JOURNAL OF VIROLOGY, Jan. 1995, p. 75–81 0022-538X/95/$04.0010 Copyright q 1995, American Society for Microbiology
Vol. 69, No. 1
Unique Insertion Sequence and Pattern of CD4 Expression in Variants Selected with Immunotoxins from Human Immunodeficiency Virus Type 1-Infected T Cells HUA FANG
AND
SETH H. PINCUS*
Laboratory of Microbial Structure and Function, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, Hamilton, Montana 59840 Received 17 May 1994/Accepted 7 October 1994
To study the variability of human immunodeficiency virus type 1 (HIV-1), we used immunotoxins to select for variants within a population of H9 cells persistently infected with a molecular clone of HIV-1 designated NL4-3. Chimeric immunotoxin CD4-PE40 (a chimeric fusion protein consisting of the amino-terminal two domains of CD4 and the carboxy-terminal domains of Pseudomonas exotoxin A) was used to select for cells lacking cell surface expression of HIV Env (envelope proteins gp160, gp120, and gp41). The cells described here (A1, A7, C9, and E9) fail to express HIV proteins because they have markedly diminished transcription of the integrated provirus (A1, A7, and E9) or no HIV provirus (C9). Analysis demonstrated that two different cloned variants, A1 and E9, contain the complementary sequence of tRNALys (45 bp) inserted 3* to the primer-binding 3 site, followed by a 169-bp deletion through the start of the gag gene. No HIV mRNA was detected by Northern (RNA) blotting, but PCR demonstrated the presence of the viral message. These variants were found very infrequently in the unselected H9/NL4-3 cell population, and they contained proviruses distinct from that found in the dominant population. In addition, all of these variants had similar patterns of CD4 surface expression that allowed them to escape reinfection within the tissue culture. The data are discussed with regard to mechanisms and errors of HIV reverse transcription, as well as the evolution of mutants within a population of persistently infected cells. Anti-human immunodeficiency virus (HIV) immunotoxins have been made as potential therapeutic agents for AIDS (2, 4, 11, 14, 15, 26). These immunotoxins have been targeted to HIV envelope proteins gp120 and gp41 with either antibodies or soluble CD4. Upon entry into cells expressing the target antigens at their surface, the immunotoxins kill the cells, primarily through ribosomal inactivation. Because the target antigen must be expressed on the cell surface and then internalized to obtain cell killing, the immunotoxins are useful as probes of HIV variation and to study the cell biology of HIV infection (15, 16, 19). We have previously selected persistently infected cell lines for variants with an anti-gp120 immunotoxin. We have shown that the variants fell into two general classes: those in which only the expression of HIV Env (envelope proteins gp160, gp120, and gp41) was altered and those in which the production of all viral proteins was diminished or absent (19). Altered Env expression was shown to be due to a mutation in gp41, resulting in a truncated form of the transmembrane protein and altered processing of both the envelope protein and the intact virus. In this report, we describe variants that arose from another selection in which levels of all HIV proteins were below detection, there was a markedly diminished level of HIV mRNA, and the cells contained a mutation within the proviral DNA. Also, these cells have a unique pattern of CD4 cell surface expression that has allowed them to escape reinfection within the original tissue culture.
MATERIALS AND METHODS Cell lines and reagents. H9 cells persistently infected with molecularly cloned virus NL4-3 (1) have been described elsewhere (14, 17). These cells remain .99% positive for HIV antigen, even after serial passage for over 1 year. CD4-PE40, a chimeric fusion protein containing the two amino-terminal domains of human CD4 coupled to the toxic domains of Pseudomonas exotoxin A (2, 4), was obtained from Upjohn Laboratories (Kalamazoo, Mich.), as was soluble CD4. The anti-Env monoclonal antibodies and the antibody-targeted ricin A chain conjugates used have been previously characterized (14, 15). HIV immune globulin (HIVIG) (20) and anti-CD4 antibody Sim.2 (12) were obtained from the AIDS Research and Reference Reagent Repository (Rockville, Md.). H9/NL4-3 cells were cultured at different densities (100 to 105 cells per 2-ml well) in the presence of CD4-PE40 at 1 mg/ml for 3 weeks. The survivors from the well containing 105 cells were cloned by limiting dilution, resulting in the variant cell lines. Variant E9 was subsequently subjected to a second round of limitingdilution cloning. All of the cell lines were maintained in RPMI 1640 containing 10% fetal bovine serum (HyClone, Logan, Utah), antibiotics, and 2-mercaptoethanol (5 3 1024 M). The numbering of the NL4-3 viral sequences corresponds to that of the Los Alamos database (13). Immunologic and viral characterization of cell lines. Details of all of the techniques used have previously been published. Cell lines were tested for sensitivity to immunotoxin action by measuring the inhibition of [35S]Met incorporation (i.e., protein synthesis) in the presence of 2 mg of the immunotoxin per ml (14). Expression of cell surface gp120 and CD4 was measured by indirect immunofluorescence and flow cytometry (14). Western blotting (immunoblotting) was performed with cell lysates and HIVIG to detect HIV-specific antigens (16). Immunoperoxidase staining was performed on ethanol-permeabilized cells with HIVIG (19). Reverse transcriptase (RT) activity was measured in cell supernatants with a poly(rA) template and radiolabeled dTTP (10, 19). Cellular and supernatant p24 was measured with a commercially available antigen capture enzyme-linked immunosorbent assay (Cellular Products, Buffalo, N.Y.; 19). Infectious virus was quantified with a focal infectivity assay by plating different numbers of test cells on monolayers of CD41 HeLa cell line 1022 (5, 6). Viral foci were detected by immunoperoxidase staining with HIVIG and by their characteristic multinucleated morphology. Percent infectious centers was calculated as follows: percent infectious centers 5 (number of foci/number of input cells) 3 100. Molecular characterization of cell lines. Cellular DNA was prepared by lysing cells in the presence of sodium dodecyl sulfate (SDS) and proteinase K, followed by phenol and chloroform extractions, RNase digestion, and ethanol precipita-
* Corresponding author. Mailing address: Laboratory of Microbial Structure and Function, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases, 903 South Fourth St., Hamilton, MT 59840. Phone: (406) 363-9317. Fax: (406) 363-9204. Electronic mail address:
[email protected]. 75
76
FANG AND PINCUS
J. VIROL. TABLE 1. Oligonucleotide pairs used in this study
Positions covered by fragment generateda
Sense sequence
Antisense sequence
F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12 F13
1–1193 989–1431 1343–2332 2163–3206 2929–3846 3774–4772 4606–5593 5515–6580 6298–7270 7125–7651 7567–8490 8321–9165 8945–9709
TGGAAGGGCTAATTCACTCC CCCTTCAGACAGGATCAGAA ATACCATGCTAAACACAGTGG ACCAGAAGAGAGCTTCAGGTT ATACTGCATTTACCATACCTAGTA ACCTGGATTCCTGAGTGGGAG TTAAGGCCGCCTGTTGGTGG ATAAAGCCACCTTTGCCTAG GATCTGTAGTGCTACAGA GAAAAAGAATCCGTATCCAGAGAG GCTGCTATTAACAAGAGATGGTGG TCTATAAGTGAATAGAGTTAG TGCTTGTGCCTGGCTAGAAGCAC
ACTATAGGGTAATTTTGGCT TCTATCCCATTCTGCAGCTT CCTGTATCTAATAGAGCTTCC TATTGCTGGTGATCCTTTCC GTTCTTTCTCTAACTGGTACC GAATACTGCCATTTGTACTG CTCTGTGGCCCTTGGTCTTC TACACATGGCTTTAGGCTT GCTTGTTCTCTTAATTTGCTAGCTATCT CCAATTGTCCCTCATATCTCCTCCT TCGTCCCAGATAAGTGCTAA AGTTCTGCCAATCAGGGAAG TGCTAGAGATTTTCCACACTGAC
39 LTR
9076–9614
TGGAAGGGCTAATTCACTCC
GGCAAGCTTTATTGAGGCTTAAGC
Fragment
a
Locations of the ends of the fragments generated by PCR with these primers. The number refers to the Los Alamos database sequence of cloned HIV NL4-3 (13).
tion as described elsewhere (19). Poly(A) RNA was obtained from SDSproteinase K lysates. mRNA was subsequently purified on oligo(dT) cellulose columns. When needed, samples were then treated with RNase-free DNase 1 (GIBCO BRL, Gaithersburg, Md.) to eliminate contaminating DNA (9). Five hundred nanograms of undigested genomic DNA from cell lines and 5 ng of HIV plasmids were used in a DNA PCR, which was performed in a total volume of 50 ml, with 1.25 U of Taq polymerase (Amplitaq; Cetus, Norwalk, Conn.), a 200 mM concentration of each deoxynucleoside triphosphate (Pharmacia, Piscataway, N.J.), and primers at 0.4 mM. The final concentration of MgCl2 was optimized for different primer pairs. DNA was amplified in an automatic thermal cycler (Coy 60; [Coy, Ann Arbor, Mich.] and TC-1 [PerkinElmer Cetus, Rockville, Md.]) with the following profile: cycle 1, 1.5 min at 948C, 2 min at 558C, and 1 min at 728C; cycles 2 to 39, 1 min at 948C, 2 min at 558C, and 1 min at 728C; cycle 40, 1.5 min at 948C, 2 min at 558C, and 10 min at 728C. To perform PCR on mRNA, the sample was first reverse transcribed into cDNA in a 10-ml total volume with final concentrations of 5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, and each deoxynucleoside triphosphate at 1 mM, 0.5 U of RNase inhibitor, 1.25 U of RT, and 200 ng of the antisense primer or 2.5 mM oligo(dT)16, covered with mineral oil, and incubated at 428C for 15 min. In the same tube, PCR on the cDNA was done in a 50-ml total volume with final concentrations of 2 to 3 mM MgCl2, 50 mM KCl, and 10 mM Tris-HCl, 200 ng of the sense primer [plus the antisense primer when oligo(dT)16 was used], and 1.25 U of Taq polymerase and incubation under the same conditions as for the DNA PCR. We refer to this process as RT PCR. Oligonucleotides were synthesized on an 8400 Cyclone Plus DNA synthesizer (Millipore, Burlington, Mass.). The sequences of the oligonucleotides synthesized are given in Table 1. To perform Southern blots of PCR fragments, 10 ml of the PCR product was loaded onto 1.5 to 2% agarose gels and electrophoresed. DNA was denatured in 0.5 M NaOH–1.5 M NaCl for 1 h and then neutralized in 1 M Tris (pH 7.4)–1.5 M NaCl for 1 h. The gel was transferred to a nitrocellulose membrane (BA85; Schleicher & Schuell, Inc., Keene, N.H.). The membrane was baked for 1.5 h at 808C in a vacuum oven. The membrane was prehybridized at 628C for 2 to 3 h in 63 SSC (13 SSC is 0.15 M NaCl plus 0.015% sodium citrate)–53 Denhardt’s solution–100 mg of sheared and denatured salmon sperm DNA per ml, and hybridization was performed under the same conditions for 16 to 20 h with a radiolabeled probe. The templates for labeling of probes were either restriction fragments of a plasmid containing HIV sequences or a PCR product amplified from such plasmids. Probes were labeled by using random-primer labeling methods, in which 100 to 200 ng of a heat-denatured template was added in a 50-ml total volume containing random hexamer oligonucleotides; 2 ml of 0.5 mM dATP, dGTP, and dTTP; 5 ml of 10 mM [a-32P]dCTP (3,000 Ci/mmol); and 1 ml of the Klenow fragment (3 U/ml) (Random Primer DNA Labeling System; GIBCO BRL). Following hybridization, the filter was washed once with 13 SSC–0.1% SDS for 0.5 h at 628C and once with 0.13 SSC–0.1% SDS for 0.5 h at the same temperature. Autoradiography was performed for 20 min to several hours. Northern blots were performed as described elsewhere (24). One microgram of poly(A) RNA was electrophoresed on 1.0 to 1.5% agarose–6.6% formaldehyde gels. The RNA was transferred to nitrocellulose membranes by capillary diffusion. The filter was baked at 808C for 1.5 h. Prehybridization was performed at 688C in 63 SSC–23 Denhardt’s solution–0.1% SDS, and hybridization was performed under the same conditions for 16 h. Plasmids containing the entire NL4-3 sequence were used as templates for the radiolabeled probe. Probes were labeled by random priming. After hybridization, filters were washed (at 688C) once in 13 SSC–0.1% SDS for 20 min, three times in 0.23 SSC–0.1% SDS for
20 min each time, and once in 0.13 SSC–0.1% SDS for 20 min. Autoradiograms were performed for 6 to 24 h. PCR fragments were cloned with the pCR Vector, which provides single 39 T overhangs at an insertion site for PCR products (Invitrogen, San Diego, Calif.). Ligation was performed in a total volume of 10 ml containing 50 ng of the vector, 1 ml of the PCR product (about a 1:1 insert-to-vector molar ratio), and 4 U of T4 DNA ligase (Invitrogen). The reaction was incubated at 128C overnight. OneShot competent Escherichia coli (Invitrogen) was transformed with the ligated DNA. Transformants were selected on Luria broth-carbenicillin plates with 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal), and white colonies were subjected to further analysis. The templates used for sequencing were either PCR products, which were purified through Centricon 100 columns (Amicon, Beverly, Mass.) or plasmids containing cloned PCR fragments. The Taq Dye Primer Cycle Sequencing or the Taq DyeDeoxy Terminator Cycle Sequencing protocol (Applied Biosystems, Foster City, Calif.) was used in association with the necessary kit supplied by the manufacturer. Running and analysis of the samples were performed on an ABI 373A DNA Sequencer and associated software (Applied Biosystems). MacVector (International Biotechnologies Inc., New Haven, Conn.) was used for analysis of sequence data. Nucleotide sequence accession number. The sequence in Fig. 4 has been assigned GenBank accession number L32865.
RESULTS Selection of immunotoxin-resistant variant cells. H9/NL4-3 cells were selected in the presence of 1 mg of CD4-PE40 per ml. Resistant cells arose at a frequency of approximately 1023. Immunotoxin-resistant cells were cloned by limiting dilution in the absence of CD4-PE40, and 11 clones were selected for further analysis. All of the clones maintained immunotoxin resistance; in contrast, H9/NL4-3 clones derived in the absence of immunotoxin were uniformly sensitive to immunotoxin effects (data not shown). As with a previous immunotoxin selection (19), the immunotoxin-resistant variants fell into two classes: those in which expression of all HIV proteins was absent (or greatly diminished) and those in which only cell surface Env was altered. Of the 11 clones, 9 fell into the first class and 2 fell into the second. Four of the former clones, designated A1, A7, C9, and E9, were selected for further analysis. Expression of HIV proteins in cloned variants. We characterized HIV antigen expression in these variant cell lines and compared the results to those obtained with unselected, uncloned H9/NL4-3 and uninfected parental cell line H9. All of the variants were resistant to a panel of anti-Env immunotoxins (Fig. 1). Although highly effective against H9/NL4-3, neither anti-gp120 nor anti-gp41 immunotoxin killed the variants. Western blots of cell lysates with anti-HIV antibodies
VOL. 69, 1995
IMMUNOTOXIN-RESISTANT HIV VARIANTS
77
TABLE 2. Status of HIV provirus in variant cell lines Length(s) (kb) of: Cell line
Provirus copy no.
H9/NL4-3 A1 A7 C9 E9
2 1 1 0 2
Unique feature
59-flanking fragmenta
39-flanking fragmentb
4.3, 3.5 4.2 5.0
19.0, 4.4 4.9 4.4
tRNA sequence
4.2, 3.2
6.2, 4.9
tRNA sequence
a
Length(s) of HincII fragment(s) detected by Southern blotting with probe representing nucleotides 1443 to 2496. The 59 HincII site of NL4-3 is located at nucleotide 2496. b Length(s) of EcoRI fragment(s) detected by Southern blotting with probe representing nucleotides 7611 to 8465. The EcoRI site is located at nucleotide 5743.
FIG. 1. Sensitivity of variant cells to immunotoxins. Parental (H9/NL4-3) and variant (A1, A7, C9, and E9) cells were incubated in the presence of 2 mg of immunotoxin per ml, and protein synthesis was measured as incorporation of [35S]Met into cellular proteins. The immunotoxins included an irrelevant antibody, T7, coupled to the ricin A chain (RAC); anti-V3 loop immunotoxin 924-RAC; CD4-PE40; and an anti-gp41 immunotoxin, 41.1-RAC, the latter tested in the presence or absence of soluble CD4 (1 mg/ml) (15). u, T7-RAC; z, CD4-PE40; h, 924-RAC; ■, 41.1-RAC; , 41.1-RAC plus CD4.
1 1
showed the expected proteins in H9/NL4-3 but nothing in variants (Fig. 2). Other assays also failed to demonstrate HIV proteins in variants. No cell surface Env was detected by flow cytometry. P24 antigen levels were measured in both cell lysates and supernatants. In the cell lysates, the level of
FIG. 2. Western blots of variant cells. Lysates of uninfected H9, H9/NL4-3, and variant cells were subjected to Western blot analysis with human HIVIG as the primary antibody. The light bands in lane C9 were spillover from an adjacent lane with a very strong signal on the original autoradiogram (note the cut line). These bands did not appear on other Western blots in which the adjacent lanes contained DNA producing no signal. The values on the left are molecular masses in kilodaltons.
H9/NL4-3 was 7 pg per cell and that of variants and uninfected H9 was ,0.00038 pg per cell. Radioimmunoprecipitation and immunoperoxidase staining of ethanol-permeabilized cells showed no expression of HIV proteins in variants. Nor was RT activity detected in the supernatants. We used an extremely sensitive focal infectivity assay to measure the production of infectious HIV by the cell lines. Most of the H9/NL4-3 cells formed foci, while for the variants and the uninfected H9 cells ,0.004% infectious centers were detected. Thus, sensitive assays did not detect HIV or HIV proteins in the variant cells. We also tested whether HIV expression could be induced in the variant cells by addition of either phorbol myristate acetate or tumor necrosis factor alpha. There was no induction of HIV gene expression by either of these agents in the variant cells. Analysis of proviral DNA. The status of HIV proviral DNA in the genomes of the parental and variant cells was assessed by Southern blotting, PCR, and sequencing. Results of Southern blotting, performed with restriction enzymes and probes so that the status of the flanking regions could be evaluated, are summarized in Table 2. There were two copies of the provirus within parental H9/NL4-3 cells. E9 also had two copies of the provirus but with flanking sequences different from those in the parental cells. There was only one copy in A1 and A7, and no HIV proviral signal was found in the variant C9 cells. The provirus of A1 appeared to be the same as one of the E9 proviruses. To map the provirus for deletions, insertions, or rearrangements, we used a combination of PCR and Southern blotting. The proviruses of the variants were compared to those in H9/NL4-3 cells and to a plasmid carrying the NL4-3 sequences. The provirus was divided into 13 overlapping segments, each of which was amplified separately from cellular DNA by PCR. Table 1 defines these segments. The PCR products were electrophoresed, blotted, and then hybridized to radiolabeled probes containing specific NL4-3 sequences. In 12 of the 13 segments, the fragments from variants A1, A7, and E9 were identical in length to those of both the parental cells and the plasmid (data not shown). No PCR products were seen in C9, which had no detectable provirus, as determined by genomic Southern blotting. However, fragment 1 (covering nucleotides 1 to 1193) in A1 and E9 was significantly different from the others (Fig. 3). A1 had a shorter band, while E9 demonstrated two bands, one of which was identical to that of H9/NL4-3; the other was the same length as that of A1 [designated E9 (short)]. To define the difference between A1, E9 (short), and NL4-3, fragment 1 was sequenced (Fig. 4). Within the long terminal repeat (LTR), there was no important difference between the
78
FANG AND PINCUS
FIG. 3. PCR mapping of parental and variant proviruses. DNAs were obtained from H9, H9/NL4-3, and variant cell lines. DNA was PCR amplified with the primer pair designated F1 (Table 1). Amplified sequences corresponding to HIV were detected by hybridization with radiolabeled probes. The numbers on the left are sizes in nucleotides.
published NL4-3 sequence and that found in H9/NL4-3, A1, and E9 (short) other than the obvious fact that the 59 LTR sequences of the proviruses contain the U3 region derived from the 39 LTR of infectious molecular clone pNL4-3. However, there were significant differences between A1, E9 (short), and NL4-3 immediately 39 of the primer binding site. The primer-binding site contains an 18-nucleotide sequence homologous to a portion of tRNALys that allows the use of this 3 tRNA to prime for reverse transcription. 39 to this region, there was a 45-bp insertion and a 169-bp deletion which continued into the start of the gag gene. The regions involved are shown in Fig. 4A, and the sequences are given in Fig. 4B. The sequence of the insertion in A1 and E9 (short) is complementary to that of tRNALys (23). The insertion and 3 deletion in both A1 and E9 (short) are identical except for a single nucleotide difference within the inserted sequence. Figure 4C compares the sequence of the insertion with that of tRNALys 3 . The deletion encompasses the major 59 donor splice site. There is no open reading frame encompassing a start site and the remainder of the in-frame gag gene. Transcription of viral genes. To study transcription of viral genes, we measured viral mRNA levels in parental and variant cells. Northern (RNA) blot analysis with radiolabeled HIV sequences gave a strong signal with H9/NL4-3 but nothing with variants (Fig. 5), while the actin control showed similar amounts of actin mRNA in these cell lines. Because Northern blotting may not detect the presence of low-level transcripts, RT PCR was performed with poly(A) RNA extracted from the cell lines as the template. Figure 6 shows that PCR products were obtained with all of the cell lines shown. The amplification of these bands was dependent on the presence of RT during the initial incubation, indicating that the PCR product does not result from DNA contamination. Other evidence that this is mRNA and not DNA is the identification of spliced forms in H9/NL4-3 (data not shown). Thus, a low level of HIV mRNA is produced in the variant cells. CD4 expression on the cell surface. Prior to immunotoxin
J. VIROL.
selection, the variant cells existed in a tissue culture containing large quantities of infectious HIV. To evaluate the mechanism whereby the variant cells avoided superinfection, we examined the expression of cell surface CD4 in the variant cell lines (Fig. 7A). CD4 was expressed on all uninfected H9 cells. As expected, CD4 was absent from the surface of infected H9/ NL4-3 cells. Each of the variant cell lines showed the same pattern of CD4 expression: two subpopulations, one CD41 and the other CD42. Although each of these variant cells was a clone, we asked whether these are two distinct subpopulations or whether there is modulation of CD4 expression. Variant E9 was recloned, and CD4 expression was examined on the subclones (Fig. 7B). There was a full range of patterns of CD4 expression, ranging from almost completely negative to fully positive. However, several of the clones were again mixed populations, indicating that populations derived from a single cell can contain both CD41 and CD42 cells. Clones 2 and 7 were monitored through several months of serial passage, during which the character of CD4 expression changed, again yielding CD41 and CD42 subpopulations. These data indicate that cell surface CD4 expression in the variant cells can be turned on and off. DISCUSSION HIV infection of a cell line is a dynamic process. During the initial stages of infection, there are rapid alterations in the proportion of infected versus uninfected cells in addition to large-scale cytopathic effects. But even after a stable, persistent infection has been established, there are subpopulations of cells whose relative proportions can vary (3, 19). These subpopulations reflect events occurring during the initial stages of infection, as well as ongoing events due to variation and the interaction among the virus, the host cell, and factors within the tissue culture environment. We used anti-HIV immunotoxins to select for variants that have altered envelope expression. The rarity of these variants (approximately 1 in 1,000) indicates the stability of the infection within the H9/NL4-3 cell line. The variants described in this report have two sets of alterations. The first results in the failure of expression of HIV proteins, resulting primarily from mutations within the provirus. The second is variable expression of CD4 on the surfaces of the variant cells, which has allowed the variants to escape reinfection with HIV produced by other cells within the tissue culture. HIV infection of cells can result in the down-regulation of CD4 expression (8). However, this is an unlikely explanation for the CD4 modulation in the variant cells because no HIV proteins appeared to be expressed. Moreover, the expression of CD4 on the variant cells can be unregulated as well as turned off. We are currently exploring the molecular regulation of CD4 expression in these variant cells. It is likely that these variants arose prior to immunotoxin selection because immunotoxin killing is so rapid that there was not time for adaptive changes to occur (18). Analyses of the proviruses in the variant cell lines suggest their origins. C9 has no detectable provirus. This may indicate that C9 either was never infected or had been infected and then the provirus was deleted. The provirus of A7 is unique compared with either the parental H9/NL4-3 line or the other variants,
FIG. 4. 59 regions of proviral DNA in H9/NL4-3, A1, and E9 (short). (A) Overall maps showing the site of the deletion-insertion in the A1 and E9 (short) proviruses. PBS, primer-binding site. (B) Sequence of the proviral DNA at the site of the insertion and deletion. The region covered is shown by the wavy line (p) in panel A. The numbers refer to the numbering of the NL4-3 sequence. (C) Comparison of the sequence of the insertion in A1 and E9 to that of tRNALys 3 . The underlining indicates sequence. unusual or modified bases within the tRNA. The region covered is shown by the wavy line (pp) in panel A. The numbering corresponds to that of the tRNALys 3
VOL. 69, 1995
IMMUNOTOXIN-RESISTANT HIV VARIANTS
79
80
FANG AND PINCUS
J. VIROL.
FIG. 5. Northern blot analysis of transcripts from variant cell lines. Equal amounts of poly(A) mRNAs from the cell lines were electrophoresed in formaldehyde-agarose gels, blotted, and then probed with radiolabeled HIV (left panel) or actin (right) sequences. The autoradiograms were deliberately overexposed to detect any HIV message within the variants. The numbers on the left are size standards (in kilobases).
implying that this variant arose independently of the others. Both E9 and A1 have a common provirus with identical flanking regions and mutations, although there is a single nucleotide difference in the inserted sequence. However, E9 has an additional provirus not present in A1. The most likely explanation is that E9 lost the second provirus, begetting the progenitors of A1. However, the reverse cannot be ruled out, i.e., that A1 was superinfected but the provirus that was inserted was defective, giving rise to E9. The proviruses of variants A1 and E9 contain both a unique insertion, complementary to tRNALys 3 , and a deletion encompassing the 59 major splice site and the start of gag. Although not proven, it is likely that the greatly diminished level of HIV mRNA is due to the insertion and/or deletion rather than to some other event. Either the deletion of the 59 major splice site or mRNA instability caused by the secondary structure imparted by tRNA sequences could account for diminished message levels (22). Subsequent underproduction of Tat and
FIG. 6. RT PCR performed on poly(A) mRNA isolated from H9/NL4-3 and variant cell lines. Reactions were performed in the presence (1) or absence (2) of RT. Samples were amplified for 40 cycles. The primers used were those designated 39 LTR in Table 1, located within the 39 LTR (9076 to 9614). Amplified sequences corresponding to HIV were detected by hybridization with radiolabeled probes.
FIG. 7. Cell surface expression of CD4. Cells were stained with anti-CD4 antibody Sim.2 and then fluoresein isothiocyanate-conjugated anti-mouse immunoglobulin. Three thousand cells were analyzed by flow cytometry. Cell numbers are represented by the vertical axis, and fluorescence intensity is represented by the horizontal axis. (A) Parental and variant cell lines. (B) Subclones of variant cell line E9.
deficient transactivation could then lead to a further diminution of mRNA synthesis. It is unlikely that alterations in enhancer and promoter sequences within the LTR have caused altered transcription because the sequences of the 59 LTRs of H9/NL4-3 and variant proviruses do not differ significantly from each other. However, the techniques we used to analyze most of the A1 provirus, PCR amplification and Southern blotting, are unlikely to detect most point mutations, so that we cannot rule out other influential changes within the provirus in regions we have not sequenced. We have not identified the alterations in the A7 and second E9 proviruses that lead to deficient HIV transcription. The insertion of tRNALys most likely occurred during the 3 initial reverse transcription of HIV-1 genomic RNA, prior to integration. The process of reverse transcription is notably error prone, and mutations similar to those described here have been reported in other retroviral systems (7, 21, 25). The most likely mechanism to account for both the insertion and the deletion is that during plus-strand DNA synthesis the RNase H activity failed to degrade the tRNA primer. Most of the primer was then copied, including a number of unusual and modified bases. This process generated extra 39 bases on the
VOL. 69, 1995
IMMUNOTOXIN-RESISTANT HIV VARIANTS
plus strand that could not hybridize during the second-strand transfer. The resulting deletion probably occurred when these sequences annealed elsewhere along the minus strand. The demonstration that HIV-1 RT can copy a tRNA, with its unusual and modified bases and its highly ordered structure, enlarges our knowledge of the versatility of this enzyme. A very low level of HIV transcription was maintained in the variant cell lines. Although PCR artifacts are well known, we are confident that we actually detected mRNA and not contaminating DNA. This belief is based on the failure to obtain a PCR signal when the RT step was omitted and the demonstration of PCR products indicating appropriate mRNA splicing (data not shown). The functional significance of this mRNA is unclear. Even very sensitive assays failed to detect the presence of any HIV proteins. The variants most likely represent a minor population within the uncloned H9/NL4-3 cells. The overall frequency of immunotoxin-resistant variants was less than 1 in 1,000. The flanking sequence restriction site polymorphism that defines the A1 provirus was not seen in Southern blots of DNA from the uncloned H9/NL4-3, and even a nested PCR could not detect the tRNA insertion in these cells. Immunotoxins have proven to be powerful tools for selection of rare variants from stably infected cell lines. We have defined two types of immunotoxin-resistant variants: those affecting only Env and those resulting from a more global defect in expression of HIV proteins. We have previously shown that a truncation of gp41 grossly alters the processing of both Env and the virion, leading to secretion of the virus into intracellular vesicles rather than cell surface budding (19). Here we describe variants that help define the abilities of HIV RT to read and copy unusual bases, as well as its capacity for error. We also showed that modulation of CD4 expression also played a role in the generation of these HIV-null variants. Other variants we have selected appear to be a result of cellular rather than viral variation that effects the processing of Env (14a). The study of naturally arising variants allows us to examine aspects of HIV function in both informative and unexpected ways. ACKNOWLEDGMENTS We thank Chun Liu for technical assistance, Sandra Morrison for synthesis of all oligonucleotides, Tom Duensing for helpful suggestions, Gerry Spangrude and Diane Brooks for assistance with flow cytometry, Carole Smaus and Susan Smaus for secretarial assistance, Robert Evans and Gary Hettrick for art work, and John Swanson, Wendy Maury, and Patti Rosa for excellent review of the manuscript. This work was supported by NIAID intramural research funds and by the NIH Intramural Targeted Anti-Viral Program. REFERENCES 1. Adachi, A., H. E. Gendelman, S. Koenig, T. Folks, R. Willey, A. Rabson, and M. A. Martin. 1986. Production of acquired immunodeficiency syndromeassociated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284–291. 2. Berger, E. A., K. A. Clouse, V. K. Chaudhary, S. Chakrabarti, D. J. FitzGerald, I. Pastan, and B. Moss. 1989. CD4-Pseudomonas exotoxin hybrid protein blocks the spread of human immunodeficiency virus infection in vitro and is active against cells expressing the envelope glycoproteins from diverse primate immunodeficiency retroviruses. Proc. Natl. Acad. Sci. USA 86:9539–9543. 3. Butera, S. T., B. D. Roberts, L. Lam, T. Hodge, and T. M. Folks. 1994. Human immunodeficiency virus type 1 RNA expression by four chronically infected cell lines indicates multiple mechanisms of latency. J. Virol. 68: 2726–2730. 4. Chaudhary, V. K., T. Mizukami, T. R. Fuerst, D. J. FitzGerald, B. Moss, I.
81
Pastan, and E. A. Berger. 1988. Selective killing of HIV-infected cells by recombinant human CD4-Pseudomonas exotoxin hybrid protein. Nature (London) 335:369–372. 5. Chesebro, B., and K. Wehrly. 1988. Development of a sensitive quantitative focal assay for human immunodeficiency virus infectivity. J. Virol. 62:3779– 3788. 6. Chesebro, B., K. Wehrly, J. Metcalf, and D. E. Griffin. 1991. Use of a new CD4-positive HeLa cell clone for direct quantitation of infectious human immunodeficiency virus from blood cells of AIDS patients. J. Infect. Dis. 163:64–70. 7. Colicelli, J., and S. P. Goff. 1986. Structure of a cloned circular retroviral DNA containing a tRNA sequence between the terminal repeats. J. Virol. 57:674–677. 8. Geleziunas, R., S. Bour, and M. A. Wainberg. 1994. Cell surface downmodulation of CD4 after infection by HIV-1. FASEB J. 8:593–600. 9. Gilman, M. 1989. Removal of contaminating DNA, p. 4.1.4–4.1.6. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. Greene Publishing Associates and Wiley-Interscience, New York. 10. Goff, S., P. Traktman, and D. Baltimore. 1981. Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase. J. Virol. 38:239–248. 11. Kim, Y.-W., M. S. C. Fung, N.-C. Sun, C. R. Y. Sun, N. T. Chang, and T. W. Chang. 1990. Immunoconjugates that neutralize HIV virions kill T cells infected with diverse strains of HIV-1. J. Immunol. 144:1257–1262. 12. McCallus, D., K. Ugen, A. Sato, W. Milliams, and D. Weiner. 1992. Construction of a recombinant bacterial human CD4 expression system producing a bioactive CD4 molecule. Viral Immunol. 5:163–172. 13. Myers, G., B. Korber, S. Wain-Hobson, R. F. Smith, and G. N. Pavlakis. 1993. Human retroviruses and AIDS 1993: a compilation and analysis of nucleic acid and amino acid sequences. Los Alamos National Laboratory, Los Alamos, N.Mex. 14. Pincus, S. H., R. L. Cole, E. M. Hersh, D. Lake, Y. Masuho, P. J. Durda, and J. McClure. 1991. In vitro efficacy of anti-HIV immunotoxins targeted by various antibodies to the envelope protein. J. Immunol. 146:4315–4324. 14a.Pincus, S. H., and T. Duensing. Unpublished data. 15. Pincus, S. H., and J. McClure. 1993. Soluble CD4 enhances the efficacy of immunotoxins directed against gp41 of the human immunodeficiency virus. Proc. Natl. Acad. Sci. USA 90:332–336. 16. Pincus, S. H., J. McClure, and H. Fang. 1994. Use of anti-HIV immunotoxins as probes of the biology of HIV-infected cells. Can. J. Infect. Dis. 5 (Suppl. A):23A–27A. 17. Pincus, S. H., and K. Wehrly. 1990. AZT demonstrates anti-HIV-1 activity in persistently infected cell lines: implications for combination chemotherapy and immunotherapy. J. Infect. Dis. 162:1233–1238. 18. Pincus, S. H., K. Wehrly, and B. Chesebro. 1989. Treatment of HIV tissue culture infection with monoclonal antibody-ricin A chain conjugates. J. Immunol. 142:3070–3075. 19. Pincus, S. H., K. Wehrly, E. Tschachler, S. F. Hayes, R. S. Buller, and M. Reitz. 1990. Variants selected by treatment of human immunodeficiency virus-infected cells with an immunotoxin. J. Exp. Med. 172:745–757. 20. Prince, A. M., B. Horowitz, L. Baker, R. W. Shulman, H. Ralph, J. Valinsky, A. Cundell, B. Brotman, W. Boehle, F. Rey, M. Piet, H. Reesink, N. Lelie, M. Tersmette, F. Miedema, L. Barbosa, G. Nemo, C. L. Nastala, J. S. Allan, D. R. Lee, and J. W. Eichberg. 1988. Failure of a human immunodeficiency virus (HIV) immune globulin to protect chimpanzees against experimental challenge with HIV. Proc. Natl. Acad. Sci. USA 85:6944–6948. 21. Pulsinelli, G. A., and H. M. Temin. 1991. Characterization of large deletions occurring during a single round of retrovirus vector replication: novel deletion mechanism involving errors in strand transfer. J. Virol. 65:4786– 4797. 22. Purcell, D. F. J., and M. A. Martin. 1993. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity. J. Virol. 67:6365–6378. 23. Raba, M., K. Limburg, M. Burghagen, J. R. Katze, M. Simsek, J. E. Heckman, U. L. Rajbhandary, and H. J. Gross. 1979. Nucleotide sequence of three isoaccepting lysine tRNAs from rabbit liver and SV40-transformed mouse fibroblasts. Eur. J. Biochem. 97:305–318. 24. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed., p. 7.37–7.52. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 25. Temin, H. M. 1993. Retrovirus variation and reverse transcription: abnormal strand transfers result in retrovirus genetic variation. Proc. Natl. Acad. Sci. USA 90:6900–6903. 26. Till, M. A., S. Zolla-Pazner, M. K. Gorny, J. S. Patton, J. W. Uhr, and E. S. Vitetta. 1989. Human immunodeficiency virus-infected T cells and monocytes are killed by monoclonal human anti-gp41 antibodies coupled to ricin A chain. Proc. Natl. Acad. Sci. USA 86:1987–1991.
