Ursolic Acid Induces Apoptosis Through Mitochondrial ... - J-Stage

J Pharmacol Sci 125, 202 – 210 (2014)

Journal of Pharmacological Sciences © The Japanese Pharmacological Society

Full Paper

Ursolic Acid Induces Apoptosis Through Mitochondrial Intrinsic Pathway and Suppression of ERK1/2 MAPK in HeLa Cells Yanhong Li1,2,3, Xueying Lu1, Hongxue Qi1, Xiaobo Li1,*a, Xiangwen Xiao1, and Jianfeng Gao2,*b 1

Key Laboratory of Chemistry of Plant Resources in Arid Regions, Xinjiang Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, Urumqi 830011, China 2 College of Animal Science and Technology, Shihezi University, Shihezi 832003, China 3 Department of Physical Education, Xinjian Education Institute, Urumqi 830043, China Received January 22, 2014; Accepted April 17, 2014

Abstract. Ursolic acid (UA), a natural pentacyclic triterpenoid compound, has been demonstrated to induce apoptosis in various tumors. The aim of the present study was to elucidate the molecular mechanisms of UA-induced apoptosis in HeLa cells. Here, we reported that UA induced apoptosis through the mitochondrial intrinsic pathway in HeLa cells, as shown by release of cytosol cytochrome c, activation of caspase-9 and -3, reduction of Bcl-2 and Bcl-xL, and increase of Bax and Bak. UA down-regulated the phosphorylation of ERK1/2 and p38, whereas phosphorylation of JNK was unchanged. The roles of ERK1/2 and p38 were further confirmed using the ERK1/2 inhibitor (U0126) and p38 inhibitor (SB203580). U0126 markedly increased UA-induced the Bax/Bcl-2 ratio, the increase of cytosol cytochrome c, and the levels of cleaved caspase-3, but SB203580 had little effects on the above characters, suggesting the ERK1/2 signaling pathway is required for apoptosis. Furthermore, UA up-regulated DUSP 1, 2, 4, 5, 6, 7, 9, and 10 mRNA expressions, which may be a clue for the role of dephosphorylation of ERK1/2 and p38. These data suggested that the apoptotic mechanism of UA treatment in HeLa cells was through the mitochondrial intrinsic pathway and closely associated with the suppression of the ERK1/2 signaling pathway. Keywords: ursolic acid, apoptosis, HeLa cell, mitogen-activated protein kinase (MAPK), dual-specific phosphatase (DUSP) Introduction

progress in the past years, recurrence, toxic side effects, and multidrug resistance of cervix-carcinoma are still frequent and important causes leading to the final death in cervical cancer patients. Therefore, the development of new anticancer agents to eradicate cervical cancer cells remains highly attractive and is crucial for a better treatment and a more prolonged survival. Ursolic acid, a natural pentacyclic triterpenoid compound derived from the berries, leaves, flowers, and fruits of medicinal herbs, such as Rosemarinus officinalis, Oldenlandia diffusa, and Radix actinidiae, possesses antiviral (2), antibacterial (3), anti-inflammatory (4), anticancer (5), and hepatoprotective activities (6). Its antitumor effects have been investigated in vivo and in vitro by inducing tumor differentiation, inhibiting the proliferation of cancer cells, inducing apoptosis, as well as promoting the autophagy of cancer cells. Park et al. reported that UA could inhibit the proliferation of

Cervical cancer ranks as the second most common gynecological cancer worldwide. There is an estimated incidence of 450,000 newly diagnosed cases and a mortality rate of 50% from invasive cervical cancer (ICC) per annum. Compared with developed countries, the prevalence of morbidity and mortality of cervical cancer in developing countries are higher, which have been ascribed to poor hygiene conditions, unavailable mass-screening programs, earlier age of sexual debut, and so on (1). Although therapeutic techniques for the treatment of cervical cancer have made considerable Corresponding authors. [email protected]*a, [email protected]*b Published online in J-STAGE on May 30, 2014 doi: 10.1254/jphs.14017FP

202

UA-Induced Apoptosis in HeLa Cells

cervical cancer lines, including HeLa, CaSki, and SiHa, and in addition, induce apoptosis in HeLa cells. The expression of Fas protein, cleaved proteins of caspase-8, caspase-3, and poly ADP-ribose polymerase (PARP) were observed after treatment of HeLa cells with UA (7). However, the underlying molecular mechanisms of UA’s anti-cervical carcinoma activity have been largely unknown. Mitogen-activated protein kinases (MAPKs) play vital roles in cellular processes, including cell proliferation, differentiation, migration, and apoptosis. MAPK pathways are activated through sequential phosphorylation of several substrates on threonine/tyrosine residues by the integration and processing of intracellular and extracellular cues. There are three best-characterized MAPK pathways: the extracellular signal-regulated kinase (ERK1/2) pathway, which responds mainly to growth- and differentiation-factors, and the p38 and JNK pathways, which respond mainly to stress conditions (8, 9). Increasing evidence has shown that abnormalities in MAPK signaling have been implicated in several pathological situations, including cancer. Remarkably, dysregulation of the RAS/RAF/MEK/ERK pathway has been detected in > 30% of human tumors. For example, constitutive activation of the ERK pathway results in basic fibroblast growth factor-induced angiogenesis (10 – 12). Therefore, in the recent decades, some small molecule agents have been developed to regulate MAPK signaling pathways, mostly with ERK1/2, p38 and MEK as targets, in order to inhibit the proliferation and promote the apoptosis of tumor cells. It has been not clear whether MAPK signaling pathways are involved in the apoptotic process induced by UA on cervical carcinoma. On the other hand, MAPK pathways are inactivated through dual-specific phosphatases (DUSPs). DUSPs’ family currently contains 25 members and their primary mode of action of DUSPs is the dephosphorylation of tyrosine and/or serine/threonine residues on activated MAPKs (13). Regulation of expression and activity of DUSP family members in different cells and tissues controls the intensity and duration of MAPKs, thereby determining the type of physiological response (14). It has been reported that the growing list of cancers are associated with dysregulated expression of DUSPs (15, 16). Of them, as a major negative regulator of ERK1/2 activation, the study of DUSP6/MKP3 focuses on the mRNA level. The DUSP6/MKP3 gene was downregulated in invasive pancreatic carcinoma and highgrade lung carcinomas; moreover, its expression is also associated with overall survival in non–small cell lung cancer (NSCL). On the basis of these findings, DUSP6/ MKP3 has been proposed as a candidate tumor suppres-

203

sor gene in pancreatic and lung cancer (17, 18). To date, little information is available about whether UA has the potential to regulate the expression of DUSPs genes in cervical carcinoma. Therefore, in the present study, we investigated the effects of UA on cervical cancer cell proliferation and analyzed the UA-induced apoptosis pathway. Furthermore, we examined the roles of the MAPK signaling pathways and DUSPs gene expression regulated by UA in HeLa cells. This study provides important insight into the molecular mechanisms of UA against cervical cancer cells and will be helpful for developing future therapies for the treatment of cervical cancer. Materials and Methods Reagents and antibodies UA (purity > 99%), 3-(4,5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), penicillin, and streptomycin were purchased from Gibco (Gaithersburg, MD, USA). The Annexin V–Fluorescein Isothiocyanate (FITC) Apoptosis kit was purchased from BD Biosciences (San Jose, CA, USA). Primary antibodies against caspase-3, caspase-9, cytochrome c, p38, p-p38, ERK1/2, p-ERK1/2, JNK, p-JNK, Bcl-2, Bax, Bak, Bcl-xL, and b-actin were purchased from Cell Signaling Technology (Danvers, MA, USA). The secondary antibodies horseradish peroxidase (HRP)conjugated anti-rabbit IgG and anti-mouse IgG were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The ERK1/2 inhibitor U0126 and the p38 inhibitor SB203580 were purchased from Cell Signaling Technology. All other chemicals were produced in China and were of analytical grade. Cell culture and UA treatment HeLa cells were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). Cells were grown in DMEM at 37°C and 5% CO2 supplemented with 10% FBS, 100 U/mL of penicillin, and 100 mg/mL of streptomycin. Cells in the exponential phase of growth were collected for proliferation, apoptosis, western blotting, and real-time polymerase chain reaction (PCR) assays. For UA treatment, UA was dissolved in DMSO to make a stock solution of 100 mM and diluted further to final concentrations with serumfree culture medium. Cell proliferation assay The MTT assay was carried out to evaluate the effect

204

Y Li et al

of UA on HeLa cells. Briefly, HeLa cells were plated in 96-well culture plates (1 × 104 cells/well) for 12 h. Cells were incubated with UA (0, 5, 10, 20, and 40 mM) for 48 h. A 20-mL aliquot of MTT test solution (5 mg/mL) was added to each well. After 4 h of incubation, the culture medium was removed and 100 mL of DMSO added to each well. After 10 min of incubation and vortex mixing, the absorbance at 570 nm was read. All experiments were carried out at least three times. Inhibition (%) was calculated using the following formula: Inhibition (%) = (1 - absorbance of experimental well/ absorbance of control well) × 100%. Apoptosis The Annexin V–FITC Apoptosis kit was used according to manufacturer’s instructions. HeLa cells (5 × 105) were plated in 60-mm dishes and treated with UA (0, 20, 40, and 60 mM) for 48 h. After treatment, cells were collected by trypsinization and washed twice in cold phosphatebuffered saline (PBS). Cells (1.0 × 106/mL) were added to 1 × combination buffer (100 mL). Five microliters of Annexin V and 10 mL propidium iodide were then added. The mixture was vortex-mixed gently and incubated in the dark for 15 min at room temperature. Loading buffer (300 mL) was then added. Flow cytometry was then employed using a FACS Calibur system (BD Biosciences, San Jose, CA, USA). All experiments were conducted at least 3 times. Western blotting Cells (1.0 × 106) were seeded in 10-cm dishes. When the cells had grown to the log phase, they were treated. To obtain total cell extracts, treated cells were washed with ice-cold PBS and resuspended in lysis buffer comprising 20 mM Tris-HCL (PH 7.4), 150 mM NaCl, 1% Triton and 1 mM PMSF at 4°C for 30 min. The lysed cells were centrifuged at 13,000 × g for 5 min at 4°C, and the supernatant solutions were collected as whole cytoplasmic protein for analyzing caspase-3, caspase-9, Bcl-2, Bcl-xL, Bak, Bax, ERK1/2, p-ERK1/2, p38, p-p38, JNK, and p-JNK. For determining the cytochrome c release, the cytoplasm fraction and mitochondria fraction were separated. The cells were collected and washed with PBS and then resuspended in an ice-cold homogenizing buffer (250 mM sucrose, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride, 1 mg/mL aprotinin, and 1 mg/mL leupeptin). Cells were homogenized with a glass homogenizer. The homogenate was centrifuged at 1000 × g for 10 min, and the supernatant was subjected to 10,000 × g centrifugation for another 10 min. The pellet was the mitochondrial fraction. The supernatant was re-centrifuged at 100,000 × g for 1 h at 4°C. The resulting supernatant

was used as the cytosolic fraction. The total protein concentration was determined using a Bicinchoninic Acid Protein kit (Thermo Fisher, Shanghai, China). Proteins were separated by 10% sodium dodecyl sulfate–polyarylamide gel electrophoresis and electrotransferred onto a polyvinylidene difluoride (PVDF) membrane (0.22 mm; Millipore, Bedford, MA, USA) using a semi-dry transfer apparatus (Bio-Rad, Hercules, CA, USA). Blocking was carried out for 2 h in 5% non-fat dried milk in Tris-buffered saline and Tween 20 (TBST) buffer at room temperature. Then, the PVDF membrane was washed thrice with washing buffer for 10 min each. Primary antibodies were added to the PVDF membrane for 2 h at room temperature or 4°C overnight. Then, after 3 washes in TBST buffer, secondary antibodies were added and the mixture incubated at room temperature for 2 h. Blots were subjected to a further 3 washes with TBST buffer. Detection was undertaken using an enhanced chemiluminescence western blotting substrate (Pierce, Rockford, IL, USA). Real-time PCR HeLa cells were exposed to 0, 20, 40, or 60 mM UA for 48 h. Then, total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The concentration and purity of RNA was determined based on measurement of absorbance at 260 and 280 nm. RNase-free DNase I was used to remove DNA. M-MLV reverse transcriptase (Invitrogen) was used (according to manufacturer instructions) to treat 2 mg of total RNA for synthesizing first-strand cDNA. cDNA was then subjected to real-time quantitative PCR for evaluation of mRNA levels. Gene-specific amplification was done using a real-time PCR system (ABI StepOne; Applied Biosystems, Foster City, CA, USA) with a 20-mL PCR reaction mixture containing 1 mL cDNA (synthesized as described above), 2 × fast SYBR Green Master Mix (10 mL, ABI StepOne), forward primer (1 mL), and reverse primer (1 mL) (Table 1). The amplification conditions were 95°C for 20 s, followed by 40 cycles at 95°C for 3 s and 60°C for 30 s. Regression curves were calculated for each sample, and the relative amount of mRNA calculated from the threshold cycles using the software provided with the instrument. Relative expression of the target genes was normalized to the geometric mean of the internal control gene (glyceraldehyde 3-phosphate dehydrogenase). Data were analyzed using the two standard-curve methods. Statistical analyses Data are expressed as the mean ± S.D. Statistical analyses were done using SPSS ver15.0. The data were analyzed with one-way analysis of variance, followed


205

Table 1. Primer sequences for the DUSPs target genes Gene

Forward primer (5′-3′)

Reverse primer (5′-3′)

DUSP1 DUSP2 DUSP4 DUSP5 DUSP6 DUSP7 DUSP9 DSP10 DUSP14 DUSP16 GAPDH

TTTGAGGGTCACTACCAG AGTCACTCGTCAGACC CAAA-GGCGGCTATGAG CTGAGTGTTGCGTGGA CGAGACCCCAATAGTGC TCATTGACGAAGCCCG ATCCGCTACATCCTCAA CTGAACATCGGCTACG CTGCTCACTTAGGACTTTCT AGAATGGGATTGGTTATGTG AAGGTCGGAGTCAACGGATT

GAGATGATGCTTCGCC TGTTCTTCACCCAGTCAAT GGTTATCTTCCACTGGG AGTCTATTGCTTCTTGAAAGT AATGGCCTCAGGGAAA GCGTATTGAGTGGGAACA AGGTCATAGGCATCGTT GGTGTAAGGATTCTCGGT CCTTGGTAGCGTGCTG TGTAGGCGATAGCGATG CTCCTGGAAGATGGTGATGG

Fig. 1. Inhibition of the growth of HeLa cells by UA. Cells were treated in vitro with 0, 5, 10, 20, and 40 mM UA for 48 h, and cell inhibition determined by the MTT assay. Data are the mean ± S.D. from 3 independent experiments. The data were analyzed by Dunnett’s test, **P < 0.01, compared with 5 mM UA group.

Fig. 2. UA induced high levels of apoptosis in HeLa cells. Cells were treated with 0, 20, 40, and 60 mM UA for 48 h. Induction of apoptosis was determined by Annexin V–FITC/PI double-staining assay. The degree of apoptosis was quantified. Data are the mean ± S.D. of at least 3 independent experiments. The data were analyzed by Dunnett’s test, **P < 0.01, compared with the control group.

by Dunnett’s test and Tukey’s test. A P-value of less than 0.05 was considered significant.

of HeLa cells by an Annexin V staining–based FACS assay. The number of cells undergoing early apoptosis after treatment with UA (40 and 60 mM) for 48 h was much higher than that of control cells (74.30% ± 5.26% and 83.87% ± 2.27% vs. 2.20% ± 1.15%, respectively). The percentage of total apoptotic cells increased to 85.76% ± 4.85% and 92.10% ± 8.64% after treatment with 40 mM and 60 mM UA, respectively, which was significantly higher than that in control cells (3.10 ± 1.06%) (P < 0.01). The total apoptotic rate of HeLa cells after UA treatment increased in a dose-dependent manner (Fig. 2).

Results Effects of UA on the proliferation of HeLa cells First, we determined the effect of UA on the proliferation of HeLa cells. Cells were treated with 0, 5, 10, 20 and 40 mM of UA for 48 h. The viability of HeLa cells was assessed by the MTT assay. UA inhibited cell proliferation in a dose-dependent manner, with a halfmaximal inhibitory concentration (IC50) of 9.54 ± 0.98 mM at 48 h (Fig. 1). Observed under a microscope, the anti-proliferative effect of 40 mM UA treatment at 48 h was characterized mainly by a large proportion of round floating cells. The number of survival cells decreased significantly when compared with the control. Effects of UA on the apoptosis of HeLa cells Next, we examined the effect of UA on the apoptosis

UA induces activation of caspases and release of mitochondria cytochrome c Caspases are believed to play a central role in mediating various apoptotic responses. Hence, we monitored the enzymatic activities of caspases-3, -8, and -9 during UA induced apoptosis in HeLa cells. UA treatment caused the activation of caspase-9 and caspase-3, which

206

Y Li et al

Fig. 3. UA induced the expression of caspase family proteins, Bcl-2 family proteins, and release of mitochondria cytochrome c. HeLa cells were treated with 40 mM UA for 24, 36, or 48 h and protein expression detected by Western blotting. A) UA activated caspase-9 and caspase-3 and caused a gradual increase of the level of cytochrome c in the cytosol. B) UA downregulated the expression of Bcl-2 and Bcl-xL, and upregulated the expression of Bax and Bak to induce apoptosis.

were observed as the cleaved form in a time-dependent manner. The release of cytochrome c from the mitochondria is a crucial event in the process of cell death, which subsequently activates caspases and ultimately results in apoptosis. In our study, UA treatment caused a gradual increase in the level of cytosol cytochrome c in a timedependent manner (Fig. 3A) due to its release from mitochondria. These results suggested that UA-induced apoptosis in HeLa cells occurred through the mitochondrial pathway. Effects of UA on the expression of Bcl-2 family proteins Mitochondrial involvement in apoptosis is regulated by Bcl-2 family proteins, whose family is divided into anti-apoptotic and pro-apoptotic proteins. We examined the expression of four members of the Bcl-2 family: two anti-apoptotic proteins (Bcl-2 and Bcl-xL) and two pro-apoptotic proteins (Bak and Bax). UA treatment in HeLa cells resulted in increasing the levels of Bax and Bak, as well as decreasing levels of Bcl-2 and Bcl-xL, in a time-dependent manner (Fig. 3B). These data further suggested that UA induced apoptosis via the mitochondrial intrinsic pathway in HeLa cells.

Fig. 4. Effects of UA on MAPK signaling pathways in HeLa cells. A) HeLa cells were exposed to 0, 20, 40, and 60 mM UA for 48 h. After treatment, total cellular extracts were prepared and subjected to western blotting using antibodies against phospho-ERK1/2, phosphop38, and phospho-JNK. Blots were subsequently re-probed with antibody directed against ERK1/2, P38, and JNK to control for equal loading. B) Values are the mean ± S.D. for 3 separate experiments. The data were analyzed by Dunnett’s test, *P < 0.05 and **P < 0.01, compared with the control group.

MAPK pathways are involved in UA-induced apoptosis in HeLa cells Recently studies have demonstrated that UA regulates activation of a different MAPK signaling pathway components in various cancers. Therefore, we investigated whether MAPK signaling pathways were involved in the UA effecting on cervical cancer cells. HeLa cells were treated with various concentrations of UA for 48 h, and the total protein levels of ERK1/2, JNK, and p38, as well as their phosphorylation levels were determined by western blotting. The results showed that total protein levels of p38, ERK1/2, and JNK were not altered after exposure to various UA concentrations for 48 h, but levels of p-p38 and p-ERK1/2 were reduced markedly in a dose-dependent manner; the level of p-JNK showed no


207

A

B Fig. 6. Expression of DUSP genes in UA-treated HeLa cells. Cells were treated with 0, 20, 40, and 60 mM UA for 48 h and total RNA isolated. Real-time PCR was undertaken using SYBR Green as the detection dye after reverse transcription with oligo (dT) primers. Ct was measured. Compared with the control, expression of DUSP1, 2, 4, 5, 6, 7, 9, and 10 mRNA in UA-treated HeLa cells was significantly increased. Values are the mean ± S.D. The data were analyzed by Dunnett’s test, *P < 0.05 and **P < 0.01, compared with the control group.

Fig. 5. Effects of U0126 and SB203580 on the mitochondrialmediated apoptotic pathway in UA-treated HeLa cells. A) Cells were pretreated with 10 mM U0126 or 20 mM SB203580 for 1 h, and then cells were exposed to 40 mM UA for 48 h. Western blotting revealed the protein expression of Bcl-2, Bax, cytosol cytochrome c, and caspase-3. B) The ratio of relative protein level of Bax/Bcl-2 was calculated. Values are the mean ± S.D. The data were analyzed by Tukey’s test, *P < 0.05 and **P < 0.01, compared with the control group, #P < 0.05, compared with the UA group.

significant change (P > 0.05). These results suggested that UA treatment suppressed the ERK1/2 and p38 pathway, but not JNK in HeLa cells (Fig. 4). Effects of MAPK inhibitors on UA-induced apoptosis in HeLa cells Accumulating evidence indicates that the MAPK signaling pathway participates in the mitochondrialmediated apoptotic pathway. We further determined the roles of ERK1/2 and p38 pathways on the UA-induced apoptosis in HeLa cells. HeLa cells were pretreated with the ERK1/2 inhibitor U0126 or p38 inhibitor SB203580 for 1 h before UA treatment for 48 h. The Bax/Bcl-2 ratio has been reported to determine whether or not a cell will undergo apoptosis, so the expression levels of

Bcl-2 and Bax were determined and the ratio of Bax/ Bcl-2 was evaluated. Levels of cytosol cytochrome c, procaspase-3, and its cleaved activity were also monitored. The results showed that UA and U0126 alone downregulated expression of Bcl-2 and upregulated expression of Bax, level of cytosol cytochrome c, and cleaved caspase-3. Compared with control cells, the ratio of Bax/Bcl-2 increased significantly (P < 0.01). Together with U0126 treatment, the effects of UA on the above characteristics had been enhanced significantly (P < 0.05) compared with the UA group; of note, the ratio of Bax/ Bcl-2 dramatically increased (> 2.0-fold). SB203580 moderately decreased the expression of Bcl-2, increased levels of Bax and cytosol cytochrome c, and the ratio of Bax/Bcl-2 increased significantly (P < 0.05) compared with control cells, but cleaved caspase-3 had not been observed remarkably. Whereas for SB203580 combined with UA, the ratio of Bax/Bcl-2 decreased but the difference did not reach statistical significance (P > 0.05) compared with UA alone (Fig. 5). These data indicated that UA-induced apoptosis in HeLa cells was associated with the suppression of the ERK1/2 pathway. Effects of UA on expression of DUSP genes in HeLa cells In view of the knowledge that activation of the MAPK pathway is closely related to the DUSP genes expression, ten typical DUSPs members, including DUSP 1, 2, 4, 5, 6, 7, 9, 10, 14, and 16 were employed to examine the

208

Y Li et al

mRNA expression levels under treatment with various UA concentrations in HeLa cells. The results of quantitative real-time PCR are shown in Fig. 6. The mRNA levels of DUSP 1, 2, 4, 5, 6, 7, 9, and 10 were up-regulated compared with the control in UA-treated HeLa cells; moreover, DUSP 1, 2, 4, 5, 6, and 7 were significantly increased, whereas mRNA levels of DUSP 9 and 10 decreased in a dose-dependent manner. In addition, mRNA levels of DUSP 14 and 16 had not changed in the course of treatment. Of interest, DUSP 6 as a major negative regulator of ERK1/2 activation, its relative expression reached culmination at higher UA concentration. The results indicated that UA had potential to regulate the expression of specific DUSPs genes resulting in attenuation of the MAPK signaling pathways. Discussion Every year, various natural compounds have been exploited for usage as therapeutic agents for the treatment of cancer. An important property of a candidate anticancer drug is its ability to inhibit cancer cell growth and kill cancer cells. In this study, our results showed that UA inhibited proliferation and induced apoptosis in HeLa cells in a dose-dependent manner, which were consistent with reports as to the anti-proliferative and pro-apoptotic effects of UA on other cancer cells. Apoptosis pathways are strategic targets for effective cancer therapies. There are mainly two apoptotic pathways: the intrinsic pathway and the extrinsic pathway. The extrinsic pathway involves cell death receptors and their ligands on the cell surface, such as FasL and TNF-Rs. It can be initiated by intracellular signals and lead to activation of initiator caspase-8 and -10, which sequentially trigger the “executioner” caspases-3, -6, and -7. The intrinsic pathway, known as the mitochondrial pathway, is characterized by the efflux of cytochrome c from mitochondria to the cytosol, where it subsequently activates the initiator caspase-9 and thus causes the activation of caspase-3, -6, and -7 in turn (19). Moreover, it is well known that the mitochondrial pathway is both triggered and inhibited by Bcl-2 superfamily members, which include anti-apoptotic (e.g., Bcl-2, Bcl-xL) and pro-apoptotic (e.g., Bax, Bak, Bid) proteins acting mainly at the level of the external mitochondrial membrane (20). The anti-apoptotic proteins prevent cytochrome c release from mitochondria, while the pro-apoptotic proteins can be activated under the apoptotic stimulus and inducing mitochondrial outer membrane form channels, through which cytochrome c is released from mitochondria, causing activation of caspase-9 and caspase-3, ultimately resulting in apoptosis. In the past decades, researchers have intensively studied the pathway of apoptosis induced by

UA treatment in a wide variety of cell lines (21, 22), but it is not clear which pathway is involved into the apoptotic process induced by UA in HeLa cells. In the present study, we found that mitochondria cytochrome c was released, caspase-3 and -9 were activated, anti-apoptotic proteins Bcl-2 and Bcl-xL expressions were downregulated, and pro-apoptotic proteins Bax and Bak expressions were up-regulated in a time-dependent manner. These results strongly demonstrated that UA induced HeLa cell apoptosis through the mitochondrial intrinsic pathway. Numerous investigations have demonstrated that the intracellular signal transduction of apoptosis in tumor cells is closely associated with MAPK pathways in response to several extracellular stimuli, including small compounds (23, 24). Several studies had reported that UA acted on different MAPK pathways in different types of cancer cells (25 – 28). Subsequently, this study focused on the roles of MAPK pathways in apoptosis induced by UA in HeLa cells. We found that phosphorylation of ERK1/2 and p38 decreased significantly after UA treatment. These results demonstrated that UA treatment in HeLa cells suppressed ERK1/2 and p38 signaling pathways. The two systems, MAPK and Bcl-2 protein families, communicate with each other to regulate the proliferation and the death of cells. Genes encoding Bcl-2, and Bcl-xL are activated by MAPK signaling in some cell types (29 – 31), in addition, the activities of Bcl-2, Bad, and Bim are regulated post-translationally by phosphorylation (32 – 34). It has been reported that ERK1/2 participates in anti-apoptotic signaling via phosphorylation-dependent control of pro-apoptotic Bim protein. The phosphorylation of Bim by MAPK involves its disassociation from Bcl-2 and Bcl-xL; Bim subsequently is degraded via proteasomes, and this allows Bcl-2 and Bcl-xL to bind Bax and inhibit Bax activation and the formation of Bax:Bax homodimers. Consequently, apoptosis is prevented (35, 36). Regardless of how the ERK signaling regulates the Bcl-2 superfamily members, as a whole, Bax/Bcl-2 ratios determine whether the cell survives or undergoes apoptosis under some circumstances (37). The higher this ratio is, the more possibility apoptosis would occur. In this study, we showed that UA treatment in HeLa cells increased the ratio of Bax/Bcl-2, level of cytosol cytochrome c, and activation of caspase-3 compared to the control cells; when U0126 was added to inhibit ERK1/2, the regulation effects were enhanced on the above characteristics. Furthermore, we also found that the Bax/Bcl-2 ratio and the expression of those proteins induced by UA have not been significantly altered in cells treated with the p38 inhibitor SB203580 compared with the UA group. Thus, our findings firstly provided the evidence that UA-induced apoptosis was


closely associated with suppression of the phosphorylation of ERK1/2 in HeLa cells. Future experiments will further define the role of p38 in apoptotic process induced by UA treatment in HeLa cells. DUSPs are negative regulators of the activity of MAPKs. Expression of DUSPs is correlated with the activity of its target MAPK, which can regulate cell survival and apoptosis (38). DUSPs can specifically dephosphorylate one or more MAPKs (39), and substrate specificity may be dependent upon cell type and context (40 – 42). DUSP 1, 2, 4, and 5 are mitogen- and stressinducible nuclear DUSPs; DUSP 6, 7, and 9 are cytoplasmic ERK-specific DUSPs; DUSP 8, 10, and 16 are JNK/p38-specific phosphatases found in both the cell nucleus and cytoplasm (43). Here, we revealed that DUSP 1, 2, 4, 5, 6, 7, and 9 mRNA expressions were up-regulated; and DUSP 14 and 16 expressions were not changed with UA treatment. It is therefore speculated that higher-expressed DUSP 4, 5, 6, 7, 9, specifically dephosphorylated ERK1/2 as substrate may account for the decrease in the phosphorylation of ERK1/2; higherexpressed DUSP 1 and 2, specifically dephosphorylated p38 as substrate may account for the decrease in the phosphorylation of p38; and unvaried phosphorylation of JNK may be due to no difference in mRNA level of DUSP 16, which would specifically dephosphorylated JNK as substrate, between with or without UA treatment. To the best of our knowledge, no one has reported that UA has potential to regulate the expression of DUSP genes in cervical carcinoma. It has been documented that DUSP 1, 2, 3, 4, 5, and 6 have emerged as potential regulators of cell growth, apoptosis, and transformation in different cell systems and human malignancies (43). Therefore, further investigations to explore the regulatory mechanisms of UA on specific DUSP gene expression in cervical cancer cells may prove to be worthwhile. In conclusion, our present study demonstrated that UA was able to effectively inhibit the proliferation and induce apoptosis in HeLa cells. The UA-induced apoptosis was mainly associated with the mitochondrial intrinsic pathway, as we provided the evidence of the release of cytochrome c from mitochondria and the cleavage of caspases-9 and -3. Moreover, the apoptotic mechanism involved upregulation of Bax and Bak expression and downregulation of Bcl-2 and Bcl-xL. UA acted on the HeLa cells through suppressing p-ERK1/2 and p-p38, but not p-JNK. Furthermore, ERK1/2 signaling pathways were proven to be involved in the pro-apoptotic effects of UA on cervical cancer cells by increasing the Bax/ Bcl-2 ratio. Last but not least, the upregulation of specific DUSP genes may be responsible for the dephosphorylation of ERK1/2 and p38. Taken together, our findings provided new insights into the molecular mechanisms

209

of UA in HeLa cells and will be useful for evaluating the potency of UA as a promising agent for the prevention and treatment of human cervical cancer. Acknowledgments This research was financially supported by Natural Science Foundation of Xinjiang Uygur Autonomous Region (No.2011211B51) and Western Action Project of Bureau of Resources and Environmental Science, Chinese Academy of Sciences (KZCX-XB2-17), P. R. China.

Conflicts of Interest The authors indicated no potential conflicts of interest.

References 1 Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61:69–90. 2 Kazakova OB, Giniyatullina GV, Yamansarov EY, Tolstikov GA. Betulin and ursolic acid synthetic derivatives as inhibitors of Papilloma virus. Bioorg Med Chem Lett. 2010;20:4088–4090. 3 Cunha WR, de Matos GX, Souza MGM, Tozatti MG, Andrade e Silva ML, Martins CH, et al. Evaluation of the antibacterial activity of the methylene chloride extract of Miconia ligustroides, isolated triterpene acids, and ursolic acid derivatives. Pharm Biol. 2010;48:166–169. 4 Shanmugam MK, Ong TH, Kumar AP, Lun CK, Ho PC, Wong PT, et al. Ursolic acid inhibits the initiation, progression of prostate cancer and prolongs the survival of TRAMP mice by modulating pro-inflammatory pathways. PloS One. 2012;7: e32476. 5 Jin YR, Jin J, Li CH, Piao XX, Jin NG. Ursolic acid enhances mouse liver regeneration after partial hepatectomy. Pharm Boil. 2012;50:523–528. 6 Sultana N. Clinically useful anticancer, antitumor, and antiwrinkle agent, ursolic acid and related derivatives as medicinally important natural product. J Enzyme Inhib Med Ch. 2011;26: 616–642. 7 Yim EK, Lee KH, Namkoong SE, Um SJ, Park JS. Proteomic analysis of ursolic acid-induced apoptosis in cervical carcinoma cells. Cancer Lett. 2006;235:209–220. 8 Wada T, Penninger JM. Mitogen-activated protein kinases in apoptosis regulation. Oncogene. 2004;23:2838–2849. 9 Chang L, Karin M. Mammalian MAP kinas signaling cascades. Nature. 2001;410:37–40. 10 Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 2002;298:1911–1912. 11 Cargnello M, Roux PP. Activation and function of the MAPKs and their substrates, the MAPK-activated protein kinases. Microbiol Mol Biol R. 2011;75:50–83. 12 Pearson G, Robinson F, Gibson TB, Xu BE, Karandikar M, Berman K, et al. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev. 2001;22:153–183. 13 Huang CY, Tan TH. DUSPs, to MAP kinases and beyond. Cell Biosci. 2012;2:24.

210

Y Li et al

14 Jeffrey KL, Camps M, Rommel C, Mackay CR. Targeting dual-specificity phosphatases: manipulating MAP kinase signaling and immune responses. Nat Rev Drug Discov. 2007;6:391–403. 15 Patterson K, Brummer T, O’brien P, Daly R. Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009;418:475–489. 16 Keyse SM. Dual-specificity MAP kinase phosphatases (MKPs) and cancer. Cancer Metast Rev. 2008;27:253–261. 17 Xu S, Furukawa T, Kanai N, Sunamura M, Horii A. Abrogation of DUSP6 by hypermethylation in human pancreatic cancer. J Hum Genet. 2005;50:159–167. 18 Zhang Z, Kobayashi S, Borczuk AC, Leidner RS, LaFramboise T, Levine AD, et al. Dual specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic ERK signaling in lung cancer cells. Carcinogenesis. 2010;31: 577–586. 19 Breckenridge DG, Xue D. Regulation of mitochondrial membrane permeabilization by BCL-2 family proteins and caspases. Curr Opin Cell Biol. 2004;16:647–652. 20 Kassi E, Sourlingas TG, Spiliotaki M, Papoutsi Z, Pratsinis H, Aligiannis N, et al. Ursolic acid triggers apoptosis and Bcl-2 downregulation in MCF-7 breast cancer cells. Cancer Invest. 2009;27:723–733. 21 Kwon SH, Park HY, Kim JY, Jeong IY, Lee MK, Seo KI. Apoptotic action of ursolic acid isolated from Corni fructus in RC-58T/h/SA#4 primary human prostate cancer cells. Bioorg Med Chem Lett. 2010;20:6435–6438. 22 Harmand PO, Duval R, Delage C, Simon A. Ursolic acid induces apoptosis through mitochondrial intrinsic pathway and caspase-3 activation in M4Beu melanoma cells. Int J cancer. 2005;114: 1–11. 23 Zheng GY, Qu LP, Yue XQ, Gu W, Zhang H, Xin HL. Portulacerebroside A induces apoptosis via activation of the mitochondrial death pathway in human liver cancer HCCLM3 cells. Phytochem Lett. 2014;7:77–84. 24 Yang GH, Jarvis BB, Chung YJ, Pestka JJ. Apoptosis induction by the satratoxins and other trichothecene mycotoxins: relationship to ERK, p38MAPK, and SAPK/JNK activation. Toxicol Appl Pharm. 2000;164:49–160. 25 Wang J, Liu L, Qiu H, Zhang X, Guo W, Chen W, et al. Ursolic acid simultaneously targets multiple signaling pathways to suppress proliferation and induce apoptosis in colon cancer cells. PLoS One. 2013;8:1–13. 26 Shan JZ, Xuan YY, Zheng S, Dong Q, Zhang SZ. Ursolic acid inhibits proliferation and induces apoptosis of HT-29 colon cancer cells by inhibiting the EGFR/MAPK pathway. J Zhejiang Univ Sci B. 2009;10:668–674. 27 Wang X, Li L, Wang B, Xiang J. Effects of ursolic acid on the proliferation and apoptosis of human ovarian cancer cells. J Huazhong Univ Sci Technolog Med Sci. 2009;29:761–764. 28 Zhang YX, Kong CZ, Wang HQ, Wang LH, Xu CL, Sun YH. Phosphorylation of Bcl-2 and activation of caspase-3 via the

29

30

31

32

33

34

35 36

37

38 39

40

41 42

43

c-Jun N-terminal kinase pathway in ursolic acid-induced DU145 cells apoptosis. Biochimie. 2009;91:1173–1179. Kothakota S, Azuma T, Reinhard C, Klippel A, Tang J, Chu K, et al. Caspase-3-generated fragment of gelsolin: effector of morphological change in apoptosis. Science. 1997;278:294–298. Kamada S, Kusano H, Fujita H, Ohtsu M, Koya RC, Kuzumaki N, et al. A cloning method for caspase substrates that uses the yeast two-hybrid system: cloning of the antiapoptotic gene gelsolin. Proc Natl Acad Sci U S A. 1998;95:8532–8537. Liu Y, Yang Y, Ye YC, Shi QF, Chai K, Tashiro SI, et al. Activation of ERK-p53 and ERK-mediated phosphorylation of Bcl-2 are involved in autophagic cell death induced by the c-Met inhibitor SU11274 in human lung cancer A549 cells. J Pharmacol Sci. 2011;118:423–432. Ruvolo PP, Deng X, Carr BK, May WS. A functional role for mitochondrial protein kinase C alpha in Bcl2 phosphorylation and suppression of apoptosis. J Biol Chem. 1998;273:25436– 25442. Deng X, Ruvolo P, Carr B, May WS. Survival function of ERK1/2 as IL-3-activated, staurosporine-resistant Bcl2 kinases. Proc Natl Acad Sci U S A. 2000;97:1578–1583. Deng X, Gao F, Flagg T, May WS. Mono- and multisite phosphorylation enhances Bcl2’s antiapoptotic function and inhibition of cell cycle entry functions. Proc Natl Acad Sci U S A. 2004;101:153–158. Sebolt-Leopold JS. Development of anticancer drugs targeting the MAP kinase pathway. Oncogene. 2000;19:6594–6599. McCubrey JA, Steelman LS, Chappell WH, Abrams SL, Wong EW, Chang F, et al. Roles of the RAF/MEK/ERK pathway in cell growth, malignant transformation and drug resistance. Bba-Mol Cell Res. 2007;1773:1263–1284. Oltersdorf T, Elmore SW, Shoemaker AR, Armstrong RC, Augeri DJ, Belli BA, et al. An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature. 2005;435:677–681. Arnoldussen YJ, Saatcioglu F. Dual specificity phosphatases in prostate cancer. Mol Cell Endocrinol. 2009;309:1–7. Patterson K, Brummer T, O’brien P, Daly R. Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009;418:475–489. Camps M, Nichols A, Arkinstall S. Dual specificity phosphatases: a gene family for control of MAP kinase function. Faseb J. 2000;14:6–16. Huang CY, Tan TH. DUSPs, to MAP kinases and beyond. Cell Biosci. 2012;2:24. Franklin CC, Kraft AS. Conditional expression of the mitogenactivated protein kinase (MAPK) phosphatase MKP-1 preferentially inhibits p38 MAPK and stress-activated protein kinase in U937 cells. J Biol Chem. 1997;272:16917–16923. Nunes-Xavier C, Roma-Mateo C, Rios P, Tarrega C, CejudoMarin R, Tabernero L, et al. Dual-specificity MAP kinase phosphatases as targets of cancer treatment. Anti-Cancer Agent Me. 2011;11:109–132.