Useful marker for the estimation of a ... - Wiley Online Library

Reproductive Medicine and Biology 2007; 6: 91–97

doi: 10.1111/j.1447-0578.2007.00171.x

Original Article Blackwell Publishing Asia

gr/gr deletion using qRT–PCR

Useful marker for the estimation of a recombination pair in the partial azoospermia factor c (gr/gr) deletion using quantitative real-time polymerase chain reaction HIROMI SUZUKI,1 FUTOSHI MATSUI,1 EITETSU KOH,1* MASATO FUKUSHIMA,1 JIN CHOI,1 YUJI MAEDA,1 MIKIO NAMIKI1 and ATSUMI YOSHIDA2 1

Department of Integrated Cancer Therapy and Urology, Kanazawa University Graduate School of Medical Science, Kanazawa and 2The Reproduction Center, Kiba Park Clinic, Tokyo, Japan Background and aims: Azoospermia factor c (AZFc) microdeletions are associated with male infertility and are caused by intrachromosal recombination between homologous repetitive sequence segments. Partial AZFc deletion (gr/gr) has been reported in male factor infertility. In the present study, we established detecting the copy number using quantitative real-time polymerase chain reaction (qRT-PCR) with the genome DNA, and assessed the association of the recombination pair set of gr/gr deletion and deleted in azoospermia copies. Furthermore, we determined the clinical significance of differential recombination patterns of gr/gr deletion, and compared them with azoospermia and proven fertile volunteers, with both groups having gr/gr deleted Japanese subjects. Materials and methods: A total of 16 Japanese subjects with idiopathic azoospermia, and 13 proven fertile men with gr/gr

INTRODUCTION HE WHOLE SEQUENCE of the Y chromosome was determined after the completion of the human genome project.1 As a result, large identical sequences have been found to be present as massive Y-specific repeats, called amplicons, on the distal side of the euchromatic region of the long arm of the Y chromosome. These ampliconic regions have formed eight palindromes. All palindrome structures have more than 99.9% sequence

T

Hiromi Suzuki and Futoshi Matsui contributed equally to this work. *Correspondence: Eitetsu Koh, Department of Integrated Cancer Therapy and Urology, Kanazawa University Graduate School of Medical Science, 13-1 Takarama-machi, Kanazawa 920-8641 Japan. Email: [email protected] Received 16 October 2006; accepted 27 November 2006.

deletion, were studied. qRT-PCR was used for the estimation of an identical site number.

Results: The g1/g2 deletion was found in 69.2% (9/13) in proven fertile men and in 75% (12/16) of idiopathic infertile men. The gr/gr deletion could result in the recombination of g1/g2 segments. Furthermore, there was no difference in the position of deletion between azoospermic patients and controls (P = 0.59). Conclusion: There was no association between the loss of DAZ cluster and azoospermia in gr/gr deletion. This suggests that most of the partial deletions are neutral variants. (Reprod Med Biol 2007; 6: 91–97) Key words: azoospermia factor, deleted in azoospermia, infertility, microdeletion, real-time polymerase chain reaction.

homology, and the palindromes in the azoospermia factor c (AZFc) region consist of a complex of several small segments.2 Complete deletions of AZFc have been shown after intrachromosomal recombinations between b2 and b4 segments. When the b2/b4 deletion is eliminated, the complete AZFc region causes spermatogenetic failure.2 Repping also reported the 1.6Mb AZFc partial deletion (gr/gr deletion). The gr/gr deletion, caused by homologous recombination events, is speculated to be the result of three types of recombination pairs, such as g1/g2, r1/r3 and r2/r4 subampliconic segments.3–5 Deleted in azoospermia (DAZ) genes span the gr/gr region and the multiple copies are clustered in the AZFc region. DAZ is transcribed in the adult testis and appears to encode an RNA-binding protein.6 DAZ deletions result in azoospermia with Sertoli cell-only

© 2007 The Authors Journal compilation © 2007 Japan Society for Reproductive Medicine

91

92 H. Suzuki et al.

syndrome or testicular maturation arrest. The gr/gr deletion explains the loss of some copies of DAZ clusters. Therefore, the gr/gr deletion was reported as a significant risk factor for spermatogenetic failure.4,7,8 However, other studies have reported this deletion to not be associated with spermatogenesis failure.9–12 A part of the Japanese subpopulation has been observed to have a Y-haplogroup D2b with a gr/gr deletion in common.4,10 Sequence tagged site (STS) markers are now available for the detection of the position of deleted gr/gr regions.4 However, there is not enough information to distinguish the recombination pairs set as a result of their high homology similarity. The objective of the present study was to establish multiple sites which are identical to sequences using the quantitative detection of copies by quantitative real-time polymerase chain reaction (qRT–PCR) from the genome DNA, and then to evaluate the association of the deletion pair segments of gr/gr deletion and DAZ copies. Furthermore, we aimed to determine the effects of gr/gr deletion by comparing azoospermia with Sertoli cell-only phenotype and proven fertile volunteers, both having proven gr/gr deleted Japanese subjects.

MATERIALS AND METHODS Subjects HIRTEEN IDIOPATHIC INFERTILE patients and 16 proven fertile volunteers with gr/gr deletion were studied. The idiopathic infertile patients were shown to be Sertoli cell-only by testicular biopsy. All patients were subjected to detailed history taking, physical examination, at least two semen analyses, endocrinology profile testing, karyotyping and a molecular test for Y-chromosome microdeletions. Semen analysis was carried out according to the standard methods outlined by the World Health Organization.13 The proven fertile volunteers had fathered at least one child. All participants were found to have no microdeletions of AZF, using specific STS probes. Microdeletion of each AZF was carried out by PCR using probes sY84 and sY86 for AZFa, sY127 and sY134 for AZFb, and sY254 and sY255 for AZFc, according to guidelines published by the European Academy of Andrology.14 A gr/gr deletion was identified by the absence of PCR amplification of the marker sY1091, according to Repping.4 All subjects had a normal karyotype and no deletion of AZF microdeletions. The present study was approved by the Ethical Committee of Kanazawa University Hospital, and informed consent was obtained from patients and volunteers.

T


DNA preparations Genomic DNA was extracted from peripheral blood lymphocytes using Quiagen genome extraction kit (Hilden, Germany) according to the manufacturer’s protocol, including an RNase A digestion step (incubation of 200 µL sample with 400 µg RNase for 10 min at 37°C) to degrade RNA. First, quality and concentration of all DNA samples were determined by recording a UV absorption spectrum between 220 and 320 nm with a spectrophotometer. Concentrations were determined by qRT–PCR on an ABI 7700 (Applied Biosystems, Rotkreuz, Switzerland) so that each sample DNA, when amplified with TagMan RNase P Detection regent (ABI), reached a threshold cycle equivalent to a 10-ng control genome DNA provided by ABI. Each DNA sample was adjusted to 10 ng.

Adjustment for amount of total input DNA To adjust for differences in the amount of total input DNA, sample genome DNA was quantified by a detecting single-copy gene probe RNase P (TaqMan RNase P detection reagents; primer and probe sequences are proprietary). A standard curve was generated using a normal human genome provided by ABI as a control genome DNA (TaqMan control genomic DNA). Serial dilutions of control genome DNA containing 10 ng, 7.5 ng, 5 ng and 2.5 ng per 5 µL were made in water. The accurate mass of DNA samples was determined by qRT–PCR on an ABI 7700 so that each DNA reached a threshold cycle equivalent to 10 ng control DNA.

Quantitative real-time Taqman PCR probes Sets of primers were chosen to obtain PCR products of approximately 100 base pairs. A dual-labeled fluorogenic probe (labeled with a ‘reporter’ dye and a second dye, quenching the emission of the ‘reporter’ dye) complementary to a sequence within each PCR product was added to the PCR reaction. Cleavage of the probe during elongation by the exonuclease activity of the Taq DNA polymerase separates the reporter from its quencher. We modified the original STS probes which were obtained from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov), because original STS probes were too long for qRT–PCR probes.

STS marker in AZFc regions The region of AZFc consists of a complex of several small segments2 (Fig. 1a) and is present on one or more



gr/gr deletion using qRT–PCR 93

Figure 1 Schematic representation of azoospermia factor c (AZFc) region. (a) The Palindrome complex consists of subampliconic segments. (b) Position of each STS primer in the AZFc region from GenBank. (c) Candidate recombination pairs in the gr/gr deletion and b2/b4 (AZFc) deletion.

identical tandem sequences as a result of its repeat structures. The segments of the palindromes in the AZFc are shown, and the position of each STS primer is indicated in Figure 1b. Probes were selected from GenBank as follows: sY142 (G38345), sY 1196(G67167), sY 1197 (G67168), sY 254 (G38349), sY 579 (G63909), sY 1291(G72340), sY 1054(G6716), sY 1190(G67165), sY 639 (G67162), and sY 1201(G67170).

Selection of modified STS probes for qRT–PCR The region of AZFc is present as identical sequences (segments), because of their repeat structures. The AZFc region consists of four segmental families (‘b1,2,3,4’, ‘g1,2,3,4’, ‘yel1,2’, ‘r1,2,3,4’ segments, etc.) as shown Figure 1a. These segments have high homology and form direct and reverse repeats. The recombination occurs between each pair segment and in the same directions. The original position of STS probes is indicated in Figure 1b in the AZFc region. We modified the primer size for qRT–PCR, so that the PCR products amplify approximately 100 base pairs, and hybridization probes within each primer and dual-labeled fluorogenic probes (Taqman probe) are designed between these selected modified probes (Table 1). The amplicon corresponding primers that showed a unique BLAST hit were selected and used in further experiments. The sY254 sequence is also retrieved from NCBI, and the sequence of modified sY254 primer (sY254m) is confirmed as a unique position by the UCSC Genome Bioinformatics site (http://www.genome.ucsc.edu/) using Genome Browser (NCBI Build 36.1), which was produced by the International Human Genome Sequencing Consortium (Table 1).

Condition of real time PCR Each PCR reaction contained 12.5 µL Taqman Universal PCR Master Mix, a 0.5 µmol/L concentration of each

Table 1 The position of multiple-sY254 and sY579 were subjected to a BLAST search of the University of California Santa Cruz human genome assembly (March 2006 freeze) STS primers

Strand

Start

End

sY254 (1) sY254 (2) sY254 (3) sY579 (1) sY254 (4) sY254 (5) sY579 (2) sY254 (6) sY254 (7)

– – – + + – + + +

23725716 23736556 23747404 23663736 23782129 25361787 25278121 25396516 25407364

23725795 23736635 23747483 23863999 23782208 25361866 25478384 25396595 25407443

STS primer, 10 ng DNA and 7.5 pmol of each Y specific hybridization primer, in a total reaction volume of 25 µL. All samples were run in triplicate, and repeated at least twice. Results are reported as average mass. Amplification conditions consisted of 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. PCR products were size-fractioned on 2.5% agarose gels and visualized under UV light to confirm the expected product length. Reproducibility and accuracy of PCR experiments was confirmed by the preceding experiments.

Calculations of copy number To confirm whether PCR would be quantitative in infertile DNA samples, serial four-point dilutions were prepared from control genome DNA and subjected to qRT–PCR at a single reference locus (RNase P). Over a range of 2.5–10 ng, the starting DNA reached threshold (threshold coefficiency; Ct). Isolated genome DNA from participants was subjected to qRT–PCR at the same time and Ct was plotted. We determined the mass of sample DNA. In general, DNA mass is proportional to Ct. All PCR reactions constantly contained the 10 ng of sample genome DNA. The amount of amplification is


94 H. Suzuki et al.


Figure 2 Threshold coefficient (Ct) value, and corresponding logarithmic standard curve plot and sample data.

expected to be proportional to the number of identical sequence sites of each genome. The copy number can be easily calculated by dividing the mass of sample DNA products by the mass of reference DNA products for reference site. The sY142 is a single site of Y specific. Therefore, the copy number is to be determined by the estimated amount of qRT–PCR amplicon relative to that of sY142 amplicon. The copy number corresponds to a relative mass of sY142 amplicon in the present study.

Statistical analysis Fisher’s exact test was carried out in a comparison between two groups. P < 0.05 was considered significant.

RESULTS Adjustment of infertile genome DNA HE qRT–PCR BASED method for estimation of identical site number required the absolute quantification of a single-copy gene. For this purpose, all sample genome DNA were adjusted to 10 ng using qRT–PCR. We plotted threshold coefficients (Ct) with respect to corresponding DNA concentrations, determined the linear dynamic range of DNA concentrations for both target DNA (slope of –3.34 for human control DNA assays), and observed a significant correlation coefficient (r > 0.97 for RNase P gene). Absolute quantitation of the amount of target amplicon in samples is accompanied by measuring its Ct value and using the corresponding logarithmic standard curve plot for linear interpolation (Fig. 2).

T

Evaluation of the expected copy number We used modified probes to evaluate copy number, as shown in Table 2. sY1196m, sY1197m are a single copy,

sY579m, sY1054m, sY1190m and sY639m are two copies relative to sY142m (Table 3). sY 579 m is present as two copies in the r1/r2 or r3/r4 junctions. Some PCR primers could not design a specific primer such as sY1125, sY1192, sy1198, sY1201 and sY1206 shown Figure 1b for qRT–PCR in the present study. However, sY254 retrieves seven identical sequences (copies) as shown in Table 1.

Evaluation of recombination segments using the expected copy number of the sY254m The original definition of recombination segments of gr/gr deletion remains poorly understood. The gr/gr deletion is speculated to be the result of three candidate recombination pairs such as g1/g2, r1/r3 or r2/r4 segments (Fig. 1c). By means of qRT–PCR, gr/gr deletion is detected by single copy of sY579m, sY1054m, sY1190m and sY639m related to sY142m. The sY254m probe is present in different copy numbers in each ‘r’ segment from the GenBank database. The sY254m is present in seven copies in the ‘r’ segments, as shown in Figure 3a. Therefore, we are able to recognize the recombination pairs exactly by means of counting copy numbers of sY254m. The BLAST (http:// www.ncbi.nlm.nih.gov/BLAST/) program was used for sequence analysis; sY254m is located in seven copies in ‘r’ segments, where three copies are situated in the r1 segment, one copy is situated in the r2, r3 segments, and two copies are situated in the r4 segment (Fig. 3a). Homologous recombination requires both identical sequence and the same direction.15,16 As for the gr/gr deletion due to g1/g2 recombination, four copies, sY254m (1) to sY254m (4) are removed in r1 and r2 segments. As a result, three copies in r3 and r4 segments are present. According to r1/r3 recombination, the r1 and r3 segments have the same direction and high homology with a distance of 83668 bp from the sY579


TGCAGGATGAGAAGCAGGTAG TCATATTTGG ACTCCAGCCTAGCTGACAGAA CGAGACC CATGCG CCAAAGGCCTGGTCT TGCATTCCAGGTTGCGGTTGTTGT TTTGGCCATTGTCAAGAGAGCAGT TACACA AGCTCCTAGCTTAAGAGGTGAGAAA GACAGGTCA CAGGTCACTTCTGGGCAAGCTCTGGA AGGTACTAAAAATATCTTTGACAAAGGGC CTCCACAATGAAAAGCCTAT GCAGATG TATTTTGTTTTGTTCCGTTTTT AAGAGA GGTGAAAGTTCCAGTCAAAAATA CTTCAGCCCCCACAAGGA CCCTAAACAATAACCACAGGCATT

TTCCAGAGCTTGCCCAGAA

AAAGTCCCCAAGTATCGTGAGG CCCCCATTTATCCCCGAAT

CTATTCGAGGGCTTCATGACCC

CGAAAGCT GACAGCAAGG GA AAGGGATCTTGGATAGGCTGG AGGGCATCCTGATTCCTTAAAGT

GAACATCAGCCTGGTAATTGGTT

AGCTCCTAGCTTAAGAGGTGAGAAAG GAATTGCTTTTAGGTTTGACCCA

TGAGCTATGACAACACCACCG

Hybrid primer Reverse primer Forward

76 80 G67168 G38349 1197 254

1197 m 254 m

79 G67167 1196

1196 m

72 65 80 G67162 G67163 G67165 639 1054 1190

639 m 1054 m 1190 m

80 G63909 579

579 m

78 G38345 142

142 m

Size (bp) Locus

Modified primers


(1) to the sY254 (3) in the r1 segment and a distance of 83666 bp from the sY5792 to the sY254 (5) in the r3 segment. Both distances are almost identical (Table 1). After the recombination between segment r1 and r3 (r1/r3) occurs, the fused r1 plus r3 segment makes three copies of sY254 primers. Therefore, the r1/r3 recombination is extinguished sY254m (4) and results in five copies of sY254. Likewise, the recombination between segment r2 and r4 (r2/r4) is caused by removing sY254 (5) and the total copy number is five sY254 primers. The expected copy numbers are shown in column sY254 of Table 3. By means of counting copy numbers of sY254m, the g1/g2 recombination is distinguishable from the r1/r3 or r2/r4 recombination, but the r1/r3 recombination is not distinguishable from the r2/r4 recombination (Table 4). The expected copy number using the present study is shown in Table 3.

Evaluation of the subjects with the gr/gr deletion A total of 16 Japanese subjects with idiopathic azoospermia and 13 proven fertile men were selected with a presence of the gr/gr deletion for the present study. Of the 13 subjects, nine (69.2%) had the g1/g2 deletion in proven fertile men and 75% (12/16) had the g1/g2 deletion in azoospermic men. Therefore, the possibility exists that most of the gr/gr deletion is a result of the recombination of the g1/g2 pair. We estimated the difference of the recombination pairs resulting in gr/gr deletion between the infertile and fertile groups. In the present study, we were able to identify the recombination pairs g1/g2 or r1/r3 plus r2/r4. According to Fisher’s exact test, there was no significance between patients and controls in recombination pairs (P = 0.59) shown in Table 4.

DISCUSSION

sY

Table 2 Quantitative real-time TagMan polymerase chain reaction and probes and modified probes


Q

UANTITATIVE REAL-TIME PCR has proven to be a valuable method for quantification of gene expression, viral pathogens, gene amplification in tumors and detection of numerical chromosomal aberrations.17–20 We demonstrated the application of a new, flexible, fast and precise real-time PCR based method for estimation of the copy number of identical sequences in the Y chromosome ampliconic region. All AZFc amplicons have a high sequence homology which could not be distinguished by conventional STS.21 Real-time PCR is dependent on copy number rather than polymorphism; therefore, all loci, theoretically,


96 H. Suzuki et al.


Table 3 Expected related copy numbers to sY142m in partial deletion of azoospermia factor c

No deletion gr/gr

(g1/g2) (r1/r3) (r2/r4)

sY142m

sY1196m

sY1197m

sY579m

sY1054m

sY1190m

sY639m

sY254m

1 1 1 1

1 1 1 1

1 1 1 1

2 1 1 1

2 1 1 1

2 1 1 1

2 1 1 1

7 3 5 5

Table 4 Relative copy number of sY254m and recombination pairs between proven fertile and azoospermia groups Copies of sY245m

Potential gr/gr deletion in recombination pairs

Proven fertile

Azoospermia

3 5

g1/g2* r1/r3, r2/r4*

9 4

12 4

Fisher’s exact test, * no significance (P = 0.59).

Figure 3 Schematic representation of the gr/gr deletion. (a) Location of sY254m primers in the recombination pairs. (b) Candidate recombination pairs in the gr/gr deletion.

should be informative in each sample.22,23 In many of these cases, a sufficient sequence was available so that alternative primer sets could be chosen for a locus. However, initial experiments indicated that the primer set described in the NCBI was not suitable for real time PCR, because multiple bands appeared on amplification of genomic DNA, thus indicating non-specific amplification. Therefore, we modified the original STS markers and confirmed the unique position for the PCR probe using the BLAST database. It is reported that complete AZFc deletions are caused after intrachromosomal recombination between the b2/b4 pair amplicon.2 There are repetitive sequences like direct repeats or invert repeats in AZFc.24 Therefore, it was expected that intrachromosomal recombination would occur between g1/g2, r1/r3 and r2/r4 pairs.25 The present study showed that a majority of gr/gr deletion was caused by the recombination of g1/g2. There

was no significance between azoospermic patients and proven fertile controls in recombination pairs such as g1/g2, r1/r3 or r2/r4 segments. The DAZ deletions came from azoospermia with Sertoli cell-only syndrome or testicular maturation arrest. Saxena et al. identified four DAZ genes in two clusters, each comprising an inverted pair in the AZF region of the Y chromosome.26 DAZ1, DAZ2, DAZ3 and DAZ4, are located on segments r1, r2, r3 and r4, respectively.27 DAZ1 is paired with DAZ2 (DAZ1/2 cluster), and DAZ3 is paired with DAZ4 (DAZ3/4 cluster), whereas DAZ2 and DAZ3 do not form clusters.25 The g1/g2 and r2/r4 deletion led to the loss of DAZ1/2 and the DAZ3/4 clusters, respectively. To determine the incidence of various DAZ cluster deletions and their effect on fertility, Machev et al. reported that DAZ3/4 was associated with male infertility.25 Ferlin et al. reported that subjects with loss of DAZ3/4 had different seminal patterns, ranging from moderate oligospermia to azoospermia and normozoospermia. 28 Analysis of DAZ gene copy number in the present study, together with published data, led Ferlin et al. to suggest that only partial AZFc deletions removing DAZ1/2 are associated with spermatogenic impairment, whereas those removing DAZ3/DAZ4 might have little or no effect on fertility.28,29 According to the results obtained in the present study, the incidence of removing DAZ1/2 is higher than that of DAZ3/4. However, we did not find an association between the loss of DAZ cluster and azoospermia in gr/gr deletion. The gr/gr deletion is predicted to result in the reduction of gene copies, but not all gene copies, thus suggesting that most gr/gr deletions are neutral variants.




15

REFERENCES 1

2

3 4

5

6

7

8

9

10

11

12

13

14

Skaletsky H, Kuroda-Kawaguchi T, Minx PJ et al. The malespecific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 2003; 423: 825–837. Kuroda-Kawaguchi T, Skaletsky H, Brown LG et al. The AZFc region of the Y chromosome features massive palindromes and uniform recurrent deletions in infertile men. Nat Genet 2001; 29: 279–286. Yen P. The fragility of fertility. Nat Genet 2001; 29: 243–244. Repping S, Skaletsky H, Brown L et al. Polymorphism for a 1.6-Mb deletion of the human Y chromosome persists through balance between recurrent mutation and haploid selection. Nat Genet 2003; 35: 247–251. Vogt PH. Genomic heterogeneity and instability of the AZF locus on the human Y chromosome. Mol Cell Endocrinol 2004; 224: 1–9. Reijo R, Lee TY, Salo P et al. Diverse spermatogenic defects in humans caused by Y chromosome deletions encompassing a novel RNA-binding protein gene. Nat Genet 1995; 10: 383–393. de Llanos M, Ballesca JL, Gazquez C, Margarit E, Oliva R. High frequency of gr/grchromosome Y deletions in consecutive oligospermic ICSI candidates. Hum Reprod 2005; 20: 216–220. Ravel C, Chantot-Bastaraud S, El Houate B, Mandelbaum J, Siffroi JP, McElreavey K. GR/GR deletions within the azoospermia factor c region on the Y chromosome might not be associated with spermatogenic failure. Fertil Steril 2006; 85: 229–231. Hucklenbroich K, Gromoll J, Heinrich M et al. Partial deletions in the AZFc region of the Y chromosome occur in men with impaired as well as normal spermatogenesis. Hum Reprod 2005; 20: 191–197. de Carvalho CM, Zuccherato LW, Fujisawa M et al. Study of AZFc partial deletion gr/gr in fertile and infertile Japanese males. J Hum Genet 2006; 51: 794–749. Carvalho CM, Zuccherato LW, Bastos-Rodrigues L, Santos FR, Pena SD. No association found between gr/gr deletions and infertility in Brazilian males. Mol Hum Reprod 2006; 12: 269–273. Zhang F, Li Z, Wen B et al. A frequent partial AZFc deletion does not render an increased risk of spermatogenic impairment in East Asians. Ann Hum Genet 2006; 70: 304. World Health Organization. Laboratory Manual for the Examination of Human Semen and Sperm-Cervical Mucus Interaction, 4th edn. Cambridge: Cambridge University Press, 1999. Simoni M, Bakker E, Krausz C. EAA/EMQN est practice guidelines for molecular diagnosis of y-chromosomal microdeletions. State of the art 2004. Int J Androl 2004; 27: 240–249.

16

17

18

19

20

21

22

23

24

25

26

27

28

29

Stankiewicz P, Lupski JR. Genome architecture, rearrangements and genomic disorders. Trends Genet 2002; 18: 74–82. Lupski JR. Genomic disorders: structural features of the genome can lead to DNA rearrangements and human disease traits. Trends Genet 1998; 14: 417–422. Linzmeier RM, Ganz T. Human defensin gene copy number polymorphisms: comprehensive analysis of independent variation in alpha- and beta-defensin regions at 8p22-p23. Genomics 2005; 86: 423–430. Jardi R, Rodriguez F, Buti M et al. Quantitative detection of hepatitis B virus DNA in serum by a new rapid real-time fluorescence PCR assay. J Viral Hepat 2001; 8: 465–471. Ruiz-Ponte C, Loidi L, Vega A, Carracedo A, Barros F. Rapid real-time fluorescent PCR gene dosage test for the diagnosis of DNA duplications and deletions. Clin Chem 2000; 46: 1574–1582. Horsman KM, Hickey JA, Cotton RW, Landers JP, Maddox LO. Development of a human-specific real-time PCR assay for the simultaneous quantitation of total genomic and male DNA. J Forensic Sci 2006; 51: 758–765. Fukushima M, Koh E, Choi J, Maeda Y, Namiki M, Yoshida A. Reevaluation of azoospermic factor c microdeletions using sequence-tagged site markers with confirmed physical positions from the GenBank database. Fertil Steril 2006; 85: 965–971. Writzl K, Zorn B, Peterlin B. Preliminary analysis of AZFb region duplication by quantitative real-time PCR. Hum Reprod 2006; 21: 753–754. Writzl K, Zorn B, Peterlin B. Copy number of DAZ genes in infertile men. Fertil Steril 2005; 84: 1522–1525. Krausz C, Quintana-Murci L, Forti G. Y chromosome polymorphisms in medicine. Ann Med 2004; 36: 573–583. Machev N, Saut N, Longepied G et al. Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility. J Med Genet 2004; 41: 814–825. Saxena R, de Vries JW, Repping S et al. Four DAZ genes in two clusters found inthe AZFc region of the human Y chromosome. Genomics 2000; 67: 256–267. Vogt PH, Fernandes S. Polymorphic DAZ gene family in polymorphic structure of AZFc locus: Artwork or functional for human spermatogenesis? APMIS 2003; 111: 115–126; discussion 126–127. Ferlin A, Tessari A, Ganz F et al. Association of partial AZFc region deletions with spermatogenic impairment and male infertility. J Med Genet 2005; 42: 209–213. Lin YW, Thi DA, Kuo PL et al. Polymorphisms associated with the DAZ genes on the human Y chromosome. Genomics 2005; 86: 431–438.
