Original Article Upstream Regulatory Region of Zebrafish lunatic fringe: Isolation and Promoter Analysis Jing Liu,1,2,j Yong-Hua Sun,1,j Na Wang,1,2 Ya-Ping Wang,1 Zuo-Yan Zhu1 1 State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China 2 Graduate School of the Chinese Academy of Sciences, Beijing 100039, China
Received: 2 September 2005 / Accepted: 26 November 2005 / Published online: 26 May 2006
Abstract Lunatic fringe (Lfng), one modulator of Notch signaling, plays an essential part in demarcation of tissues boundaries during animal early development, especially somitogenesis. To characterize the promoter of zebrafish lfng and generate somite-specific transgenic zebrafish, we isolated the upstream regulatory region of zebrafish lfng by blast search at the Ensembl genome database (http://www. ensembl.org) and analyzed the promoter activity using green fluorescent protein (GFP) as a reporter. Promoter activity assay in zebrafish shows that the 0.2-kb fragment containing GC-box, CAAT-box, and TATA-box can direct tissue-specific GFP expression, while the 0.4-kb and 1.2-kb fragments with further upstream sequence included drive GFP expression more efficiently. We produced lfngEGFP-transgenic founders showing somite-specific expression of GFP and consequently generated a hemizygous lfngEGFP-transgenic line. The eggs from lfngEGFPtransgenic female zebrafish show strong GFP expression, which is consistent to the reverse-transcription polymerase chain reaction PCR (RT-PCR) detection of lfng transcripts in the fertilized eggs. This reveals that zebrafish lfng is a maternal factor existing in matured eggs, suggesting that fish somitogenesis may be influenced by maternal factors. Keywords: Green fluorescent protein — lfng — maternal factor — promoter — zebrafish
Introduction Lunatic fringe (Lfng), one of fringe families (lunatic fringe, manic fringe, and radical fringe), is a regulaj
These authors contributed equally to this work.
Correspondence to: Zuo-Yan Zhu; E-mail:
[email protected] DOI: 10.1007/s10126-005-5125-y
& Volume 8, 357–365 (2006) & *
tor of Notch signaling (Fleming et al., 1997; Zhang and Gridley, 1998). lfng encodes b-1, 3-N-acety1glucosaminy1 transferase (Bruckner et al., 2000; Moloney et al., 2000), which refines the spatial localization of Notch-receptor signaling to tissue boundaries by regulating the signal activity of Serrate and Delta (Cohen et al., 1997; Aulehla and Johnson, 1999). lfng was first found in Drosophila (Irvine and Wieschaus, 1994), and several homologues have been discovered in vertebrates (Johnson et al., 1997; Sakamoto et al., 1997; Prince et al., 2001). Fringe-modulated deployment of Notch signaling demarcates the formation of wing margin, eye, and leg in Drosophila (Fleming et al., 1997; Johnson et al., 1997). In zebrafish, lfng is generally expressed in many regions including the anteriorposterior (A-P) axis of the neural tube, dorsal midline cells, the lateral plate mesoderm, presomitic mesoderm (PSM), somites, specific rhombomeres, and so forth (Leve et al., 2001; Prince et al., 2001; Appel et al., 2003; Qiu et al., 2004) ). It is expressed stably within the PSM in wild-type embryos and is maintained in the anterior half of each of the formed somites. In lfng mutant zebrafish embryos, lfng expression cannot generate a correctly segmented array of somites (van Eeden et al., 1996; Holly et al., 2000). In addition to brain, neural tube, somites, PSM, and so forth, lfng is also expressed in some other sites in chicken and mouse, such as zona limitans intrathalamica, eye, retina, and otic vesicles in chicken (Laufer et al., 1997; Sakamoto et al., 1997; McGrew et al., 1998; Aulehla and Johnson, 1999; Cole et al., 2000; Chen and Chuong, 2000; Zeltser et al., 2001); and olfactory placode, myotome, inner ear, tongue, skin, teeth, hair follicle, and so forth in mouse (Cohen et al., 1997; Johnson et al., 1997; Ishii et al., 2000; Zhang et al., 2000; Favier et al., 2000; Pouyet and Mitsiadis, 2000; Thelu et al., 2002). In particular, expression Springer Science+Business Media, Inc. 2006
357
358
patterning of lfng in somites and PSM is different from that in zebrafish. It plays an essential part in the segmentation of PSM during somitogenesis (Dale et al., 2003). The glucosaminy1 transferase encoded lfng controls the activity of Notch via its dynamic expression in PSM and establishes a negative feedback loop that implements periodic inhibition of Notch (Prince et al., 2001; Giudicelli and Lewis, 2004). A comprehensive analysis of lfng expression waves in mouse PSM shows that a new somite boundary forms just after the end of a wave (Forsberg et al., 1998). It was also found that somites in the lfng mutant embryos were irregular in size and shape, and their A-P patterning was disturbed (Evrard et al., 1998; Zhang and Gridley, 1998). Overexpression of lfng causes expression inhibition of cyclic genes (Dale et al., 2003; Serth et al., 2003; Ishikawa et al., 2004). It was proposed that the function of Lfng in boundary definition of the somites might be ancestral, while its recruitment to the prepatterning process of the somites might be a derived feature in higher vertebrates (Leve et al., 2001). Our recent study demonstrates that the somitogenesis process and the vertebral numbers of the cross-genus cloned fish, which were derived from transgenic common carp (Cyprinus carpio) nuclei and goldfish (Carassius auratus) enucleated eggs, are both consistent in goldfish but different from common carp (Sun et al., 2005). This suggests that maternal factors might play a certain role in regulating somite development. Thus it is important to study somitogenesis in fish cross-species cloned embryos, which will likely provide novel insights into somite development. The goal of our present study was to generate a transgenic zebrafish line showing somite-specific expression of green fluorescent protein (GFP), which will allow us observe the dynamic pattern of lfng expression in zebrafish embryos. By screening the released zebrafish genome sequences on Ensembl (http://www.ensembl. org/) using the zebrafish lfng cDNA sequence, we isolated zebrafish lfng upstream regulatory region and generated three GFP expression vectors for transgenic study. We obtained the crucial sequence of zebrafish lfng promoter and one transgenic line of somite-specific GFP expression; furthermore, we found expression of lfng in the eye and maternal inheritance of lfng mRNA in zebrafish embryos, which are, to our knowledge, the first report of these. Materials and Methods Total DNA Isolation and Cloning of Lfng Upstream Regulatory Sequence. Zebrafish (AB strain) tail fin pieces were mixed with 300 ml of extraction buffer
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
(10 mM Tris-Cl, pH 8.0; 0.1 M EDTA, pH 8.0; 0.5% sodium dodecyl sulfate [SDS], 10 mg/ml of Proteinase K), homogenized, and incubated at 37-C for 12 h. Zebrafish total DNA was extracted by phenol-chloroform, purified by ethanol precipitation, and dissolved in TE (10mM Tris-Cl, pH 8.0; 1mM EDTA). The final concentration was estimated using 0.8% agarose gel electrophoresis. The reported cDNA sequence of zebrafish lfng (GenBank accession no. BC044339) was downloaded from the NCBI server and screened against the zebrafish genomic sequence in the Ensembl database with the known lfng cDNA via the BLAST program (http://www.ensembl.org/Multi/blast view). After obtaining the lfng genomic sequence and its upstream sequence, we used the upstream sequence for putative promoter analysis by using PROSCAN1.7 provided by the server at http:// bimas.dcrt.nih.gov/molbio/proscan/. According to the putative promoter sequence, we designed the upstream primer Pup: 50 -ATGCAAGCTTGTTGCT GAGCTGTCAGCTGG30 (_1052 bp) and the downstream primer Pdn: 50 -ATGCGAATTCCCGACTGC TGCATAGTAGCG30 (+20) for lfng promoter amplification. Based on the sequence we obtained, we designed two upstream primers, Pup1: 50 -ATGCAA GCTTTACAGGCAGCCGTGGGTA-30 (_397 bp), Pup2: 50 -ATGCAAGCTTTACTCTGTTCGTGCTC TTC30 (_181 bp), for amplification of the different subfragments of lfng promoters. The underlined bases indicate the additional restriction sites (HindIII and EcoRI). The polymerase chain reaction (PCR) reaction contained 100 ng of DNA, 0.2 mM dNTP, 0.5U LA Taq (Takara, Dalian, China), and 10 mM of each primer. PCR parameters were as follows: a predenaturation of 94-C for 2 min, 30 cycles of amplification (94-C for 30 s, 60-C for 1 min, and 72-C for 1 min). The PCR products were separated on a 0.8% agarose gel by electrophoresis, and the corresponding band was subjected to gel extraction and purification (Vitagene Co., Hangzhou, China). Construction of GFP Expression Vectors. The extracted fragments were cleaved with HindIII and EcoRI, and ligated into pEGFP1 (Clontech, Basingstoke, UK) with T4 ligase (Fermentas, Lithuania). The ligated products were transformed into competent cells of E. coli Top 10 (Invitrogen, Carlsbad, CA, USA). The positive clones were screened via PCR and the fragments were sequenced. The recombinant plasmids were extracted and digested by HindIII to linearize the DNA. The linearized plasmid was purified using a glassmilk kit (MBI, Vilnius, Lithuania), and resus-
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
359
LFNG
Fig. 1. (A) Sketch map of zebrafish lfng
genomic structure. The full length of the lfng gene is 9.4 kb. It has eight exons. (B) The sketch map of the lfng promoter structure.
pended in ST buffer (5 mM Tris, 0.5 mM EDTA, 0.1 M KCl) at a final concentration of 100 ng/mL for microinjection. Gene Transfer, Fluorescence Detection, and Western Blotting. The recombinant plasmids were introduced into the fertilized eggs of zebrafish by pressure injection. The expression of GFP in transgenic zebrafish was directly observed under fluorescent microscope with a filter of 480 nm
(Olympus SZX-12, Japan). The embryos showing green fluorescence were selected and raised to adult. The matured transgenic founders were crossed with control zebrafish to screen the hemizygous F1 generation. Western blotting was utilized to confirm the expression levels of GFP in three types of transgenic zebrafish embryos (plfngEGFPa, plfngEGFPb, plfngEGFPc). Total proteins were extracted from three batches of transgenic zebrafish embryos
Fig. 2. Alignment of zebrafish lfng upstream
regulatory sequence and the released zebrafish DNA (BX294380) sequence. The 72-bp sequence is different from the released sequence.
360
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
Table 1. Statistical Comparison of Fluorescence Caused by Three Different Length Promoters Experimental group
Injected embryos
Embryos showing green fluorescence
Embryos without green fluorescence
Percentage of fluorescent embryos (%)
plfngEaGFPa plfngEGFPb plfngEGFPc
242 225 240
188 180 190
54 45 50
77.7 80.0 79.2
Fig. 3. (A, B, C) Transgenic zebrafish of P0 generation. (A) 80% epiboly; (B, C) 20- to 25-somite stage. From A, B, and C, we could observe the specific expression of GFP although the P0 generation is chimeras. (D, E) The F1 generation reproduced from a lfngEGFP-transgenic female and control male. They all show green fluorescence from the zygote stage. (D) Zygote stage; (E) four- to eight-cell stage. (F, G, H, I) The F1 generation reproduced from lfngEGFP-transgenic male and control female. We could observe the tissue-specific expression of hemizygous transgenic embryos. (F) 70% epiboly stage; (G) 10somite stage; (H, I) 20- to 25-somite stage. At the 70% epiboly stage (F), GFP was evenly spotted in the whole embryo. With the development of the embryo, the differential was more remarkable, especially in the segmentation period (G, H, I). GFP was distributed to the brain, hindbrain (G), eyes (G, H), PSM (I), somites, neural tube (I), the A-P axis of the neural tube (I), and notochord (I). J, K, and L each show plfngEGFPa-, plfngEGFPb-, and plfngEGFPc-transgenic embryos at the four- to six-somite stage. From the intensity of GFP, we could see that L is much weaker than J and K.
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
(24 hpf) and protein lysate equivalent of five embryos was loaded on each lane. After separation via 15% asodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS-PAGE), the proteins were electrophoretically blotted to a polyvinylidene fluoride (PVDF) membrane (Amresco, Solon, OH, USA). The membrane was blocked with 5% dry milk in PBST buffer (140mM NaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.4mM K2HPO4, 0.05%v/v Tween 20, pH 7.5) overnight at 4-C, and the blocked membrane was incubated with mouse antibody of GFP monoclonal (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a dilution of 1:1000 in PBST buffer containing 5% dry milk at room temperature for 2 h. The membrane was washed three times for 15 min each in PBS buffer and then incubated with goat antimouse IgG (Zhongshan Biotech Co., Beijing, China) at a dilution of 1:2000 in PBS buffer (PBST without Tween 20) at room temperature for 2 h. After washing three times for 15 min each in PBS, detection was performed using 3,30 -diaminobenzidine (DAB) (Zhongshan Biotech, Beijing, China). RNA Isolation and Reverse Transcriptase-PCR (RT-PCR) Analysis. RT-PCR was performed to determine the expression pattern of lfng transcript in five serial developmental stages: zygote, 30% epiboly, 50% epiboly, bud, and 10-somite stage. Total RNA of nontransgenic zebrafish embryos was extracted using the SV Total RNA Isolation System (Promega, Madison, WI, USA). The primers for RT-PCR detection were upstream primer (CCTCACACTCAGGACATGTA) and downstream primer (AGCAGACAGTGCACTGACTT), which are located on the fourth exon and the eighth exon, respectively. Meanwhile, b-actin specific primers, the upstream primer (TCACCACCACAGCCGA AAG) and the downstream primer (GGTCAG CAATGCCAGGGTA), were used in parallel RTPCR reactions, which could facilitate evaluation of the relative amount of lfng mRNA in each sample. The predicated lengths of lfng and b-actin products are each 412 bp and 335 bp. RT-PCR was carried out with the RNA PCR Kit (AMV) Version 2.1 (Takara, Dalian, China) according to the following parameters: 30-C for 10 min, 42-C for 30 min, 94-C for 3 min, and 30 cycles of 94-C, 30 s, 57-C, 40 s, and 72-C, 1 min.
361
known lfng cDNA via the BLAST program (http:// www.ensembl.org/Multi/blastview). Aligning analysis showed that zebrafish Lfng is encoded by a genomic sequence of 9.4 kb, which contains eight exons (Figure 1A). An approximately 3-kb sequence including a partial uncoding region and the upstream sequence of lfng was intercepted and input to the promoter forecast site. The result shows that the upstream site 140 bp away from the coding region has some key sequences for transcription start, such as TATA-box, GC-box, and CAAT-box. We intercepted three fragments of different lengths (1072 bp, 417 bp, 201 bp) from the upstream site about 100 bp away from coding region for the analysis of zebrafish lfng promoter (Figure 1B). The sequence was aligned with the released data (BX294380) in Ensembl (Figure 2). We found that 72 bp was different between our sequence and the released sequence in Ensembl, which might be due to the strain difference or the errors in the public database. Generation of Transgenic Founders and Analysis of Promoter Activity. By identification with HindIII and EcoRI digestion and sequencing, we successfully constructed three GFP expression vectors, plfngEGFPa (5241 bp), plfngEGFPb (4605 bp), and plfngEGFPc (4389 bp), each containing 1.1 kb, 0.4 kb, and 0.2 kb zebrafish lfng promoter sequences. Linearized plfngEGFPa, plfngEGFPb, and plfngEGFPc were each microinjected into 250 zebrafish fertilized eggs. The transgenic embryos at bud stage were observed and the fluorescence percentage of each group was determined. As shown in Table 1, there were no significant differences in the fluorescence percentages and the sites of GFP expression among the three types of transgenic zebra-
Results Structure of Zebrafish lfng Genomic Sequence and Cloning of Zebrafish lfng Promoter. We obtained a genomic site in BX294380 by screening zebrafish genomic sequence in the Ensembl database with the
Fig. 4. Western blotting analysis of GFP using 18-hpf
transgenic zebrafish embryos of plfngEGFPa (A), plfngEGFPb (B), and plfngEGFPc (C). Protein lysate equivalent of five zebrafish embryos was loaded on each lane. M is the protein marker (MBI: 0671).
362
fish embryos, while the fluorescent intensity of lfngEGFPc-transgenic embryos is weaker than that of lfngEGFPa- and lfngEGFPb-transgenic embryos (Figure 3J-L). To confirm the different activity of promoters with different lengths, we performed Western blotting of GFP with each of five transgenic embryos. The results show no significant difference in GFP levels of lfngEGFPa- and lfngEGFPb-transgenics, while the GFP level of lfngEGFPc-transgenics is much lower than that of the former two (Figure 4), which is consistent with the fluorescence observation. Faithful Expression of GFP in Transgenic F1 Generation and Maternal Expression of lfng. Among 63 matured transgenic founders from lfngEGFPc-transgenic zebrafish, four of them, two males, and two females, generated F1 embryos with GFP expression. The F1 embryos generated from the two females and the control males show strong green fluorescence from the one-cell stage, which is certainly due to the fact that GFP is maternally expressed in matured oocytes under the control of the zebrafish lfng promoter (Figure 3D, E). Of the embryos generated from the two transgenic males and the control females, about 40% show green fluorescence from the 50% epiboly stage. As shown in Figure 3F, GFP is evenly spotted on the whole blastoderm at the gastrula stage. With the development of embryos, green fluorescence clears from the marginal region and localizes to the cells of the animal pole. The expression of GFP is more restricted in the segmentation period, at which stage GFP is distributed over the A-P axis of the neural tube, notochord, eye, brain, lateral plate mesoderm, and somites (Figure 3G-I). RT-PCR analysis shows that lfng is ubiquitously expressed in the five stages from the zygote, while the level of mRNA is relatively lower in zygote, higher in 30% epiboly, 50% epiboly, and reaches the highest in bud stage (Figure 5). The maternal
Fig. 5. Results of RT-PCR for zebrafish lfng mRNA. M is
the 250-bp marker; A, egg; B, 30% epiboly; C, 50%-epiboly; D, bud stage; E, 10-somite stage. lfng is ubiquitously expressed in the five stages, while the level of mRNA is relatively lower in zygote, higher in the 30% epiboly, 50% epiboly, and reaches the highest level in the bud stage.
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
expression of lfng is consistent with our former observation of maternal GFP expression driven by the lfng promoter.
Discussion In the present study, we applied the online BLAST program to screen the zebrafish genomic sequence in the Ensembl database with the known lfng cDNA, and as a result, we successfully obtained the lfng genomic site and its upstream regulatory sequence. Using bioinformatic predication provided by the NIH server, we rapidly isolated the lfng promoter region by PCR amplification. Since the entire genome sequences of several model animals are approaching completion (Couronne et al., 2003), it will be of great interest to researchers to identify and characterize the individual genes including their regulatory sequences by using the existing database and online programs, just as reported in our present study. To analyze the promoter activity of lfng in zebrafish, we consequently generated three expression constructs-plfngEGFPa, plfngEGFPb, and plfngEGFPc-each of which contains the presumptive promoter sequences of zebrafish lfng of different lengths. After microinjection of these constructs into zebrafish fertilized eggs, we found that the GFP expression under the control of lfng promoters of various lengths faithfully reflects the expression pattern of endogenous transcript of lfng. Although there are no significant differences in the fluorescence percentage and expression sites of lfngEGFPa-, lfngEGFPb- and lfngEGFPc- transgenic embryos, the GFP expression level of lfngEGFPc-transgenic embryos is much lower than that of lfngEGFPa- and lfngEGFPb-transgenic embryos. Western blotting of GFP levels from the three batches of transgenic embryos verified this point. Both results strongly suggest that the 0.2-kb fragment containing the TATA-box, GC-box, and CAAT-box is the key regulatory sequence of lfng promoter, and the 200-bp more upstream sequence is related to the enhancer elements of the lfng promoter. The middle-size sequence of 417 bp is shown to be the effective promoter length on the basis of fluorescence observation, but it nearly has no homology with the conserved 110-bp region that is necessary to direct cyclic lfng expression in the posterior PSM in mouse (Cole et al., 2002), suggesting that the cyclic expression of lfng is limited to the higher vertebrates. In transgenic zebrafish embryos, GFP could be observed after the 50% epiboly stage, indicating
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
363
LFNG
that lfng promoter exerts its activity in 50% epiboly or a much earlier stage. Lfng is one of maternal factors that is reported only in Xenopus and newt but not in zebrafish, chicken, and mouse (Wu et al., 1996), whereas in our present study, RT-PCR shows lfng mRNA existing in the fertilized eggs, and the F1 embryos reproduced from the transgenic female founders display GFP expression from the one-cell stage. This is quite different from previous findings that maternal lfng mRNA could not be detected in early embryos of zebrafish (Prince et al., 2001). We propose that it is caused by the relatively low sensitivity of in situ hybridization utilized in Prince et al.’s study. Our observation of maternal expression of zebrafish lfng suggests to us that the development of somite and brain of zebrafish may be affected by maternal factors. However, RT-PCR assay shows that the mRNA level from zygotic expression is much higher than that of the maternal expression, suggesting that the zygotic expression is more important for its normal function. With gastrulation development, Lfng is expressed within a small group of cells that do not involute in the embryo when it migrates toward the animal pole (Stachel et al., 1993; Melby et al., 1996). In the F1 offspring generated from a lfngEGFPtransgenic male and control female, we observed the faithful and dynamic expression of GFP reflecting endogenous lfng expression. The regions of high GFP expression in the head will give rise to future primary neurons of the mid- and hindbrain (Woo and Fraser, 1995). With embryonic development, specific expression could be observed in eye, brain, notochord, and somites, although the expression region of GFP is extensive. GFP expression directed by the lfng promoter shows no cyclic expression during zebrafish somitogenesis, revealing the noncyclic expression of zebrafish Lfng. As mentioned in the previous study, the recruitment of Lfng to the pre-patterning process of the somites might be a derived feature in higher vertebrates, such as chicken and mouse (Leve et al., 2001). In our study, most GFP expression sites in lfngEGFP-transgenic embryos are consistent with the sites previously described by in situ hybridization (Prince et al., 2001) except a few superfine sites such as in the even-numbered prospective rhombomeres, because of the high intensity of GFP. In the early development of generation of transgenic GFP zebrafish, a nonfish promoter such as Xenopus elongation factor 1a promoter was used to drive GFP expression ubiquitously in zebrafish (Amsterdam et al., 1995). Subsequently, some nonspecific fish promoters such as b-actin promoters of zebrafish (Higashijima et al., 1997), carp (Gibbs and
Schmale, 2000), and medaka (Hamada et al., 1998; Kohno et al., 1998), and medaka elongation factor 1a promoter (Kinoshita et al., 2000) were used for generation of GFP transgenic zebrafish. Recently, some tissue-specific fish promoters were reported to generate GFP transgenic zebrafish, such as the promoters of zebrafish GATA-2 (Meng et al., 1997; Meng and Lin, 2000) and sonic hedgehog (Teng et al., 2004), Atlantic salmon MHCII (Syed et al., 2003), sea bream somatolactin (Astola et al., 2004), flounder TNF (Yazawa et al., 2005a,b), and so forth. In this study, we identified the upstream sequence of zebrafish lfng of 1.2 kb as a strong tissue-specific promoter, which can drive GFP expression mimicking endogenous lfng expression, and obtained lfngEGFP-transgenic hemizygous zebrafish, which could be used to study gene function related to Lfng and the somite development in zebrafish crossspecies nuclear transplantation in our future studies.
Acknowledgments We are grateful to Ming Li for taking care of the experimental fish. This work was supported by the State Key Fundamental Research of China (grant no. 2004CB117406 and G2000016109) and the National Natural Science Foundation of China (grant nos. 90208024 and 30123004).
References Amsterdam A, Lin S, Hopkins N (1995) The Aequorea victoria green fluorescent protein can be used as a reporter in live zebrafish embryos. Dev Biol 171, 123– 129 Appel B, Marasco P, McClung LE, Latimer AJ (2003) Lunatic fringe regulates Delta-Notch induction of hypochord in zebrafish. Dev Dyn 228, 281–286 Astola A, Calduch-Giner JA, Ortiz M, Perez-Sanchez J, Valdivia MM (2004) Genomic structure and functional analysis of promoter region of somatolactin gene of sea bream (Sparus aurata). Mar Biotechnol 6, 411–418 Aulehla A, Johnson RL (1999) Dynamic expression of lunatic fringe suggests a link between notch signaling and an autonomous cellar oscillator driving somite segmentation. Dev Biol 207, 49–61 Bruckner K, Perez L, Clausen H, Cohen S (2000) Glycosyltransferase activity of Fringe modulates NotchDelta interactions. Nature 406, 411–415 Chen CW, Chuong CM (2000) Dynamic expression of lunatic fringe during feather morphogenesis: a switch from medial-lateral to anterior-posterior asymmetry. Mech Dev 91, 351–354 Cohen B, Bashirullah A, Dagnino L, Campbell C, Fisher WW, Leon CC, Whiting E, Ryan D, Zinyk D,
364
Boulianne G, Hui CC, Gallie B, Phillips RA, Lipshitz HD, Egan SE (1997) Fringe boundaries coincide with notch-dependent patterning centres in mammals and alter Notch-dependent development in Drosophila. Nat Genet 16, 283–288 Cole LK, Le Roux I, Nunes F, Laufer E, Lewis J, Wu DK (2000) Sensory organ generation in the chicken inner ear: contributions of bone morphogenetic protein 4, Serrate1, and Lunatic fringe. J Comp Neurol 424, 509– 520 Cole SE, Levorse JM, Tilghman SM, Vogt TF (2002) Clock regulatory elements control cyclic expression of Lunatic fringe during somitogenesis. Dev Cell 3, 75–84 Couronne O, Poliakov A, Bray N, Ishkhanov T, Ryaboy D, Rubin E, Pachter L, Dubchak I (2003) Strategies and tools for whole-genome alignments. Genome Res 13, 73–80 Dale JK, Maroto M, Dequeant ML, Malapert P, McGrew M, Pourquie O (2003) Periodic notch inhibition by lunatic fringe underlies the chick segmentation clock. Nature 421, 275–278 Evrard YA, Lun Y, Aulehla A, Gan L, John RL (1998) Lunatic fringe is an essential mediator of somite segmentation and patterning. Nature 394, 377–381 Favier B, Fliniaux I, Thelu J, Viallet JP, Demarchez M, Jahoda CA, Dhouailly D (2000) Localization of members of the notch system and the differentiation of vibrissa hair follicles: receptors, ligands, and fringe modulators. Dev Dyn 218, 426–437 Fleming RJ, Gu Y, Hukriede NA (1997) Serrate-mediated activation of Notch is specifically blocked by the product of the gene fringe in the dorsal compartment of the Drosophila wing imaginal disc. Development 124, 2973–2981 Forsberg H, Crozet F, Brown NA (1998) Waves of mouse Lunatic fringe expression, in four-hour cycles at twohour internals, precede somite boundary formation. Curr Biol 8, 1027–1030 Gibbs PD, Schmale MC (2000) GFP as a genetic marker scorable throughout the life cycle of transgenic zebrafish. Mar Biotechnol 2, 107–125 Giudicelli F, Lewis J (2004) The vertebrate segmentation clock. Curr Opin Genet Dev 14, 407–414 Hamada K, Tamaki K, Sasado T, Watai Y, Kani S, Wakamatsu Y, Ozato K, Kinoshita M, Kohno R, Takagi S, Kimura M (1998) Usefulness of the medaka beta-actin promoter investigated using a mutant GFP reporter gene in transgenic medaka (Oryzias latipes). Mol Mar Biol Biotechnol 7, 173–180 Higashijima S, Okamoto H, Ueno N, Hotta Y, Eguchi G (1997) High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev Biol 192, 289–299 Holly SA, Geisler R, Nusslein-Volhard C (2000) Control of her1 expression during zebrafish somatogenesis by a delta-dependent oscillator and an independent wavefront activity. Genes Dev 14, 1678–1690 Irvine KD, Wieschaus E (1994) Fringe, a boundary-specific signaling molecule, mediates interactions between
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
dorsal and ventral cells during Drosophila wing development. Cell 79, 595–606 Ishii Y, Nakamura S, Osumi N (2000) Demarcation of early mammalian cortical development by differential expression of fringe genes. Brain Res Dev Brain Res 119, 307–320 Ishikawa A, Kitajima S, Takahashi Y, Kokubo H, Kanno J, Inoue T, Saga Y (2004) Mouse Nkd1, a Wnt antagonist, exhibits oscillatory gene expression in the PSM under the control of Notch signaling. Mech Dev 121, 1443– 1453 Johnson SH, Rauskolb C, Wilson R, Prabhakaran B, Irvine KD, Vogt TF (1997) A family of mammalian Fringe genes implicated in boundary determination and the Notch pathway. Development 124, 2245–2254 Kinoshita M, Kani S, Ozato K, Wakamatsu Y (2000) Activity of the medaka translation elongation factor 1alpha-A promoter examined using the GFP gene as a reporter. Dev Growth Differ 42, 469–478 Laufer E, Dahn R, Orozco OE, Yeo CY, Pisenti J, Henrique D, Abbott UK, Fallon JF, Tabin C (1997) Expression of Radical fringe in limb-bud ectoderm regulates apical ectodermal ridge formation. Nature 386, 366–373 Leve C, Gajewski M, Rohr KB, Tautz D (2001) Homologues of c-hairy1 (her9) and lunatic fringe in zebrafish are expressed in the developing central nervous system, but not in the presomitic mesoderm. Dev Genes Evol 211, 493–500 McGrew MJ, Dale JK, Fraboulet S, Pourquie O (1998) The lunatic fringe gene is a target of the molecular clock linked to somite segmentation in avian embryos. Curr Biol 8, 979–982 Melby AE, Warga RM, Kimmel CB (1996) Specification of cell fates at the dorsal margin of the zebrafish gastrula. Development 122, 2225–2237 Meng A, Lin S (2000) Generation of germ-line transgenic zebrafish expressing GFP in a tissue-specific manner by using GATA-2 regulatory sequences. Chin Sci Bull 45, 31–34 Meng A, Tang H, Ong BA, Farrell MJ, Lin S (1997) Promoter analysis in living zebrafish embryos identifies a cis-acting motif required for neuronal expression of GATA-2. Proc Natl Acad Sci USA 94, 6267–6272 Moloney DJ, Panin VM, Johnston SH, Chen J, Shao L, Wilson R, Wang Y, Stanley P, Irvine KD, Haltiwanger RS, Vogt TF (2000) Fringe is a glycosyltransferase that modifies Notch. Nature 406, 369–375 Pouyet L, Mitsiadis TA (2000) Dynamic Lunatic fringe expression is correlated with boundaries formation in developing mouse teeth. Mech Dev 91, 399–402 Prince VE, Holley SA, Bally-Cuif L, Prabhakaran B, Oates AC, Ho RK, Vogt TF (2001) Zebrafish lunatic fringe demarcates segmental boundaries. Mech Dev 105, 175– 180 Qiu X, Xu H, Haddon C, Lewis J, Jiang YJ (2004) Sequence and embryonic expression of three zebrafish fringe genes: lunatic fringe, radical fringe, and manic fringe. Dev Dyn 231, 621–630 Sakamoto K, Yan L, Imai H, Takagi M, Nabeshima Y, Takeda S, Katsube K (1997) Identification of a chick
JING LIU
ET AL.:
PROMOTER ANALYSIS
OF
ZEBRAFISH
LFNG
homologue of Fringe and C-Fringe 1: involvement in the neurogenesis and the somitogenesis. Biochem Biophys Res Commun 234, 754–759 Serth K, Schuster-Gossler K, Cordes R, Gossler A (2003) Transcriptional oscillation of lunatic fringe is essential for somitogenesis. Genes Dev 17, 912–925 Stachel SE, Grunwald DJ, Myers PZ (1993) Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117, 1261–1274 Sun YH, Chen SP, Wang YP, Hu W, Zhu ZY (2005) Cytoplasmic impact on cross-genus cloned fish derived from transgenic common carp (Cyprinus carpio) nuclei and goldfish (Carassius auratus) enucleated eggs. Biol Reprod 72, 510–515 Syed M, Vestrheim O, Mikkelsen B, Lundin M (2003) Isolation of the promoters of Atlantic salmon MHCII genes. Mar Biotechnol 5, 253–260 Teng P, Cao Y, Wang WX, Zhu SX, Meng AM, Zhang JP (2004) The shh promoter of zebrafish directs the expression of GFP in notochord. Yi Chuan Xue Bao 31, 39–42 Thelu J, Rossio P, Favier B (2002) Notch signalling is linked to epidermal cell differentiation level in basal cell carcinoma, psoriasis and wound healing. BMC Dermatol 2, 7 van Eeden FJ, Granato M, Schach U, Brand M, FurutaniSeiki M, Haffter P, Hammerschmidt M, Heisenberg CP,
365
Jiang YJ, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, Allende ML, Weinberg ES, NussleinVolhard C (1996) Mutations affecting somite formation and patterning in zebrafish, Danio rerio. Development 123, 153–164 Woo K, Fraser SE (1995) Order and coherence in the fate map of the zebrafish nervous system. Development 121, 2595–2609 Wu JY, Wen L, Zhang WJ, Rao Y (1996) The secreted product of Xenopus gene lunatic Fringe, a vertebrate signaling molecule. Science 273, 355–358 Yazawa R, Hirono I, Aoki T (2005a) Characterization of promoter activities of four different Japanese flounder promoters in transgenic zebrafish. Mar Biotechnol 21 7, 625–633 Yazawa R, Hirono I, Ohria T, Aoki T (2005b) Induction of Japanese flounder tnf promoter activity by lipopolysaccharide in zebrafish embryo. Mar Biotechnol 7, 231–235 Zeltser LM, Larsen CW, Lumsden A (2001) A new developmental compartment in the forebrain regulated by Lunatic fringe. Nat Neurosci 4, 683–684 Zhang N, Gridley T (1998) Defects in somite formation in lunatic fringe-deficient mice. Nature 394, 374–377 Zhang N, Martin GV, Kelley MW, Gridley T (2000) A mutation in the Lunatic fringe gene suppresses the effects of a Jagged2 mutation on inner hair cell development in the cochlea. Curr Biol 10, 659–662
