macrophages whose functions have been elucidated over the past decade. IL-1, as well as IL-6, can provide a second signal for T-cell activation (7). Expression of IL-1 supports B-cell activation and differentiation, augments N K cell cytolytic activity, and is directly toxic to certain cell lines (8). IL-1 promotes fibrosis by stimulating fibroblast mitogenesis and increasing the transcription of type I, type III, and type IV collagen (9). When compared to normal controls, bioassay and ELISA measurements reveal that increased levels of IL-1 protein are present in intestinal supernatants of cultured intestinal tissue and intestinal mononuclear cells extracted from IBD patients (10, 11). Distinct alpha and beta TNF polypeptides have been characterized (12). TNFct promotes T-cell and B-cell proliferation and differentiation (13, 14). TNF-ct is inextricably linked to the toxic shock syndrome (15) and has been detected in multiple sclerosis plaques (16). IL-6 is a pleiotropic cytokine produced by monocytes, macrophages, and also by activated T cells, B cells, fibroblasts, endothelial cells, chondrocytes, and mesangial cells (17). IL-6 promotes terminal differentiation of B cells, induction of immunoglobulin secretion (18), and production of acute-phase proteins by hepatocytes (19). IL-6 provides costimulatory T-cell activation signals, which in turn support IL-2 mRNA transcription. IL-6 also promotes Digestive Diseases and Sciences, Vol. 37, No. 6 (Jane 1992)
the cytolytic capacity of cytotoxic T cells (20) and NK cells (21). IL-6 expression has been implicated in the pathogenesis of mesangial proliferative glomerulonephritis (22), multiple myeloma (23), rheumatoid arthritis (24), and cardiac myxoma (25). Expression of TNF-ot, IL-113, and IL-6 transcripts have not been reported in intestinal specimens obtained from IBD patients. Therefore we chose to investigate these Cytokine transcripts most likely to be produced by macrophages in the intestinal mucosa of IBD patients. MATERIALS AND METHODS
Experimental Design. Patients were selected for study from three categories~ (1) IBD; (2) other gastrointestinal inflammatory diseases---esophagitis (N = 3), gastritis (N = 3), duodenitis (N = 2), appendicitis (N = I); and (3) subjects lacking inflammatory or neoplastic diseases of the bowel (Table 1). In each case of CD and UC the diagnosis was confirmed by clinical, radiographic, endoscopic, and histologic criteria (26). Non-IBD inflammatory diagnoses were based upon endoscopic findings and histology revealing active inflammation. The study was approved by the committee on clinical investigation of Beth Israel Hospital. Informed consent was obtained from patients undergoing endoscopy. Surgical resections and endoscopic biopsy samples were studied. Three endoscopic biopsies each were taken from normal areas and areas of gross inflammation in patients with IBD or other inflammatory diseases. Patients undergoing colonoscopy for cancer surveillance or esophagogastroduodenoscopy for evaluation of abdominal pain were
819
STEVENS ET AL selected as normal controls. Similarly three biopsies were obtained from a grossly normal site in these patients. Specimens of bowel resected for neoplasia were taken > 8 cm from any histologically abnormal lesions. Only those specimens that manifested absolutely normal histology by hematoxylin and eosin staining without cryptitis, granulomas, or increased inflammatory cell populations were included in the normal group. Giemsa stains were performed on all normal tissues to specifically investigate the possibility of mast cell degranulation, which was not seen in any normal specimen. IBD and non-IBD inflammatory samples were interpreted as either moderately or severely active by a gastrointestinal pathologist. Two of the biopsies from each site were immediately frozen in liquid nitrogen and reserved for subsequent RNA extraction. The third biopsy was placed in Zamboni's fixative and processed into frozen sections in preparation for immunofluorescent staining. Materials. Polyclonal rabbit anti-human IL-6 (Genzyme, Boston, Massachusetts) and monoclonal mouse anti-human anti-CD3, anti-CD22 (Becton Dickinson, Mountainview, California), and MO-2 (Coulter Immunology, Hialeah, Florida) were used as the primary antibodies in the immunofluorescent technique. Fluorescein isothiocyanate (FITC) -conjugated goat anti-rabbit and rhodamine isothiocyanate (RITC) -conjugated goat antimouse secondary antibodies were purchased from Calbiochem (La Jolla, California). Full-length IL-113 and TNF-a cDNAs were a generous gift from Charles Dinarello (Tufts University, Boston, Massachusetts) and IL-6 cDNA was kindly provided by Steve Clark (Genetics Institute, Cambridge, Massachusetts). Culture reagents included phytohemagglutinin (PHA, Wellcome Diagnostics, Dartford, UK), phorbol myristate acetate (PMA, Sigma, St. Louis, Missouri), cyclohexamide (Sigma), RPMI 1640 media (MA Bioproducts, Walkerville, Maryland), normal human serum (Biobee, Boston, Massachusetts), HEPES buffer (Sigma), and Ficoll Hypaque (Pharmacia Co., Piscataway, New Jersey). Guanidinium thiocyanate, sarcosyl, and cesium chloride were purchased from International Biotechnologies (New Haven, Connecticut). Sodium citrate, sodium acetate, and ethylenediamine tetraacetic acid (EDTA) were supplied by Fisher Scientific (Fair Lawn, New Jersey) while agarose, 3-(4-morpholino)propane sulfonic acid (MOPS) and formamide were furnished by Sigma. The reducing agent 2-mercaptoethanol was provided by Bio-Rad (Richmond, California) and Hybond N+ nylon filter by Amersham (Arlington Heights, Illinois). Microscopic slides (Fisher Scientific), gelatin (Biorad), normal goat serum (Gibco, Grand Island, New York), picric acid (Aldrich), and sucrose (Mallinckrodt Inc. Paris, Kentucky) were employed in the immunohistochemical studies. The reverse transcriptase from Maloney murine leukemia virus (Betliesda Research Laboratories, Bethesda, Maryland) and the DNA p01ymerase of Thermus aquaticus (Perkin Elmer Cetus, Norwalk, Connecticut) were used for mRNA amplification. Tissue Sections. Samples were placed in Zamboni's fixative (2% formaldehyde, 15% picric acid in 0.1 M phosphate buffer) for 14-18 hr followed by soaking in phosphate-buffered saline (PBS), pH 7.4, at 8~ C for 24
820
hr. After an additional 24 hr at 8~ C in PBS containing 15% sucrose, the tissues were serially cryosectioned at 16 I~m and placed on gelatin-coated slides. Immunofluorcscent Staining. Two color indirect immunofluorescence with the FITC-tagged IL-6 polyclonal antibody and RITC-labeled anti-CD3, anti-CD14, and anti-CD22 were utilized to demonstrate the cellular origins of IL-6 production within the bowel specimens. Non-antigen-specific antibody binding sites were blocked with 5% normal goat serum. Bowel sections were then incubated with the antibodies for 20 hr at 4~ C. After washing the specimens with PBS, the secondary antibody, FITC-conjugated afffinity-purified goat anti-rabbit IgG or RITC-conjugated goat anti-mouse IgG was applied for 1 hr at room temperature. Sections that were evaluated for the cellular origins of IL-6 received an additional 1-hr incubation at room temperature with the RITCconjugated antibody. Microscopic observation and photography were performed under fluorescent epiillumination on an Olympus BH-2 microscope. RNA Extraction. RNA was extracted from gut samples by the guanidinium isothiocyanate cesium chloride method (27). One to three milliliters of guanidinium thiocyanate (GTC) solution (4 M GTC, 25 mM sodium citrate, pH 7, 0.5% sarcosyl, and 2% 2-mercaptoethanol) was added to frozen (-80 ~ C) tissue. DNA was sheared with a polytron (Brinkmann, Westbury, New York). The samples were layered upon a 5.7 M cesium chloride gradient and ultracentrafuged for 18 hr at 35,000 rpm. The RNA pellet was recovered, ethanol precipitated, and quantitated by absorbance at 260 nm. Fifteen to 20 micrograms of total RNA were routinely extracted from two endoscopically obtained biopsies, and the amounts were comparable in normal and inflammatory tissue. Two micrograms of total RNA from all samples were electropheresed on 1% agarose gels and stained with ethidium bromide to identify 28S and 18S ribosomal bands. This ensured the integrity of the extracted RNA prior to proceeding with subsequent steps in gene amplification. Northern RNA Transfer Protocol. RNA samples were dissolved in 50% formamide, 2.2 M formaldehyde, 40 mM MOPS, 10 mM sodium acetate, I mM EDTA, and denatured by heating for 5 min at 60 ~ C and applied to a 1% agarose gel prepared using standard methods. Twenty micrograms of RNA were electropheresed for 4 hr at 60 V (80 mA) and then transferred to Hybond N+ nylon filters according to the recommendations of Amersham. After air drying, the filters were hybridized overnight at 42~ C in a solution containing 50% formamide, 5x SSC, 50 mM sodium phosphate, pH 6.5, 0.2% SDS, 1 x Denhardt's solution, 10% dextran, 100 I~g/ml salmon sperm DNA, and cDNA probe radiolabeled by the random primer method. After hybridization, the filter was washed at room temperature with 2 x SSC and 0.1% SDS for 30 min followed by another 30 min at 55 ~ C in a0.2• SSC, 0.1% SDS solution. After air drying, the filters were exposed to x-ray film (Kodak, Rochester, New York) for 24-72 hr. Synthesis of eDNA and Polymerase Chain Reaction (PCR) Amplification. Oligonucleotide sense TTAAGCTTGCTATGAACTCCTTCTCCACAAGC, TTAAGCTTTGGCTGAACCGCCGGGCAATGCC, TTAAGCTTGCDigestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
CYTOKINES IN INFLAMMATORY BOWEL DISEASE CATGGACAAGCTGAGGAAGATG and antisense CAGGATCCCATGCTACATTTGCCGAAGAGCCCT, CAGGATCCTCACAGGGCAATGATCCCAAAGTA, CAGGATCCTCTTTAGGAAGACAAATTGCAT primers complementary to IL-6, TNF-a, and IL-113 DNA sequences, respectively, were prepared using a DNA synthesizer (Applied Biosystems, Foster City, California). A single-strand cDNA copy was made from 1 Ixg of total RNA using 5 mM of the appropriate antisense oligonucleotide primer for each cDNA synthesis. Amplification of the first strand of cDNA was performed with the heat-stable DNA polymerase of Thermus aquaticus as recommended by the supplier (Perkin Elmer Cetus). Twenty, 25, 30, and 40 cycles of PCR amplification were performed using a DNA thermal cycler (Perkin Elmer Cetus). This established the linear part of the amplification curve for each cytokine (28). Each cycle consisted of 1 min at 94~ C to denature double-stranded DNA, 45 sec at 60~ C for the primers to anneal to their complementary sequences, and 1 rain at 72~ C for extension of the DNA strands. The resulting PCR products were size fractionated on 1.5% agarose gels, blotted onto nylon membranes and hybridized with random primer radiolabeled full-length cytokine cDNAs. Total RNA extracted from PHA (5 i~g/ml) and PMA (5 ng/ml) stimulated peripheral blood mononuclear cells (PBMC) cultured for 12 hr and pulsed with cyclohexamide (20 i~g/ml) for an additional 4 hr served as the positive control for the detection of IL-6, TNF-a, and IL 113 transcripts in each reaction. The same stock of positive control RNA was used for each set of amplification reactions and produced a strong and consistent hybridization signal with TNF-a, IL-113, and IL-6 probes. Reaction mixtures containing oligonucleotides, appropriate buffers, and enzymes without RNA substrate served as the negative control for each reverse transcriptase and gene amplification reaction. Data Analysis. Semiquantitation of the PCR products was assessed by comparing the densitometric ratio of intestinal and control sample autoradiograms. Statistical analysis of the densitometry data was calculated by the analysis of variance (ANOVA).
RESULTS Detection of Cytokine mRNA in Intestinal Specimens. In an effort to detect cytokine mRNAs in intestinal samples, Northern blot analysis was initially employed. Cytokine transcripts for total R N A were not identified via this method in normal or i n f l a m m a t o r y i n t e s t i n a l s p e c i m e n s (data not shown). Given the small amount of R N A extracted from endoscopic biopsy specimens, PCR gene amplification methods were utilized to detect cytokine transcripts and to determine whether qualitative differences in the tissue levels of cytokine transcripts were evident among the various intestinal specimens analyzed. Specific cytokine PCR products were identified by hybridization with radiolabeled full-length cytokine c D N A s (Figure 1). oige~ave o i , e , , ~ and Scie,,~. Vol. 37. iVo. O (S,,~ 1992)
Fig 1A. PCR products of intestinal samples size fractionated on 1.5% agarose gels and hybridized with radiolabeled probes for (A) TNF-c~,]L-I~3and (B) IL-6. TNF-a was amplified 30 cycles (PCR products were not seen at 25 cycles; data not shown), while IL-I[3 and IL-6 were amplified 40 cycles each. NL, UC, and CR abbreviations stand for normal, ulcerative colitis, and Crohn's disease specimens, respectively.
Measurement of the relative densities of the hybridized PCR products provided a means for estimating the relative abundance of intestinal cytokine mRNAs (Figure 2). T N F a was detected in all intestinal samples studied after 30 cycles of amplification, and the magnitude of expression determined by the percent densitometry o f control did not vary to a statistically significant degree among inflammatory and normal groups. Expression of IL-113 was pronounced in active UC with relative densities of the PCR product in active UC specimens greater than those detected in active CD, inactive IBD, and normal specimens (P < 0.05). H o w e v e r , the difference between active UC and non-IBD inflammatory samples was not statistically significant. IL-6 mRNA levels were much higher in IBD specimens than inactive IBD, non-IBD inflammatory, and nor82 1
STEVENS ET AL
Fig lB. A representative blot of the 633bp PCR product for IL-6 from intestinal tissues is shown after electropheresis on a 1.5% agarose gel and hybridization with a random labeled IL-6 cDNA. The positive control (P/P/C) is a sample of peripheral blood mononuclear cells stimulated with PHA, PMA, and cyclohexamide. NL, UC, and CR abbreviations stand for normal, ulcerative colitis, and Crohn's disease specimens, respectively.
mal groups (P < 0.05). The application of corticosteroid, sulfasalazine, or 5-aminosalacylic acid treatment to the data did not correlate with the amount of IL-6 mRNA detected in IBD specimens. Detection of IL-6 Protein in IBD Specimens. To determine whether the IL-6 transcripts, detectable
only by very sensitive PCR techniques, were translated into protein products, indirect immunofluorescent staining of IL-6 was undertaken using polyclonal anti-IL-6 antibodies. Representative sections of active and healed ulcerative colitis samples (Figure 3) clearly demonstrate cytoplas-
DENSITOMETRY OF IL-6, IL-lb, AND TNFa PCR PRODUCTS
140 -
o-.o. v
Z LM r~ LU > < --J ILl n"
120 ~oo
9
UCACTIVE
[] [] [] []
CD ACTIVE UC INACTIVE CD INACTIVE NON-IBD ACT.
[] NO~AL
80 6O 40 20 0
IL-6
IL-lb
TNFa
Fig 2. Densitometry scanning of IL-113, TNF-tx, and IL-6 PCR products expressed as a percent of the positive control. The same control was used for all experiments to obtain these comparative results. All specimens in Table 1 are represented in this figure. The relative density of IL-6 from UC and CD active samples was higher (*P < 0.05) than all the other groups. IL-I[3 in UC active specimens was greater than CD active, CD inactive, and normal groups (*P < 0.05), but did not reach statistical significance when compared to UC inactive and non-IBD active inflammatory specimens. TNF-ct was present in all samples and the relative density did not vary significantly among the groups studied. Bars indicate + or - the standard error.
822
Digestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
CYTOKINES IN INFLAMMATORY BOWEL DISEASE
Fig 3. Representative sections of active and inactive UC colon specimens stained using indirect immunofluorescence for IL-6 (A, C, E, G) and macrophage CD14 (B, H), T-cell CD3 (D), and B-cell CD22 (F) surface markers are depicted. The cytoplasm of inflammatory cells stained brightly for IL-6 (green) in the active (A, C, E) but not the healed (G) UC sample. Simultaneous staining (red) identified macrophages (B), T cells (D), and B cells as sources of IL-6. The healed UC section (H) contained macrophages not producing IL-6. Solid straight arrows identify colocalized cells staining positively for both IL-6 and a surface marker. Open arrows localize those cells that are positive for surface markers only. The curved arrow identifies an artifact. The bar equals 50 Ixm.
mic granular fluorescence in inflammatory cells of active colitis. Anti-IL-6 fluorescence was evident only in the active, but not the healed, UC colon sections. IL-6 protein was not identified within epithelial, fibroblast, or vascular endothelial cells. Colocalization with anti-CD3, anti-CD14, and anti-CD22 monoclonal antibodies demonstrated that T cells, macrophages, and B cells, respectively, each synthesized IL-6 within the inflamed bowel wall. Similar results were found in the active Crohn's disease specimens. IL-6 was not identified in non-IBD specimens. These data verify that the IL-6 mRNA, detected indirectly by the PCR, is translated into protein by a varied group of white blood cells infiltrating the bowel wall of IBD patients. Digestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
DISCUSSION We have used PCR gene amplification techniques to identify cytokine transcripts, ie, IL-6, TNF-~, and IL-113 mRNAs, in surgically resected and endoscopically obtained intestinal tissues. This powerful gene amplification technique was utilized because application of conventional Northern blot detection methods to intestinal biopsy samples failed to reveal cytokine transcripts. The range of samples studied included esophageal, gastric, duodenal, ileal, appendiceal, colonic, and rectal specimens. Our study revealed that TNF-~ mRNA was detectable in each specimen examined and is therefore probably constitutively expressed in the esophagus, stomach, ileum, and colon; however, tissue levels of TNF-~ transcripts were
823
STEVENSET AL not increased in IBD specimens. Others have not detected TNF-a by ethidium bromide staining of PCR products from normal or active IBD specimens (29). We also could not discern TNF-a in many samples with ethidium bromide analysis alone, yet when hybridized with a radiolabeled TNF-a cDNA, which markedly enhances sensitivity, specific products became readily visible in all samples. IL-113 mRNA was present in most inflammatory samples, but absent in normal specimens, suggesting that expression if IL-l[3 mRNA if translated and secreted supports the inflammatory processes of esophagitis, gastritis, appendicitis, and IBD. Lower levels of IL-113 mRNA were identified in active CD specimens as compared to active UC samples. This observation may reflect the difference between small intestinal and colonic inflammatory cell populations since all CD active samples were from the small bowel. Alternatively, enterocyte production of IL-113, which has been demonstrated in experimental colitis (30), may account for the difference since the mucosa of UC is diffusely inflamed in comparison to the transmural involvement in CD. IL-113 mRNA levels did not differ statistically between active and inactive ileal CD. This finding correlates with supernatant IL-113 ELISA measurements of sonicated ileal samples (31). The discovery of IL-113 mRNA in active UC mucosa is consistent with the data of others, who have detected elevated levels of IL-113 protein in supernatants of UC tissue and intestinal mononuclear cells extracted from active UC specimens when compared to normal controls (10, 11). The profile of IL-6 mRNA tissue accumulation was of particular interest. Within the range of biopsy materials examined, IL-6 mRNA levels are increased over normals and the non-IBD specimens studied. IL-6 mRNA positive IBD specimens were also positive for IL-113 and TNF-a mRNA. Therefore, expression of IL-6 may provide an additional inflammatory mediator in IBD that, in conjunction with IL-113, TNF-a, and other inflammatory molecules, leads to the inflammatory response characteristic of active IBD, or IL-6 may play a protective role by inducing hepatic acute phase proteins (19). As IL-6 was detected in IBD samples only by PCR but not Northern blot, given the limited amount of RNA obtainable from biopsy tissues, we were interested to determine whether IL-6 mRNA was translated into measurable protein, and if so which of the many cell types capable of synthesiz-
824
ing IL-6 were responsible for its production in IBD specimens. Immunofluorescent techniques identified IL-6-positive cytoplasmic granules only in inflammatory cells of IBD sections. IL-6 was not detected in inactive IBD or non-IBD inflammatory samples. Colocalization studies utilizing anti-IL-6 and cell-specific surface phenotypic markers identified macrophages, B cells, and T cells as potential sources of IL-6. From these data it is unknown whether the cytoplasmic IL-6 detected is secreted into the intestinal microenvironment. Other inflammatory cells, including mast cells, plasma cells, and NK cells, that were not studied may also be producing IL-6. TNF-a and IL-l[3 can both induce expression of IL-6 in vitro, and both are present in non-IBD inflammatory samples; yet IL-6 is undetectable. Since IL-1 can induce expression of IL-6, the local concentration of TNF-a and IL-1 present in nonIBD inflammatory tissues may be insufficient to induce the expression of IL-6. Alternatively, other stimulants may induce IL-6 in IBD. For example, viruses can induce IL-6 transcription via a cisacting mechanism (32). Perhaps an as yet unidentified etiologic agent causing IBD stimulates the transcription or inactivates a newly identified IL-6 repressor mechanism (33). The proinflammatory actions of TNF-et, IL-113, and IL-6 are all likely to be involved in the mucosal inflammation of this disorder. In particular, the activities of IL-6 correlate well with the immunological and clinical manifestations of IBD and other "autoimmune" dise a s e s . P o l y c l o n a l B-cell a c t i v a t i o n (34), immunoglobulin production (35), and T-cell proliferation and differentiation (36) have been described in IBD. Our data identify cytokine transcripts and cytoplasmic IL-6 protein in active IBD tissue. In particular the presence of IL-6, found only in IBD specimens as well as IL-l[3 and TNF-a, which are also expressed in IBD, may promote local inflammatory effects leading to IBD disease expression. Hence effective treatments for IBD should block IL-6 production. Indeed corticosteroids can block IL-1 (37) and IL-6 synthesis at the transcriptional level and prevent the production of many other cytokines (38-41). Although it is unlikely that the inhibition of IL-6 alone explains the effectiveness of corticosteroids in the treatment of IBD, the inhibitory effect of corticosteroids on expression of IL-6 and other cytokines does lend support to the involvement of cytokines in the pathogenesis of IBD. Digestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
CYTOKINES IN I N F L A M M A T O R Y BOWEL DISEASE I n s u m m a r y , the c y t o k i n e t r a n s c r i p t s e n c o d i n g IL-6, T N F - a , a n d IL-113 w e r e d e t e c t e d b y P C R in i n f l a m m a t o r y i n t e s t i n a l t i s s u e s . O f the i n f l a m m a t o r y s a m p l e s s t u d i e d - - e s o p h a g i t i s , gastritis, d u o d e n i t i s , appendicitis, UC, and CD---IL-6 was predomin a n t l y d e t e c t e d in U C a n d C D s p e c i m e n s . I m m u n ofluorescent techniques demonstrated IL-6 protein in T cells, B cells, a n d m a c r o p h a g e s . T h e s e d a t a suggest that IL-6 may be an intestinal inflammatory m e d i a t o r o f b o t h U C a n d CD.
ACKNOWLEDGMENTS We would like to thank Sybil Goulkin, the staff of the endoscopy suite, and the pathology department of the Beth Israel Hospital for their assistance in obtaining and processing intestinal specimens.
REFERENCES 1. Donowitz M: Arachadonic acid metabolites and their role in inflammatory bowel disease. Gastroenterology 88:580, 1985 2. Sharon P, Stenson WF: Enhanced synthesis of leukotriene B4 by colonic mucosa in inflammatory bowel disease. Gastroenterology 86:453, 1984 3. Kitahora T, Suzuki K, Asakura H, Yoshida T, Suematsu, Watanabe M, Aiso S, Tsuchiya M: Active oxygen species generated by monocytes and polymorphonuclear cells in Crohn's disease. Dig Dis Sci 33:951-955, 1988 4. Broberger O, Perimann P: Autoantibodies in human ulcerative colitis. J Exp Med 110:657, 1959 5. Kirsner JB, Shorter RG: Inflammatory Bowel Disease. Philadelphia, Lea & Febiger, 1988 6. Whorwell PJ, Bennett P, Tanner AR, Wright R: Monocyte function in Crohn's disease and ulcerative colitis. Digestion 22:271-275, 1981 7. Kurt-Jones EA, Kiely JM, Unanue ER: Conditions required for expression of membrane IL-1 on B-cells. J Immunol 135:1548-1550, 1985 8. Dinarello CA: Interleukin-1 and its biologically related cytokines. Adv Immunol 44:153-205, 1989 9. Krane S, Dayer JM, Simon CS, Byrne S: Mononuclear cell-conditioned medium containing mononuclear cell factor (MCF), homologous with interleukin 1, stimulating collagen and fibronectin synthesis by adherent rheumatoid synovial cells: effects of prostaglandin E2 and indomethacin. Collagen Rel Res 5:99-117, 1985 10. Mahida YR, Wu KC, Jewell DP: Enhanced production of interleukin 1-beta by mononuclear cells isolated from mucosa with active ulcerative colitis or Crohn's disease. Gut 30:835-838, 1989 11. Ligumsky M, Simon PL, Karmeli F, Rachmilewitz D: Role of interleukin 1 in inflammatory bowel disease-enhanced production during active disease. Gut 31:686-689, 1990 12. Pennica D, Nedwin GE, Hayflick JS, Seeburg PH, Derynck R, PaUadino MA, Kohr WJ, Aggarwal BB, Goeddel DV: Human tumor necrosis factor: Precursor structure, expression and homology to lymphotoxin. Nature 312:724-729, 1984 Digestive Diseases and Sciences, Vol. 37, No. 6 (June 1992)
13. Scheurich P, Thoma B, Ucer U, Pfizenmaier K: Immunoregulatory activity of recombinant human tumor necrosis factor (TNF)cc Induction of TNF receptors on human T cells and TNFcL mediated enhancement of T-cell responses. J Immunol 138:1786-1790, 1987 14. Jelnick DF, Lipsky PE: Enhancement of human B-cell proliferation and differentiation by tumor necrosis factor a and interleukin 1. J Immunol 139:2970-2976, 1987 15. Beutler B, Milsark IW, Cerami A: Passive immunization against cachectin/tumor necrosis factor (TNF) protects mice from the lethal effect of endotoxin. Science (Washington, DC) 229:869-871, 1985 16. Hofman FM, Hinton DR, Johnson K, Merrill JE: Tumor necrosis factor identified in multiple sclerosis brain. J Exp Med 170:607-612, 1989 17. Van Snick J: Interleukin 6: An overview. Annu Rev Immunol 8:253-278, 1990 18. Raynal MC, Liu Z, Hirano T, Mayer L, Kishimoto T, Chen-Kiang S: Interleukin 6 induces secretion of IgG1 by coordinated transcriptional activation and differential mRNA accumulation. Proc Natl Acad Sci USA 86:80248028, 1989 19. Gauldie J, Richards C, Harnish D, Lansdorp P, Baumann H: Interferon [3JB-cell stimulatory factor type 2 shares identity with monocyte-derived hepatocyte-stimulating factor and regulates the major acute phase protein response in liver cells. Proc Natl Acad Sci USA 84:7251-7255, 1987 20. Okada M, Kitahara M, Kishimoto S, Matsuda T, Hirano T, Kishimoto T: IL-6/BSF-2 functions as a killer helper factor in the in vitro induction of cytotoxic T cells. J Immunol 141:1543-1549, 1988 21. Luger TA, Krutmann J, Kirnbauer R, Urbanski A, Schwarz T, Klappacher G, Kock A, Micksche M, Malejczyk J, Schauer E, May LT, Sehgal PB: IFN/IL-6 augments the activity of human natural killer cells. J Immunol 143:12061209, 1989 22. Horii Y, Muraguchi A, Iwano M, Matsuda T, Hirayama T, Yamada H, Fujii Y, Dohi K, Ishikawa H, Ohmoto Y, Yoshizaki K, Hirano T, Kishimoto T: Involvementof IL-6 in mesangial proliferative glomerulonephtitis. J Immunol 143:3949-3955, 1989 23. Bataille R, Jourdan M, Zhang XG, Klein B: Serum levels of Interleukin 6, a potent myeloma cell growth factor, as a reflection of disease severity in plasma cell dyscrasias. J Clin Invest 84:2008-2011, 1989 24. Bhardwaj N, Santhanam U, Lau LL, Tatter SB, Ghrayeb J, Rivelis M, Steinman RM, Sehgal PB, May LT: IL-6/IFN-B2 in synovial effusions of patients with rheumatoid arthritis and other arthritides. J Immunol 143:2153-2159, 1989 25. Jourdan M, Bataille R, Seguin J, Zhang XG, Chaptal PA, Klein B: Constitutive production of interleukin-6 and immunologic features in cardiac myxomas. Arthritis Rheum 33:398-402, 1990 26. De Dombai FT, Burton IL, Clamp SE, Goligher JC: Short term course and prognosis of Crohn's disease. Gut 15:435443, 1974 27. Glisin V, Crkvenjakov R, Byus D: Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13:26332637, 1973 28. Innis MA, Gelfand DH, Sninsky JJ: PCR Protocols. New. York, Academic Press, 1989
825
STEVENS ET AL 29. Isaacs K, Sartor RB, Wang A, Haskill JS: Profiles of cytokine activation in inflammatory bowel disease tissue: Measurement by cDNA amplification. Gastroenterology 98:455A, 1990 30. Radema SA, van Deventer SJ, Cerami A: Interleukin 1 beta is expressed predominantly by enterocytes in experimental colitis. Gastroenterology 100:1180-1186, 1991 31. Sartor RB, Chapman EJ, Schwab JH: Increased interleukin-ll3 concentrations in resected inflammatory bowel disease (IBD) tissue. Gastroenterology 94:399A, 1988 32. Sehgal PB, Helfgott DC, Santhanam U, Tatter SB, Clarick RH, Ghrayeb J, May LT: Regulation of the acute phase and immune response in viral disease. Enhanced expression of the beta 2-interferon/hepatocyte-stimulating factor/interleukin 6 gene in virus-infected human fibroblasts. J Exp Med 167:1951-1956, 1988 33. Walz G, Zanker B, Barth C, Wieder KJ, Clark SC, Strom TB: Transcriptional modulation of human IL-6 gene expression by verapamil. J Immunol 144:4242-4248, 1990 34. Meijer CJ, Bosman FT, Lindeman J: Evidence for predominant involvement of the B-cell systems in the inflammatory process in Crohn's disease. Scand J Gastroenterol 14:21-32, 1979 35. Wu KC, Mahida YR, Priddle JD, Jewell DP: Effect of human intestinal macrophages on immunoglobulin production by human intestinal mononuclear cells isolated from patients
826
36.
37.
38.
39.
40.
41.
with inflammatory bowel disease. Clin Exp Immunol 79:3540, 1990 Fiocchi C, Battisto JR, Farmer RG: Studies on isolated gut mucosal lymphocytes in inflammatory bowel disease. Detection of activated T-cells and enhanced proliferation to Staphlococcus aureus and lipopolysaccharides. Dig Dis Sci 26:728-736, 1981 Knudsen PJ, Dinarello CA, Strom TB: Glucocorticoids inhibit transcriptional and post-transcriptional expression of interleukin 1 in U937 cells. J Immunol 139:4129-4134, 1987 Zanker B, Walz G, Wieder KJ, Strom TB: Evidence that glucocorticoids block expression of the human interleukin-6 gene by accessory cells. Transplantation 49:183-185, 1990 Beutler B, Krochin N, Milsark IW, Luedke C, Cerami A: Control of cachectin (tumor necrosis factor) synthesis: Mechanisms of endotoxin resistance. Science 232:977-980, 1986 Lee SW, Tsou AP, Chan H, Thomas J, Petrie K, Eugui EM, Allison AC: Glucocorticoids selectively inhibit the transcription of the interleukin 113gene and decrease the stability of interleukin 113 mRNA. Proc Natl Acad Sci USA 85:12041208, 1988 Almawi WY, Lipman ML, Stevens AC, Zanker B, Hadro ET, Strom TB: Abrogation of glucocorticosteroid-mediated inhibition of T cell proliferation by the synergistic action of IL-1, IL-6, and IFN-'y. J Immunol 146:3523-3527, 1991
Digestive Diseases and Sciences, I/ol. 37, No. 6 (June 1992)
