Unique and shared gene expression patterns in Atlantic salmon ...

Dev Genes Evol (2008) 218:427–437 DOI 10.1007/s00427-008-0237-9

ORIGINAL ARTICLE

Unique and shared gene expression patterns in Atlantic salmon (Salmo salar) tooth development Ann Huysseune & Harald Takle & Mieke Soenens & Karen Taerwe & Paul Eckhard Witten

Received: 13 January 2008 / Accepted: 16 June 2008 / Published online: 19 July 2008 # Springer-Verlag 2008

Abstract To validate the use of Atlantic salmon (Salmo salar L.) as a model species in research on the mechanism of continuous tooth replacement, we have started to collect data on the molecular control underlying tooth formation in this species. This study reports expression patterns in the lower jaw dentition of a number of key regulatory genes such as bmp2, bmp4, and sox9 and structural genes such as col1α1 and osteocalcin (= bgp, Bone Gla Protein) by means of in situ hybridization using salmon-specific, digoxygenin-labeled antisense riboprobes. We compare expression of these genes to that in other skeletogenic cells in the lower jaw (osteoblasts, chondroblasts, and chondrocytes). Our studies reveal both expression patterns that are in accordance to studies on mammalian tooth development and patterns that are specific to salmon, or teleosts. The epithelial expression of sox9 and a shift of the expression of bmp2 from epithelium to mesenchyme have also been observed during mammalian tooth development. Different from previous reports are the expressions of col1α1 and osteocalcin. In contrast to what has been reported for zebrafish, osteocalcin is not expressed in odontoblasts, nor in the osteoblasts involved in the attachment of the teeth. At the lower jaw, osteocalcin is expressed in mature and/or Communicated by M. Hammerschmidt A. Huysseune (*) : M. Soenens : K. Taerwe : P. E. Witten Biology Department, Ghent University, K.L. Ledeganckstraat 35, Ghent, Belgium e-mail: [email protected] H. Takle Nofima 5010 Ås, Norway P. E. Witten Department of Biology, Dalhousie University, Halifax, NS, Canada B3H 4J1

resting osteoblasts only. As expected, col1α1 is expressed in odontoblasts. Surprisingly, it is also strongly expressed in the inner dental epithelium, representing the first report of ameloblast involvement in collagen type I transcription. Whether the collagen is translated and secreted into the enameloid remains to be demonstrated. Keywords Tooth development . Atlantic salmon . Bmp . Collagen type I . Osteocalcin

Introduction Many decades after the pioneering papers of Parker (1873), De Beer (1937), and Tchernavin (1938), salmonids are increasingly used in fundamental studies of jaw development and remodeling (Witten and Hall 2002, 2003; Gillis et al. 2006) as well as in studies on tooth development and lifelong tooth renewal (Domon et al. 2006; Fraser et al. 2004, 2006a, b; Witten et al. 2005; Huysseune and Witten 2006, 2008; Huysseune et al. 2007). Recent studies on the lower jaw dentition of Atlantic salmon (Salmo salar L.) have revealed a consistent pattern of initiation of first-generation teeth, as well as a regular pattern of replacement tooth formation throughout nearly all life stages (Witten et al. 2005; Huysseune and Witten 2006; Huysseune et al. 2007). Together with an unlimited supply from aquaculture farms, these two features make this species particularly attractive for experimental analysis of tooth formation. Moreover, detailed studies on the histogenesis of the replacement teeth have revealed the gradual establishment of an epithelial cell population between inner and outer dental epithelium, termed middle dental epithelium, along the side of the functional tooth where the next tooth germ will appear (Huysseune and Witten 2008). These authors

428

have speculated that the middle dental epithelium functionally substitutes for a dental lamina and could be a source of adult epithelial stem cells, the progeny of which could translocate to the outer dental epithelium, thus replenishing it with cells for the new tooth germ. In addition to revealing developmental features, histological studies have revealed structural characters peculiar to salmon teeth, in particular the persistence of atubular dentine, a feature that is normally displayed in firstgeneration teeth only (Sire et al. 2002). In Atlantic salmon, it is present even in adult teeth (Huysseune and Witten 2008), as is the case in another salmonid, the rainbow trout (Bergot 1975). To validate the use of Atlantic salmon as a model species in research on the mechanism of continuous tooth replacement and to be able to extrapolate the data to other species displaying continuous tooth renewal, it is imperative to collect basic data on the molecular control underlying the formation of teeth in this species. Recent studies on tooth development in teleosts have revealed both conserved and divergent patterns of gene expression (Fraser et al. 2004; Jackman et al. 2004; Borday-Birraux et al. 2006; Wise and Stock 2006; Debiais-Thibaud et al. 2007) in comparison to mammals. Therefore, we have embarked upon a gene expression study to characterize the molecular steps of tooth formation in this species. Given, however, the enormous number of genes that are currently known to be involved in mammalian tooth formation (cf. http://bite-it. helsinki.fi/), knowledge which has been collected by dozens of laboratories over several decades, this study, inevitably, can only focus on a limited number of genes. Here, we report the expression pattern of a number of regulatory genes that play a key role in the development of mammalian teeth, in particular the growth factors bmp2 and bmp4, and the transcription factor sox9. Bmp genes play a pivotal role in tooth development (Vainio et al. 1993; Tucker et al. 1998; Jernvall and Thesleff 2000; Plikus et al. 2005) and modulation of Bmp signaling has been proposed to have morphoregulatory consequences for tooth evolution (Plikus et al. 2005; Streelman et al. 2003). Consistent with the fact that ray-finned fish (actinopterygians) underwent an extra round of genome duplication (Amores et al. 1998), teleosts often possess two orthologues of a mammalian gene. Thus, zebrafish possess two Bmp2 orthologues, bmp2a and bmp2b (Martínez-Barberá et al. 1997; Kondo 2007). The Sry-related gene Sox9, which encodes a transcription factor, is particularly well known for its capacity to drive precursor cells in a chondrogenic lineage as it is required for the expression of the type II collagen gene (Col2α1) and certain other cartilage-specific matrix proteins (Lefebvre and de Crombrugghe 1998; Goldring et al. 2006), but it also functions in neural crest and placode development (Yan et al. 2005). Relevant to the current

Dev Genes Evol (2008) 218:427–437

study is the observation that the gene is expressed during mouse odontogenesis (Mitsiadis et al. 1998). In agreement with the extra genome duplication event in actinopterygians, teleost fish possess two co-orthologues of tetrapod Sox9, sox9a and sox9b, which display subfunction partitioning (Yan et al. 2005). Given the peculiar nature of the dentine in salmonid teeth, characterized by the absence of odontoblast processes and dentinal tubules throughout development, we also examine gene expression patterns for two structural molecules of the dentine extracellular matrix: collagen type I and osteocalcin (OCN = BGP, Bone Gla Protein). Collagen type I is the most abundant protein of the dentine matrix both in mammals (Linde and Goldberg 1993) and likely also in teleost fish. Besides the classical collagen type I α1 and α2 chains assembling to a heterotrimer (α1)2α2, fish collagen type I in skin has been reported to contain a third chain, α3, leading to an α1, α2, α3 heterotrimer (Kimura et al. 1987; Kimura and Ohno 1987). The genes coding for the three α chains of collagen type I have been cloned and sequenced in trout and zebrafish (Saito et al. 2001; Morvan-Dubois et al. 2002, 2003). Osteocalcin is the most abundant non-collagenous protein of the bone extracellular matrix (Cole and Hanley 1991; Ducy et al. 1996; Boskey et al. 1998). Its presence in dentinal tissues has been reported to be variable, depending on the species (e.g. rat, Bronckers et al. 1993, versus human and bovine teeth, Gorter de Vries et al. 1988), developmental stage of the tooth germ (Papagerakis et al. 2002), and detection method (Bronckers et al. 1993). Osteocalcin belongs to the family of vitamin K-dependent proteins and has an essential role in controlling tissue mineralization (Boskey et al. 1998; Laizé et al. 2005). In addition to examining the expression of these genes in the developing tooth germs, we also compare these expression patterns to those in other skeletogenic cells in the lower jaw, such as osteoblasts, chondroblasts, and chondrocytes.

Materials and methods Materials Eggs of Atlantic salmon were incubated in tanks at 8°C. After hatching, the fry was raised at 8°C until the start of feeding at 850 day-degrees (Within the physiological limit of the species, day-degrees is a function of temperature and time. An egg that develops for 10 days at 8°C has approximately the same developmental stage as an egg that develops for 8 days at 10°C). The temperature was then raised to 12°C, at which temperature the specimens were kept until the sea water transfer. Three juvenile fish from a group with an average weight of 50 g (called fish 1, fish 2,

Dev Genes Evol (2008) 218:427–437

and fish 3) were euthanized by an overdose of the anesthetic MS222. The lower jaws were then dissected out under semi-sterile conditions and immediately fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) for 5 days. Subsequently, the left and right jaw halves were treated separately. The left lower jaws of fish 1 and 2 and the two jaw halves of fish 3 were dehydrated and stored in methanol for 2 weeks prior to decalcification. The right lower jaw of fish 1 and 2 was decalcified without prior storage in methanol. Decalcification was carried out for 5 weeks at 4°C in a 0.2 M Na2EDTA in 4% PFA. The solution was changed every 2–3 days. After decalcification, samples were washed in PBS, equilibrated in a 5% sucrose/PBS solution and embedded in 1.5% agar in 5% sucrose/PBS. The solidified tissue blocks were then transferred to 30% sucrose in PBS and left in the solution overnight (until equilibration). Cryosections of 12 μm were sectioned in the sagittal plane and allowed to thaw on Superfrost/Plus slides, coated with a 1 mg/ml poly-L-lysine hydrobromide solution, dried for 30 min at room temperature, and stored dry at −20°C until hybridization. Cloning of skeletal genes The different skeletal gene transcripts were amplified from a cDNA mix of muscle and vertebrae from Atlantic salmon using the primers listed in Table 1. The gene-specific primers were designed using the Vector NTI Advance 10 (Invitrogen, CA, USA) software, together with sequence information available in GenBank® or sequences found by Blast searches within the GRASP EST database. After gel electrophoresis, fragments were cloned into pGEM®-T Easy vectors (Promega, WI, USA) and sequenced to confirm the identity of each gene fragment. Sequence analysis was carried out using various software, including Vector NTI Advance 10 (Invitrogen, CA, USA) and BLAST.

429

In situ hybridization (ISH) Digoxygenin (DIG)-labeled riboprobes were in vitro transcribed as described (Roche, Basel, Switzerland), using polymerase chain reaction (PCR) products as templates. A PCR was carried out for each gene clone using 0.25 μm Sp6 (5′-CATTTAGGTGACACTATAG-3′) and 0.25 μm T7 (5′-GTAATACGACTCACTATAG-3′) primer and Herculase polymerase (Stratagene, CA, USA). Cycling conditions were as follows: 95°C for 2 min, 5 cycles of 95°C for 30 s, 53°C (−1°C/cycle) for 30 s, and 72°C for 1 min; then, 35 cycles of 95°C for 30 s, 49°C for 30 s, and 72°C for 1 min. The program was terminated with a 72°C step for 7 min. The products were purified on columns and about 250 μg was used as template in riboprobe synthesis. Hybridization on sections was performed with a probe concentration of approximately 500 ng/μl at a temperature of 65°C overnight. Excess probe was washed away; heatinactivated calf serum was used to prevent non-specific binding of the antibody. Sections were incubated with an alkaline phosphatase linked to an anti-DIG antibody at 4°C overnight. Excess antibody was then washed away and staining performed with nitroblue tetrazolium/5-bromo-4chloro-3-indolyl phosphate. After staining, the sections were post-fixed using 4% PFA in PBS, and the slides were mounted with Aquamount (Gurr, BDH Chemicals Ltd, Poole, UK) for light microscopic observation. In all cases, sections were hybridized with sense probes as a control.

Results General aspect of the lower jaw and its dentition The lower jaw in sexually mature Atlantic salmon bears a single row of teeth on each jaw halve, consisting of

Table 1 Primers used to amplify the skeletal genes Gene

Accession number

Orientation

Sequence (5′–3′)

bmp2 bmp2 bmp4 bmp4 sox9 sox9 Osteocalcin Osteocalcin col1α1 col1α1

CA061573a CA061573a CA056395a CA056395a AF209872.1b AF209872.1b AY233378b AY233378b AB052835.1b AB052835.1b

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TACGGTCATGACAGACAGGG CTTCATGTGGTATTGCACCC GACGAACATACGTCTCAACAG ACCAGACACCACGCCACCAG GGGGATACTATTTGACTGGATC TCTGTCTTGATGTGTGTGGG CTCATACTTGTTGATCGTCCAG TCTTTCTCTCTCGCTCTCCC TAGCCGTGGTTTCCCTGGTT CCGGGAGGTCCAAATCTACC

a b

Accession number in the GRASP EST database Accession number in the BLASTN database

430

Dev Genes Evol (2008) 218:427–437

approximately 20 to 25 teeth (Witten et al. 2005). Despite variations, the common pattern of tooth replacement is such that teeth are in a similar stage of functionality, or development, every third location along the tooth row (Huysseune et al. 2007). Thus, on one single sagittal section, different stages of replacement tooth development can be observed. The stages distinguished are (cf. Huysseune and Witten 2008): initiation stage, whereby the outer dental epithelium is locally thickened into a placode; morphogenesis stage, whereby the outer dental epithelium is re-invaginated to form the new tooth germ; cytodifferentiation stage, whereby first enameloid, then dentine are deposited; and finally attachment of the tooth to the underlying bone (Fig. 1).

expressed in the oral epithelium, in enamel organs of developing teeth, in reduced enamel organs of erupted teeth, and in the dental mesenchyme. The gene appears to be upregulated first in the ameloblasts in morphogenesis stage (Fig. 2a), followed by an upregulation in the odontoblasts (Fig. 2b). Yet, the level of transcription is much higher in the ameloblasts compared to that in the odontoblasts. Later, the gene is downregulated in the ameloblasts at the tip of the tooth but upregulated in the rest of the inner dental epithelium, almost down to the cervical loop tip (Fig. 2c). At the same time, the odontoblasts continue to express bmp2; the signal is always weaker than in the inner dental epithelium but is more widespread than the more localized, band-like, epithelial expression.

Regulatory genes

bmp4

bmp2 The expression of bmp2 (Fig. 2a–d) is distinct from that of bmp4 (Fig. 2e–h). In a general way, bmp2 is moderately

In contrast to bmp2, bmp4 is weakly, if at all, expressed in the oral epithelium and in the enamel organs (Fig. 2e–h). The pattern and level of transcription in the mesenchyme, however, is comparable to that of bmp2.

Fig. 1 Schematic representation of replacement tooth development in Atlantic salmon, showing the stages of initiation (a), morphogenesis (b), cytodifferentiation (c), and attachment (d). dp Dental papilla of the replacement tooth, ft functional (= predecessor) tooth, ide inner dental epithelium of functional tooth, mde middle dental epithelium of functional tooth, ode outer dental epithelium of functional tooth, oe oral epithelium, rt replacement tooth (partly adapted from Huysseune and Witten 2008). In sagittal sections such as used here, the functional tooth is not in the plane of sectioning and only the replacement tooth, together with part of the middle dental epithelium of the predecessor, is visible

Fig. 2 ISH with DIG-labeled antisense riboprobes on sagittal, 12-μm„ thick, cryosections of the lower jaw of juvenile Atlantic salmon. Anterior to the left, oral cavity to the top of the figures. a–d bmp2. Successive stages of replacement tooth development: morphogenesis stage (a), early cytodifferentiation stage (b), late cytodifferentiation stage (c), and attached, functional tooth (d) (see Fig. 1 for corresponding stages). Strong upregulation of bmp2 expression in secretory ameloblasts (a, white arrowhead), followed by upregulation in the odontoblasts (b, od). Expression is still very strong in the ameloblasts (b, white arrowhead). With ongoing cytodifferentiation, the gene is downregulated in the ameloblasts at the tip of the tooth (c, white asterisk) but strongly upregulated in the inner dental epithelium (ide) more towards the tooth basis (c). The odontoblasts (od) continue expressing bmp2 (c). In an attached, fully functional tooth (d), there is moderate expression in the oral epithelium (oe) as well as in the reduced enamel organ (reo), but the odontoblasts (od) still express bmp2, along with osteoblasts (ob) that attach the tooth to the dentary bone. Further abbreviations: mde middle dental epithelium, ode outer dental epithelium. Bar in a–c=0.1 mm, in d=0.25 mm. e–h bmp4. Successive stages of replacement tooth development, corresponding to the ones presented in (a)–(d). Expression in the ameloblasts (e, f, white arrowhead) is weaker than with bmp2. The level of transcription in the odontoblasts (e–h, od) is similar to that of bmp2. Abbreviations as in (a)–(d). Bar in e–g=0.1 mm, in h=0.25 mm. i–l sox9. Successive stages of replacement tooth development: morphogenesis stage (i), early cytodifferentiation stage (j), late cytodifferentiation stage (k), and fully formed tooth, here sectioned transversely (l). In all developmental stages (i–k), expression is limited to the oral epithelium (oe) and enamel organs (ide inner dental epithelium, mde middle dental epithelium, ode outer dental epithelium) of the tooth germs, and absent in the odontoblasts (od). In fully formed teeth (l), expression is downregulated in the inner dental epithelium (ide); it remains fairly strong in the outer dental epithelium (ode), but is weak in the middle dental epithelium (mde). Bar in i–l=0.1 mm

Dev Genes Evol (2008) 218:427–437

sox9 The sox9 gene is moderately expressed in the oral epithelium and in the enamel organs of developing tooth

431

germs (Fig. 2i–k). In fully formed teeth, expression is downregulated in the inner dental epithelium (Fig. 2l). Transcripts are not detected in the dental mesenchyme, nor in the odontoblasts at any stage of their differentiation.

432

The gene is strongly expressed in the chondroblasts and more moderately in the chondrocytes of Meckel’s cartilage (data not shown). Structural genes

Dev Genes Evol (2008) 218:427–437

Discussion Our studies reveal both localizations of transcripts that are in accordance to studies on mammalian tooth development and localizations of transcripts that are specific to salmon (respectively specific to teleosts).

col1α1 bmp2 The col1α1 gene is strongly expressed in various tissues of the lower jaw (Fig. 3a,b). Transcripts are abundant in the fibroblasts of the subepithelial connective tissue, and the osteoblasts around the dentary bone. Interestingly, the basal layer of the epithelium covering the lower jaw, both on the epidermal side (Fig. 3a,b) and in the oral cavity (Fig. 3c,d), shows a distinct expression of the col1α1 gene. All more superficial layers of the epithelium are negative. No transcripts are found in the chondrocytes of Meckel’s cartilage (data not shown). Surprisingly, the col1α1 gene is strongly expressed in the enamel organs of developing tooth germs, in an apparent dynamic pattern (Fig. 3c–j). High levels of transcripts are present in the inner dental epithelium of a morphogenesis stage (Fig. 3e,f) and cytodifferentiation stage (Fig. 3g–j) tooth germ, but the gene is turned off in the inner dental epithelium of the more advanced tooth germ (Fig. 3i), while the expression in the outer dental epithelium now appears to be upregulated (Fig. 3c). Within the mesenchymal compartment, the col1α1 gene is expressed in the odontoblasts from the time of first matrix deposition, until attachment (Fig. 3e–j). Expression levels are still high in odontoblasts of fully functional teeth (Fig. 3j). osteocalcin Unlike the col1α1 gene, the osteocalcin gene shows no epithelial expression (neither in the epidermis, nor in the oral epithelium, nor in any part of the dental epithelium; Fig. 3k). The gene is not expressed in the odontoblasts at any stage, nor in the osteoblasts that deposit the attachment bone or that are involved in remodeling of the oral (dentigerous) surface of the dentary bone. In contrast, it is highly expressed in the osteoblasts along the aboral surface of the dentary bone (Fig. 3l). No transcripts are present in the chondroblasts or chondrocytes of Meckel’s cartilage (data not shown). In none of the sections hybridized with sense probes was any of the above signals observed (Fig. 3b,d,f, and h and data not shown).

Pharyngeal teeth of zebrafish (Danio rerio) and oral teeth of Mexican tetra (Astyanax mexicanus) and medaka (Oryzias latipes) show a dynamic pattern of bmp2 expression (Wise and Stock 2006). During pre-initiation and initiation stage, bmp2b is expressed in the epithelium and absent from the mesenchyme. During morphogenesis stage, the expression becomes restricted to the tooth mesenchyme, and bmp2a Fig. 3 ISH with DIG-labeled antisense (a, c, e, g, i–l) or sense (b, d,„ f, h) riboprobes on sagittal, 12-μm thick, cryosections of the lower jaw of juvenile Atlantic salmon. Anterior to the left, oral cavity to the top of the figures, except in (l) where anterior is to the top. a–b col1α1 expression in the ventral skin of the lower jaw (epidermis to the bottom of the figure). Expression with the antisense probe (a) is strong in the basal epidermal layer (black arrowhead), in the fibroblasts of the subepidermal connective tissue (f), and in the osteoblasts (ob) surrounding the dentary bone (db). With the sense probe (b), no transcripts are visible in either the basal epidermal layer (black arrowhead), in the fibroblasts (f), or in the osteoblasts (ob) surrounding the dentary bone (db). The black lines adjacent to the bone represent elongated pigment cells. Bar in a, b=0.1 mm. c–d col1α1 expression in the teeth. Strong expression in the basal layer (black arrowhead) of the oral epithelium (oe), and in the enamel organ of the tooth (t), in particular the outer dental epithelium (ode; c). Note absence of transcripts in the inner dental epithelium (ide). mde Middle dental epithelium. With the sense probe (d), no transcripts are visible in either the oral epithelium (oe), or in the enamel organ (ide inner dental epithelium, mde middle dental epithelium, ode outer dental epithelium) of the tooth (t). Bar in c, d=0.1 mm. e–j col1α1. Successive stages of replacement tooth development: morphogenesis stage (e, f), early cytodifferentiation stage (g, h), late cytodifferentiation stage (i), and fully formed tooth (j; compare with Fig. 2). Very strong epithelial expression in the inner dental epithelium (ide) and in the odontoblasts (od) at the tip of the dental papilla (e). These signals are absent in the inner dental epithelium (ide) and odontoblasts (od) of a similar-staged tooth germ treated with sense probe (f). During cytodifferentiation (g), the gene is upregulated in all odontoblasts (od), while strong epithelial expression is maintained in the inner dental epithelium (ide). These signals are absent in the inner dental epithelium (ide) and odontoblasts (od) of a similar-staged tooth germ treated with sense probe (h). During further cytodifferentiation (i), the gene is downregulated in the inner dental epithelium at the tip of the tooth (white asterisk), but is maintained in the odontoblasts (od), even after the tooth has become functional (j). The osteoblasts (ob) depositing the attachment bone are similarly strongly positive. Bar in e–j=0.1 mm. k–l osteocalcin. Transcripts are lacking in the enamel organs (eo) of the tooth germs (t), as well as in their mesenchymal components: odontoblasts (od) are negative at any stage of development (k). In contrast, transcripts are present in mature osteoblasts (ob) along the aboral surface of the dentary bone (db; l). Bar in k, l=0.1 mm

Dev Genes Evol (2008) 218:427–437

expression appears for the first time in the mesenchyme only (the latter not in medaka; Wise and Stock 2006). It is at present unknown how many bmp2 orthologues S. salar possesses. Given the two rounds of genome duplication that teleosts underwent (Amores et al. 1998) and the extra genome duplication that salmonids underwent (Moghadam et al. 2005), one might expect more than

433

one orthologue. Our probes for Atlantic salmon likely did not distinguish between potential orthologues, and therefore reflect the pattern of expression of all putative bmp2 orthologues together. A comparison with the study of Wise and Stock (2006) is also hampered by the fact that these authors examined (small and fast-developing) firstgeneration teeth that may differ in expression patterns

434

from replacement teeth (Laurenti et al. 2004; Fraser et al. 2006b). Taken together, our results on bmp2 expression in Atlantic salmon suggest that the gene is expressed during cytodifferentiation stages. In the mouse, Bmp2 is expressed epithelially during initial morphogenesis of incisor and molar tooth germs (Ǻberg et al. 1997; Dassule and McMahon 1998; Keränen et al. 1998). Its expression next becomes restricted to the primary enamel knot. From bell stage onwards, Bmp2 expression is lost in the epithelium and Bmp2 is now only expressed in the dental papilla, preodontoblasts, and odontoblasts (Åberg et al. 1997; Wang et al. 2004). Bmp2 is downregulated in late odontoblasts (Yamashiro et al. 2003). Thus, like in Atlantic salmon, there is a shift in expression from epithelium to mesenchyme, but the restriction of epithelial expression to a localized area, corresponding to the primary enamel knot, is not observed. bmp4 In zebrafish and tetra pharyngeal first-generation teeth, bmp4 is expressed in the epithelium during initiation stage and in the epithelium and mesenchyme during morphogenesis stage (Wise and Stock 2006). Expression in the epithelium, preceding expression in the mesenchyme, was also observed in the oral teeth of medaka (Wise and Stock 2006). The weak or absent epithelial expression in salmon stands in contrast to the distinct epithelial expression in zebrafish and medaka, but closely resembles the situation in another salmonid, the rainbow trout (Oncorhynchus mykiss; Fraser et al. 2004, 2006a, b). In the rainbow trout, bmp4 expression is restricted to the mesenchymal cells; the gene is not expressed at any stage in the oral epithelium (Fraser et al. 2004, 2006a, b). Wise and Stock (2006) speculated that the extra round of genome duplication in salmonids could have given rise to a hitherto uncharacterized bmp4 paralogue, followed by subfunctionalization. Our data on Atlantic salmon support this suggestion. In the mouse earliest bud stages, Bmp4 is more weakly expressed than Bmp2 in the presumptive dental epithelium (Keränen et al. 1998). Unlike Bmp2, Bmp4 is also transcribed in the mesenchyme at this stage. After E12, expression of Bmp4 declines in the epithelium. At cap stage, Bmp4 is expressed in the primary enamel knot and in the mesenchyme, and is later strongly expressed in the dental papilla (Bitgood and MacMahon 1995; Vaahtokaari et al. 1996; Åberg et al. 1997). sox9 In zebrafish, subfunction partitioning exists in the branchial arches between the two sox9 co-orthologues, sox9a and

Dev Genes Evol (2008) 218:427–437

sox9b (Yan et al. 2005). Double mutants lack all pharyngeal cartilages. Whether and to what extent the (pharyngeal) teeth are affected is not reported. In salmon, sox9 expression is exclusively epithelial, in contrast to what has been observed in mice, where the gene is also (but to a lesser degree) expressed in the mesenchyme (Mitsiadis et al. 1998). At late bell stage (E18.5), Sox9 expression is strong in preameloblasts/ameloblasts, suggesting a role for the gene product in ameloblast specification and/or terminal differentiation (Mitsiadis et al. 1998). col1α1 The basic template for fibrillar collagens found in vertebrates has been laid down extremely early in evolution (BootHandford and Tuckwell 2003). Thus, collagen type I is a highly conserved protein; most conserved is the collagen α1 (I) chain. According to Morvan-Dubois et al. (2003), the identity between α1(I) chains, based on amino acid sequence, is 84% between zebrafish (D. rerio) and humans (Homo sapiens), and 93% between zebrafish and rainbow trout (O. mykiss). Our own comparison of the α1(I) chain between rainbow trout and Atlantic salmon revealed an amino acid correspondence of 97%. A similar high correspondence between α1(I) chains in other teleost species allowed the detection of collagen α1(I) mRNA by ISH in halibut (Hippoglossus hippoglossus) with probes designed for gilthead seabream (Sparus aurata; Campinho et al. 2007). In Atlantic salmon, the basal layer of both the oral epithelium and epidermis expresses col1α1, suggesting its involvement in collagen type I production. These observations are in agreement with a previous study reporting collagen type I alpha 2 production in the basal epidermal layer of zebrafish skin (Le Guellec et al. 2004). The latter authors concluded that the epidermal basal cells produce the collagen matrix of the primary dermal stroma but progressively cease collagen production once fibroblasts start to invade the stroma after 20–26 days post-fertilization. Considering the weight and size of Atlantic salmon at sexual maturity (Witten and Hall 2003), we can assume that the skin in the fish used here was not fully developed. The basal epithelial cells may therefore still contribute to the collagen of the dermal stroma, explaining the presence of transcripts. Collagen production by epidermal/epithelial cells is not uncommon. In the chick embryo, the corneal epithelium secretes the collagen of the primary corneal stroma (Hayashi et al. 1988). Recently, another type of collagen, the nonfibrillar collagen type XVIII has been shown to be expressed in the epidermis of zebrafish (Haftek et al. 2003). In addition to its expression in the basal layer of the oral epithelium, col1α1 is strongly expressed in the inner dental epithelium. This is a surprising result and it represents the first report of ameloblast involvement in collagen type I

Dev Genes Evol (2008) 218:427–437

production. The only report known to us where collagen type I has been localized in the dental epithelium is by Webb et al. (1998). These authors detected a scattered pattern of collagen type I in the dental epithelium of rat bud stage first lower molar through immunolocalization with a polyclonal antibody. A scattered pattern was also detected later in the stellate reticulum at cap and bell stage. The authors could not provide an explanation for the epithelial presence of type I collagen. In contrast, Bronckers et al. (1993) could immunolocalize collagen type I only in the mesenchymal tissues of rat molar tooth germs. Similarly, both Andujar et al. (1991) and Lukinmaa et al. (1993) reported that the oral epithelium and the enamel organ of mouse teeth do not express type I collagen at any time. It is tempting to speculate that the production and possible secretion of type I collagen by inner dental epithelium cells is related to the presence of an enameloid cap on the teeth. Like enamel, enameloid is a hypermineralized tissue, covering the teeth in the majority of actinopterygian fish. However, it is a mixed epithelial–mesenchymal product that contains collagen (see Huysseune and Sire 1998 for a review). The collagen has usually been regarded as derived from the odontoblasts, but some researchers, especially Prostak and his co-workers, have claimed that collagen has an epithelial origin (see Prostak and Skobe 1985, 1986a, b; Prostak et al. 1993). The presence of large amounts of col1α1 mRNA in the ameloblasts is indicative of an important secretory activity and could support an epithelial origin of the collagen in the enameloid. Yet, the transcripts appear to be present in a much larger area of the inner dental epithelium than that which covers the enameloid. Until we have more precise data on the exact localization and the dynamic changes of expression of the col1α1 in the inner dental epithelium, as well as data on the distribution of the protein through immunolocalization, the high amounts of col1α1 transcripts in the inner dental epithelium of Atlantic salmon remain elusive. The expression, on the other hand, of col1α1 in odontoblasts is in line with our expectations, given that collagen type I is the main protein in dentine at least in mammals (Linde and Goldberg 1993). In mouse lower molars, col1α1 is highly expressed in odontoblasts at the onset of odontoblast differentiation, and subsequently decreases (a reverse pattern is observed for col1α2) (Andujar et al. 1991). Similarly, col1α1 is expressed in mouse odontoblasts and cells of the alveolar bone before and during root development, and in the periodontal ligament (MacNeil et al. 1996). In human, like in mouse teeth, transcripts of alpha 1(I) collagen increase in the odontoblasts with progressing dentine formation and decrease toward its completion. Yet, pro-alpha 1(I) mRNA is still detectable in odontoblasts of fully developed teeth (Lukinmaa et al. 1993). Osteoblasts of the mandibular bone also expressed pro-alpha 1(I) mRNA (Lukinmaa et al. 1993).

435

osteocalcin In contrast to studies reporting osteocalcin expression in active and mature odontoblasts as well as in the odontoblastic processes in the teleost fish Argyrosomus regius (Ortiz-Delgado et al. 2005), osteocalcin in Atlantic salmon is not expressed in odontoblasts, nor in the osteoblasts involved in the attachment of the teeth. We find osteocalcin expression in the lower jaw in Atlantic salmon in mature and/or resting osteoblasts only. In rat molars, osteocalcin is absent in pre-odontoblasts but starts to be expressed in young odontoblasts, up to mature odontoblasts, making it “a good parameter for differentiated odontoblasts” (Bronckers et al. 1993). It is not found in pulp cells. Strong immunostaining for osteocalcin was also observed in root odontoblasts and in the osteoblasts lining the alveolar bone of rat incisor and molar tooth germs (Bronckers et al. 1994). In human samples, osteocalcin has either not been immunodetected in the odontoblasts (Gorter de Vries et al. 1988) or reported to be present in odontoblasts, albeit in a stage-dependent manner (Papagerakis et al. 2002). In both studies, it has been claimed absent in the dentine ECM. During root formation in mouse lower first molars, osteocalcin is expressed by cementoblasts along the root surface, odontoblasts, and bone cells along the mandibular surface and within the bone (D’Errico et al. 1997). Contrary to these studies which suggest a role for osteocalcin in secretory odontoblasts and osteoblasts, our findings appear to be in agreement with those of Ducy et al. (1996) and Boskey et al. (1998), who failed to reveal a critical role for osteocalcin in mammalian bone formation, with the findings of Sommer et al. (1996), where no osteocalcin expression was found in early differentiation osteoblasts (although osteocalcin was detected in odontoblasts at the onset of dentine matrix deposition), and with the studies of Ikeda et al. (1992) where osteoblasts of the periosteum and endosteum of 2-day-old rat bone tissues showed a much weaker expression than those in 8-week-old bone tissues. Conclusion In conclusion, the expression data presented in this study reveal localizations of transcripts that are in accordance with studies on mammalian tooth development, notably the epithelial expression of sox9 and a shift of the expression of bmp2 from epithelium to mesenchyme. Different from previous reports are the expression patterns displayed by col1α1 and osteocalcin. The epithelial expression of collagen type I is most intriguing and requires a more detailed study focusing on the dynamics of its expression in the enamel organ, together with a localization of the protein, in order to reveal whether the gene is involved in

436

the production of collagen of the enameloid. This is the focus of an ongoing study. Acknowledgments This work was carried out within the frame of the European COST Action B23 “Oral facial development and regeneration”. AH and MS acknowledge a grant from the FWO 3G0159.05. AH, HT, and PEW acknowledge the support from the Research Council of Norway project “Skeletal malformations in farmed salmon and cod: a functional approach to determine causalities and mechanisms” (Contract no. 172483/s40). The authors thank two anonymous reviewers for helpful comments and suggestions.

References Åberg T, Wozney J, Thesleff I (1997) Expression patterns of bone morphogenetic protein (Bmps) in the developing mouse tooth suggest role in morphogenesis and cell differentiation. Dev Dyn 210:383–396 Amores A, Force A, Yan YL, Joly L, Amemiya C, Fritz A, Ho RK, Langeland J, Prince V, Wang YL, Westerfield M, Ekker M, Postlethwait JH (1998) Zebrafish hox clusters and vertebrate genome evolution. Science 282:1711–1714 Andujar MB, Couble P, Couble ML, Magloire H (1991) Differential expression of type I and type III collagen genes during tooth development. Development 111:691–698 Bergot C (1975) Mise en évidence d’un type particulier de dentine chez la truite (Salmo sp., Salmonidés, Téléostéens). Bull Soc Zool Fr 100:587–594 Bitgood MJ, McMahon AP (1995) Hedgehog and Bmp genes are coexpressed at many diverse sites of cell–cell interaction in the mouse embryo. Dev Biol 172:126–138 Boot-Handford RP, Tuckwell DS (2003) Fibrillar collagen: the key to vertebrate evolution? A tale of molecular incest. BioEssays 25:142–151 Borday-Birraux V, Van der heyden C, Debiais-Thibaud M, Verreijdt L, Stock DW, Huysseune A, Sire J-Y (2006) Expression of dlx genes in zebrafish tooth development. Evolutionary implications. Evol Dev 8:130–141 Boskey AL, Gadaleta S, Gundberg C, Doty SB, Ducy P, Karsenty G (1998) Fourier transform infrared microspectroscopic analysis of bones of osteocalcin-deficient mice provides insight into the function of osteocalcin. Bone 23:187–196 Bronckers ALJJ, D’Souza RN, Butler WT, Lyaruu DM, van Dijk S, Gay S, Wöltgens JHM (1993) Dentin sialoprotein: biosynthesis and developmental appearance in rat tooth germs in comparison with amelogenins, osteocalcin and collagen type-I. Cell Tissue Res 272:237–247 Bronckers ALJJ, Farach-Carson MC, Van Waveren E, Butler WT (1994) Immunolocalization of osteopontin, osteocalcin, and dentin sialoprotein during dental root formation and early cementogenesis in the rat. J Bone Miner Res 9:833–841 Campinho MA, Silva N, Sweeney GE, Power DM (2007) Molecular, cellular and histological changes in skin from a larval to an adult phenotype during bony fish metamorphosis. Cell Tissue Res 327:267–284 Cole DEC, Hanley DA (1991) Osteocalcin. In: Hall BK (ed) Bone. vol 3. Bone matrix and bone specific products. CRC, Boca Raton, pp 239–294 Dassule HR, McMahon AP (1998) Analysis of epithelial–mesenchymal interactions in the initial morphogenesis of the mammalian tooth. Dev Biol 202:215–227 De Beer GR (1937) The development of the vertebrate skull. Clarendon, Oxford

Dev Genes Evol (2008) 218:427–437 Debiais-Thibaud M, Borday-Birraux V, Germon I, Bourrat F, Metcalfe CJ, Casane D, Laurenti P (2007) Development of oral and pharyngeal teeth in the medaka (Oryzias latipes): comparison of morphology and expression of eve1 gene. J Exp Zool (Mol Dev Evol) 308B:693–708 D’Errico JA, MacNeil RL, Takata T, Berry J, Strayhorn C, Somerman MJ (1997) Expression of bone associated markers by tooth root lining cells, in situ and in vitro. Bone 20:117–126 Domon T, Taniguchi Y, Fukui A, Suzuki R, Takahashi S, Yamamoto T, Wakita M (2006) Features of the clear zone of odontoclasts in the Chinook salmon (Oncorhynchus tshawytscha). Anat Embryol 211:87–93 Ducy P, Desbois C, Boyce B, Pinero G, Story B, Dunstan C, Smith E, Bonadio J, Goldstein S, Gundberg C, Bradley A, Karsenty G (1996) Increased bone formation in osteocalcin-deficient mice. Nature 382:448–452 Fraser GJ, Graham A, Smith MM (2004) Conserved deployment of genes during odontogenesis across osteichthyans. Proc R Soc Lond B 271:2311–2317 Fraser GJ, Graham A, Smith MM (2006a) Developmental and evolutionary origins of the vertebrate dentition: molecular controls for spatio-temporal organisation of tooth sites in osteichthyans. J Exp Zool 306B:183–203 Fraser GJ, Berkovitz BK, Graham A, Smith MM (2006b) Gene deployment for tooth replacement in the rainbow trout (Oncorhynchus mykiss): a developmental model for evolution of the osteichthyan dentition. Evol Dev 8:446–457 Gillis JA, Witten PE, Hall BK (2006) Chondroid bone and secondary cartilage contribute to apical dentary growth in juvenile Atlantic salmon. J Fish Biol 68:1133–1143 Goldring MB, Tsuchimochi K, Kosei I (2006) The control of chondrogenesis. J Cell Biochem 97:33–44 Gorter de Vries I, Coomans D, Wisse E (1988) Immunocytochemical localization of osteocalcin in human and bovine teeth. Calcif Tissue Int 43:128–130 Haftek Z, Morvan-Dubois G, Thisse B, Thisse C, Garrone R, Le Guellec D (2003) Sequence and embryonic expression of collagen XVIII NC1 domain (endostatin) in the zebrafish. Gene Expr Patterns 3:351–354 Hayashi M, Ninomiya Y, Hayashi K, Linsenmayer TF, Olsen BR, Trelstad RL (1988) Secretion of collagen types I and II by epithelial and endothelial cells in the developing chick cornea demonstrated by in situ hybridization and immunohistochemistry. Development 103:27–36 Huysseune A, Hall BK, Witten PE (2007) Establishment, maintenance and modifications of the lower jaw dentition of wild Atlantic salmon (Salmo salar L.) throughout its life cycle. J Anat 211: 471–487 Huysseune A, Sire J-Y (1998) Evolution of patterns and processes in teeth and tooth-related tissues in non-mammalian vertebrates. Eur J Oral Sci 106(Suppl 1):437–481 Huysseune A, Witten PE (2006) Developmental mechanisms underlying tooth patterning in continuously replacing osteichthyan dentitions. J Exp Zool 306B:204–215 Huysseune A, Witten PE (2008) An evolutionary view on tooth development and replacement in wild Atlantic salmon (Salmo salar L.). Evol Dev 10:6–14 Ikeda T, Nomura S, Yamaguchi A, Suda T, Yoshiki S (1992) In situ hybridization of bone matrix proteins in undecalcified adult rat bone sections. J Histochem Cytochem 40:1079–1088 Jackman WR, Draper BW, Stock DW (2004) Fgf signaling is required for zebrafish tooth development. Dev Biol 274:139–157 Jernvall J, Thesleff I (2000) Reiterative signaling and patterning during mammalian tooth morphogenesis. Mech Dev 92:19–29 Keränen SVE, Åberg T, Kettunen P, Thesleff I, Jernvall J (1998) Association of developmental regulatory genes with the devel-

Dev Genes Evol (2008) 218:427–437 opment of different molar tooth shapes in two species of rodents. Dev Genes Evol 208:477–486 Kimura S, Ohno Y (1987) Fish type I collagen: tissue-specific existence of two molecular forms, (α1)2α2 and α1α2α3, in Alaska pollack. Comp Biochem Physiol 88B:409–413 Kimura S, Ohno Y, Miyauchi Y, Uchida N (1987) Fish type I collagen: wide distribution of an α3 subunit in teleosts. Comp Biochem Physiol 88B:27–34 Kondo M (2007) Bone morphogenetic proteins in the early development of zebrafish. FEBS J 274:2960–2967 Laizé V, Martel P, Viegas CSB, Price PA, Cancela ML (2005) Evolution of matrix and bone γ-carboxyglutamic acid proteins in vertebrates. J Biol Chem 280:26659–26668 Laurenti P, Thaeron-Antono C, Allizard F, Huysseune A, Sire J-Y (2004) The cellular expression of eve1 suggests its requirement for the differentiation of the ameloblasts, and for the initiation and morphogenesis of the first tooth in the zebrafish (Danio rerio). Dev Dyn 230:727–733 Lefebvre V, de Crombrugghe B (1998) Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol 16:529–540 Le Guellec D, Morvan-Dubois G, Sire J-Y (2004) Skin development in bony fish with particular emphasis on collagen deposition in the dermis of the zebrafish (Danio rerio). Int J Dev Biol 48:217–231 Linde A, Goldberg M (1993) Dentinogenesis. Crit Rev Oral Biol Med 4:679–728 Lukinmaa PL, Vaahtokari A, Vainio S, Sandberg M, Waltimo J, Thesleff I (1993) Transient expression of type III collagen by odontoblasts: developmental changes in the distribution of proalpha 1(III) and pro-alpha 1(I) collagen mRNAs in dental tissues. Matrix 13:503–515 MacNeil RL, Berry J, Strayhorn C, Somerman MJ (1996) Expression of bone sialoprotein mRNA by cells lining the mouse tooth root during cementogenesis. Arch Oral Biol 41:827–835 Martínez-Barberá JP, Toresson H, Da Rocha S, Krauss S (1997) Cloning and expression of three members of the zebrafish Bmp family: Bmp2a, Bmp2b and Bmp4. Gene 198:53–59 Mitsiadis TA, Muchielli ML, Raffo S, Proust JP, Koopman P, Goridis C (1998) Expression of the transcription factors Otlx2, Barx1 and Sox9 during mouse odontogenesis. Eur J Oral Sci 106 (Suppl 1):112–116 Moghadam HK, Ferguson MM, Danzmann RG (2005) Evolution of Hox clusters in Salmonidae: a comparative analysis between Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). J Mol Evol 61:636–649 Morvan-Dubois G, Haftek Z, Crozet C, Garrone R, Le Guellec D (2002) Structure and spatio-temporal expression of the full length DNA complementary to RNA coding for α2 type I collagen of zebrafish. Gene 294:55–65 Morvan-Dubois G, Le Guellec D, Garrone R, Zylberberg L, Bonnaud L (2003) Phylogenetic analysis of vertebrate fibrillar collagens locates the position of zebrafish α3(I) and suggests an evolutionary link between collagen α chains and Hox clusters. J Mol Evol 57:501–514 Ortiz-Delgado JB, Simes DC, Gavaia P, Sarasquete C, Cancela ML (2005) Osteocalcin and matrix Gla protein in developing teleost teeth: identification of sites of mRNA and protein accumulation at single cell resolution. Histochem Cell Biol 124:123–130 Papagerakis P, Berdal A, Mesbah M, Peuchmaur M, Malaval J, Nydegger J, Simmer J, MacDougall M (2002) Investigation of osteocalcin, osteonectin, and dentin sialophosphoprotein in developing human teeth. Bone 30:377–385 Parker WK (1873) The bakerian lecture—on the structure and development of the skull in the salmon (Salmo salar L.). Philos Trans R Soc Lond 163:45–145 Plikus MV, Zeichner-David M, Mayer JA, Reyna J, Bringas P, Thewissen JGM, Snead ML, Chai Y, Chuong CM (2005)

437 Morphoregulation of teeth: modulating the number, size, shape and differentiation by tuning Bmp activity. Evol Dev 7:440–457 Prostak KS, Seifert P, Skobe Z (1993) Enameloid formation in two tetraodontiform fish species with high and low fluoride contents in enameloid. Arch Oral Biol 38:1031–1044 Prostak K, Skobe Z (1985) The effects of colchicine on the ultrastructure of the dental epithelium and odontoblasts of teleost tooth buds. J Craniofac Genet Dev Biol 5:75–88 Prostak K, Skobe Z (1986a) Ultrastructure of the dental epithelium and odontoblasts during enameloid matrix deposition in cichlid teeth. J Morphol 187:159–172 Prostak K, Skobe Z (1986b) Ultrastructure of the dental epithelium during enameloid mineralization in a teleost fish, Cichlasoma cyanoguttatum. Arch Oral Biol 31:73–85 Saito M, Takenouchi Y, Kunisaki N, Kimura S (2001) Complete primary structure of rainbow trout type I collagen consisting of α1(I)α2(I)α3(I) heterotrimers. Eur J Biochem 268: 2817–2827 Sire J-Y, Davit-Beal T, Delgado S, Van der heyden C, Huysseune A (2002) First-generation teeth in nonmammalian lineages: evidence for a conserved ancestral character? Microsc Res Tech 59:408–434 Sommer B, Bickel M, Hofstetter W, Wetterwald A (1996) Expression of matrix proteins during the development of mineralized tissues. Bone 19:371–380 Streelman JT, Webb JF, Albertson RC, Kocher TD (2003) The cusp of evolution and development: a model of cichlid tooth shape diversity. Evol Dev 5:600–608 Tchernavin V (1938) Changes in the salmon skull. Trans Zool Soc Lond 24:103–185 Tucker AS, Matthews KL, Sharpe PT (1998) Transformation of tooth type induced by inhibition of BMP signaling. Science 282:1136–1138 Vaahtokaari A, Åberg T, Jernvall J, Keränen S, Thesleff I (1996) The enamel knot as a signaling center in the developing mouse tooth. Mech Dev 54:39–43 Vainio S, Karavanova I, Jowett A, Thesleff I (1993) Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development. Cell 75:45–58 Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Werner S, Thesleff I (2004) Follistatin regulates enamel patterning in mouse incisors by asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev Cell 7:719–730 Webb PP, Moxham BJ, Ralphs JR, Benjamin M (1998) Immunolocalisation of collagens in the developing rat molar tooth. Eur J Oral Sci 106(Suppl 1):147–155 Wise SB, Stock DW (2006) Conservation and divergence of Bmp2a, Bmp2b, and Bmp4 expression patterns within and between dentitions of teleost fishes. Evol Dev 8:511–523 Witten PE, Hall BK (2002) Differentiation and growth of kype skeletal tissues in anadromous male Atlantic salmon (Salmo salar). Int J Dev Biol 46:719–730 Witten PE, Hall BK (2003) Seasonal changes in the lower jaw skeleton in male Atlantic salmon (Salmo salar L.): remodelling and regression of the kype after spawning. J Anat 203:435–450 Witten PE, Hall BK, Huysseune A (2005) Are breeding teeth in Atlantic salmon a component of the drastic alterations of the oral facial skeleton? Arch Oral Biol 50:213–217 Yamashiro T, Tummers M, Thesleff I (2003) Expression of bone morphogenetic proteins and Msx genes during root formation. J Dent Res 82:172–176 Yan YL, Willoughby J, Liu D, Crump JG, Wilson C, Miller CT, Singer A, Kimmel C, Westerfield M, Postlethwait JH (2005) A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development 132:1069–1083