Uteroplacental insufficiency affects epigenetic ... - CiteSeerX

Physiol Genomics 25: 16 –28, 2006. First published December 27, 2005; doi:10.1152/physiolgenomics.00093.2005.

Uteroplacental insufficiency affects epigenetic determinants of chromatin structure in brains of neonatal and juvenile IUGR rats X. Ke,1,* Q. Lei,2,* S. J. James,3 S. L. Kelleher,4 S. Melnyk,3 S. Jernigan,3 X. Yu,1 L. Wang,1 C. W. Callaway,1 G. Gill,1 G. M. Chan,1 K. H. Albertine,1 R. A. McKnight,1 and R. H. Lane1 1

Division of Neonatology, Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, Utah; David Geffen School of Medicine and Department of Pediatrics, Mattel Children’s Hospital, UCLA, Los Angeles, California; 3Department of Pediatrics, University of Arkansas Medical Sciences, Little Rock, Arkansas; and 4Department of Nutrition, University of California, Davis, California 2

Submitted 22 April 2005; accepted in final form 12 December 2005

Ke, X., Q. Lei, S. J. James, S. L. Kelleher, S. Melnyk, S. Jernigan, X. Yu, L. Wang, C. W. Callaway, G. Gill, G. M. Chan, K. H. Albertine, R. A. McKnight, and R. H. Lane. Uteroplacental insufficiency affects epigenetic determinants of chromatin structure in brains of neonatal and juvenile IUGR rats. Physiol Genomics 25: 16 –28, 2006. First published December 27, 2005; doi:10.1152/physiolgenomics.00093.2005.—Intrauterine growth retardation (IUGR) increases the risk of neuroendocrine reprogramming. In the rat, IUGR leads to persistent changes in cerebral mRNA levels. This suggests lasting alterations in IUGR cerebral transcriptional regulation, which may result from changes in chromatin structure. Candidate nutritional triggers for these changes include altered cerebral zinc and one-carbon metabolite levels. We hypothesized that IUGR affects cerebral chromatin structure in neonatal and postnatal rat brains. Rats were rendered IUGR by bilateral uterine artery ligation; controls (Con) underwent sham surgery. At day of life 0 (d0), we measured cerebral DNA methylation, histone acetylation, expression of chromatin-affecting enzymes, and cerebral levels of onecarbon metabolites and zinc. At day of life 21 (d21), we measured cerebral DNA methylation and histone acetylation, as well as the caloric content of Con and IUGR rat breast milk. At d0, IUGR significantly decreased genome-wide and CpG island methylation, as well as increased histone 3 lysine 9 (H3/K9) and histone 3 lysine 14 (H3/K14) acetylation in the hippocampus and periventricular white matter, respectively. IUGR also decreased expression of the chromatin-affecting enzymes DNA methyltransferase 1 (DNMT1), methylCpG binding protein 2 (MeCP2), and histone deacetylase (HDAC)1 in association with increased cerebral levels of zinc. In d21 female IUGR rats, cerebral CpG DNA methylation remained lower, whereas H3/K9 and H3/K14 hyperacetylation persisted in hippocampus and white matter, respectively. In d21 male rats, IUGR decreased acetylation of H3/K9 and H3/K14 in these respective regions compared with controls. Despite these differences, caloric, fat, and protein content were similar in breast milk from Con and IUGR dams. We conclude that IUGR results in postnatal changes in cerebral chromatin structure and that these changes are sex specific. Barker’s fetal origins of adult disease hypothesis; zinc; DNA methylation; histone deacetylase; histone acetylation

and undeveloped countries suffer from intrauterine growth retardation (IUGR). Epidemiologic issues for IUGR infants include poor neurodevelopmental

INFANTS IN BOTH DEVELOPED

* X. Ke and Q. Lei contributed equally to this manuscript. Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org). Address for reprint requests and other correspondence: R. H. Lane, Univ. of Utah School of Medicine, Dept. of Pediatrics, Div. of Neonatology, PO Box 58129, Salt Lake City, UT 84158 (e-mail: [email protected]). 16

outcome and problems associated with neuroendocrine reprogramming (35, 36, 65, 89, 104). These issues are examples of Barker’s “fetal origins of adult disease hypothesis,” which proposes that fetal adaptation to a deprived intrauterine milieu leads to persistent changes in cellular biology and systemic physiology (3). Causes of IUGR, such as pregnancy-induced hypertension, transiently deprive the fetus by reducing the delivery of substrate to the fetus. As a result, the fetus suffers moderate fetal hypoxia, acidosis, hypoglycemia, hypoinsulinemia, and decreased levels of growth factors and amino acids, which initiates a series of adaptations that ensure immediate survival (18 –21). Uteroplacental insufficiency caused by bilateral uterine artery ligation in the pregnant rat subjects the rat fetus to a intrauterine environment that is similar to the human condition (77–79, 96, 97). The IUGR rat recovers quickly from the initial insult during the perinatal period and appears to be metabolically normal until it develops insulin resistance in young adulthood (88, 94). Because of presumed protective mechanisms such as the “diving reflex,” the brain of the IUGR rat does not experience the same magnitude of insult as other tissues; however, the IUGR brain is affected by the altered intrauterine environment, as evidenced by altered perinatal mRNA levels of key apoptotic proteins as well as by persistent changes in mRNA levels of genes related to energy metabolism. These changes last beyond the period of recovery and occur before the onset of insulin resistance (57, 58). The molecular mechanisms underlying these changes in mRNA levels are unknown, but the aforementioned findings suggest an alteration in transcriptional regulation that is relatively persistent. Epigenetic modifications of chromatin structure cause persistent alterations in transcriptional regulation and involve processes such as DNA methylation and histone acetylation. Methylation of CpG dinucleotides is an important epigenetic mechanism that alters chromatin structure and thereby influences processes such as DNA replication and DNA transcription (12, 71, 76). DNA methylation inversely correlates with histone acetylation, which alters histone-DNA contact and affinity (40, 63, 76). Considering the ubiquitous nature of DNA methylation and histone acetylation in genome control pathways, these phenomena are possible mechanisms through which uteroplacental insufficiency could initiate a “metabolic imprint.” By permanently altering cerebral chromatin structure and subsequently affecting patterns of gene expression, IUGR could contribute to the pathogenesis of postnatal complications

1094-8341/06 $8.00 Copyright © 2006 the American Physiological Society

EPIGENETIC MODIFICATIONS IN IUGR BRAINS

such as neurodevelopmental delay and neuroendocrine reprogramming (98). We therefore hypothesized that uteroplacental insufficiency in the rat would alter cerebral DNA methylation and histone acetylation. To prove this hypothesis, we measured DNA methylation, as well as histone acetylation, in both control and IUGR rat brains at day of life 0 (d0) and day of life 21 (d21). Because of the differences we found at d0, we used two approaches to identify cellular mechanisms through which these differences occur. First, we measured and localized expression of proteins involved in DNA methylation [DNA methyltransferase 1 (DNMT1); methyl-CpG binding protein 2 (MeCP2)] and histone acetylation [histone deacetylase (HDAC)1] in control and IUGR d0 rat brains; d0 cerebral HDAC activity was also measured. Second, we measured cerebral levels of trace minerals, with a particular interest in zinc, and one-carbon metabolites in control and IUGR d0 rat brains. Cerebral zinc levels are relevant because zinc deficiency leads to IUGR, and zinc is a cofactor for many of the enzymes involved in determining chromatin infrastructure, including DNMT1 and HDAC1 (26, 69, 74, 86). We investigated the effect of uteroplacental insufficiency on whole cerebral one-carbon metabolism because it potentially contributes to the regulation of genome-wide DNA methylation via S-adenosylmethionine (SAM) and S-adenosylhomocystine (SAH) levels. METHODS

Animals. All procedures were approved by the University of Utah Chancellor’s Animal Research Committee and are in accordance with the American Physiological Society’s guiding principles (2). All surgical methods have been described previously (47–58, 66, 88, 94). Briefly, pregnant rats on day 19 of gestation were anesthetized with intraperitoneal xylazine (8 mg/kg) and ketamine (40 mg/kg), and both uterine arteries were ligated (IUGR; n ⫽ 12 litters). Term gestation in the rat is 21.5 days. Sham surgery was performed on control animals that underwent identical anesthetic and surgical procedures, except for the uterine artery ligation (Con; n ⫽ 12 litters). Full-term (d0) pups were delivered by cesarean section (n ⫽ 6 litters for Con and IUGR, respectively) 2.5 days after bilateral uterine artery ligation. Brains were quickly removed and either frozen or processed for histological evaluation (42). d0 pups were genotyped using PCR for the spermatogenic gene (Sby) from the Y chromosome to ensure an equal distribution of each sex for each methodology (forward primer: 5⬘-ACTGTTCAAGCAGTCAGCCG; reverse primer: 5⬘-CTCCATGAACTTGGGGTC) (29). To study 21-day-old (d21) rats, dams were allowed to deliver spontaneously and litters were culled to six pups, as previously described (47, 48, 52–55). At d21, Con and IUGR rats were separated from their dams for 4 h, anesthetized, and killed (n ⫽ 6 litters for Con and IUGR, respectively). Pups were studied at this age because they have not yet developed overt insulin resistance or dyslipidemia that may confound our studies, and because they are normally separated from their dams as weanlings at this age (52, 88, 94). The pups were fasted because of the potential affects of heterogeneous nutritional states on epigenetics (63). Analysis on the basis of sex was performed because previous studies demonstrated that both rodents and humans respond to a deprived intrauterine milieu in a sex-specific manner (28, 37, 52, 54, 91). d21 whole brains were collected as described for d0 above. In addition, two d21 rats per litter underwent transcardiac perfusion-fixation with 0.9% NaCl, followed by 10% formalin. Brains Physiol Genomics • VOL

25 •

17

were removed and then were put in 10% formalin at 4°C overnight for embedding (90). Cytosine extension assay. The cytosine extension assay was used to measure global and CpG island DNA methylation in IUGR and Con brains with the restriction enzymes HpaII and BssHII, which assess global and CpG island methylation, respectively (82). In brief, 2 ␮g of genomic DNA was digested overnight with 50 U of BssHII, HpaII, or MspI endonuclease according to the manufacturer’s protocol. A second DNA aliquot was incubated without restriction enzyme addition to serve as a background control. The single nucleotide extension reaction was performed in a 25-␮l reaction mixture containing 0.25 ␮g of DNA, 1⫻ PCR buffer II, 1.0 mM MgCl2, 0.25 U of AmpliTaq DNA polymerase, and [3H]dCTP (57.4 Ci/mmol), incubated at 56°C for 1 h, and then placed on ice. Six 10-␮l aliquots from each reaction were applied into Whatman DE-81 ion-exchange filters and washed three times with 0.5 Na-phosphate buffer (pH 7.0) at room temperature. The filters were dried and processed for scintillation counting. Background radiolabel incorporation was subtracted from enzyme-treated samples, and the results were expressed as relative [3H]dCTP incorporation/0.5 ␮g DNA or as percent change from Con samples. Histone isolation and Western blotting. Western blotting was used to measure overall acetylation for histones H3 and H4 at d0, as well as histone 3 lysine 9 (H3/K9) and histone 3 lysine 14 (H3/K14) site-specific acetylation at d0 and d21. In brief, histones were isolated from d0 and d21 whole brain tissue by acid extraction according to Galasinski et al. (33). Histone concentrations were determined with a micro-bicinchoninic acid (BCA) protein assay kit (Pierce Biotechnology). Ten to twenty micrograms of histones were separated on 15% SDS-PAGE gels and transferred by electroblotting to polyvinylidene difluoride membranes (Millipore, Billerica, MA). Blocking was carried out with freshly prepared PBS plus 3% nonfat milk. After washing, the membrane was incubated overnight with primary antibodies diluted in PBS-milk. Primary antibodies included antiacetyl-H3 at 1:1,000 (Upstate Cell Signaling, Lake Placid, NY), anti-acetyl-H4 at 1:1,000 (Upstate Cell Signaling), anti-acetyl-H3/K9 at 1:400 (Cell Signaling, Beverly MA), anti-acetyl-H3/K14 at 1:5,000, anti-acetyl histone 3 lysine 18 at 1:500, and anti-histone H3 at 1:2,000 (Upstate Cell Signaling). Separate membranes were used for each primary antibody (histone and nonhistone). After a result was obtained from acetylated H3, the same membrane was stripped with stripping buffer (62.5 mM Tris 䡠 HCl pH 6.7, 2% SDS, 100 mM 2-mercaptoethanol) at 55°C for 30 min and then was reprobed with total H3. Secondary antibodies conjugated with horseradish peroxidase (HRP) were incubated for 1 h at room temperature. Signal was detected with enhanced chemiluminescence (ECL) according to the manufacturer’s instructions (Amersham, Little Chalfont, UK). The amount of site-specific acetylated H3 was quantified relative to the amount of total H3 in the sample. Immunohistochemistry analysis. Immunohistochemistry was used to localize the differences in H3 acetylation occurring between IUGR and Con groups, as well as DNMT1, MeCP2, and HDAC1 expression. In brief, coronal sections of embedded brain tissue were deparaffinized and rehydrated in a graded series of ethanol and distilled H2O (dH2O) with a final wash in PBS. Sections were then incubated in a 3% H2O2 solution for 30 min at room temperature to quench endogenous peroxidase activity. After a brief PBS wash, slides were subjected to an antigen retrieval procedure (Biogenex Laboratories, San Ramon, CA), in which the slides were put in a slide tray with 10 mM citrate solution, pH 6.0, placed in a microwave oven, and heated on high power for 165 s and on low power for 8 min, after which they were cooled to room temperature. Slides were then rinsed with tap water, washed in PBS for 10 min, and incubated in a blocking buffer (2% normal goat serum, 2% bovine serum albumin, 0.8% Triton X-100, 0.2% nonfat dry milk in PBS) at room temperature for 1 h. They were then probed overnight at 4°C in a humidified www.physiolgenomics.org

18


chamber with DNMT1, MeCP2, or HDAC1, acetyl-H3/K14, or acetyl-H3/K9 antibodies at 1:100 to 1:1,000 dilution in blocking buffer. The next day, sections were washed in PBS containing 0.2% Tween 20 three times and exposed to biotinylated goat anti-rabbit antibody for 1 h. After exposure to a Vectastain avidin-biotin complex mixture for 1 h, slides were washed in PBS for 15 min, stained with diaminobenzidine (Sigma), counterstained with hematoxylin, dehydrated, and coverslipped with Cytoseal 60 (Stephens Scientific, Kalamazoo, MI). Transmission electron microscopy. Transmission electron microscopy was performed to visualize chromatin ultrastructure. The analysis focused on the hippocampus because this region is vulnerable to IUGR insult and contains a high density of hormone receptors (42, 59). Brains of d0 rat pups were fixed for transmission electron microscopy. Briefly, the brains were placed in 2.5% glutaraldehyde-1% paraformaldehyde in buffer (pH 7.4, 310 mosmol/kgH2O, 4°C for 24 h), after which the hippocampus was isolated. The principles of systematic, uniform, and random sampling were used to collect tissue blocks of hippocampus (1 mm3; 4 – 6 per hippocampal region per brain) (7). The tissue blocks were postfixed in 1% osmium tetroxide, dehydrated in a graded acetone series, and infiltrated and embedded in epoxy resin. Thin sections (80-nm thickness) were cut with the aid of a diamond knife, counterstained with uranyl acetate and lead citrate, and analyzed with a Hitachi H-7100 transmission electron microscope. Neurons in the hippocampal region were photographed at the same magnification in the upper left corner of each grid square for an entire thin section per tissue block. Thin sections from four tissue blocks were photographed per brain. Image analysis for nuclear dimensions was performed on digitized images. Nuclear average, perimeter, and maximum and minimum diameters (measured perpendicularly) were determined with Bioquant Image Analysis software (Bioquant, Nashville, TN). Ten nuclei per thin section were measured. RNA isolation and real-time RT-PCR. Brain mRNA levels of DNMT1, HDAC1, and MeCP2 were measured by real-time RT-PCR, as previously described (54, 81). In brief, total RNA was extracted from d0 brains with an RNeasy Minute Kit (Qiagen, Valencia, CA), treated with DNase I (Ambion, Austin, TX), and quantified by ultraviolet absorbance (16). Sample integrity was confirmed by gel electrophoresis. The probe and primers were designed with Primer Express (PE Applied Biosystems, Foster City, CA) with a reporter dye FAM and a TAMRA quencher dye (Table 1). cDNA was synthesized from 2 ␮g of DNase-treated total RNA. cDNA- and gene-specific probe and primers were added to Taqman universal PCR master mix (PE Applied Biosystems), and samples were run on an ABI Prism 7900. Real-time RT-PCR quantification was then performed with the Taqman GAPDH as an internal control. Before the use of GAPDH as a control, serial dilutions of cDNA were quantified to prove the validity of using GAPDH as an internal control. Relative quantification of PCR products was based on value differences between the target and GAPDH control by the comparative threshold cycle method (Taqman Gold RT-PCR manual, PE Applied Biosystems). Cycle parameters were 50°C for 2 min, 95°C for 10 min, and then 40 cycles at 95°C for

15 s and 60°C for 60 s. For each set of reactions, samples were run in triplicate. Protein isolation and Western blotting. Protein levels of DNMT1, MeCP2, and HDAC1 were measured in d0 Con and IUGR brains. In brief, whole brains were homogenized in ice-cold lysis buffer (150 mM NaCl, 50 mM Tris pH 7.4, 1 mM EDTA, 0.25% Na-deoxycholate, 1% Igepal CA-630) with protease inhibitors and 0.1 M PMSF. After centrifugation (10,000 g) at 4°C for 15 min, supernatants were stored at ⫺80°C until use. Protein concentrations were determined by the BCA method (Pierce, Rockford, IL). Proteins were separated by 10% SDS-PAGE ready gels (Bio-Rad, Hercules, CA) and transferred to nitrocellulose membranes in standard transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol). After the membranes were blocked with 5% milk in Tris-buffered saline (TBS) for 1 h, bound proteins were exposed to specific antibodies against DNMT1, HDAC1, or MeCP2 (rabbit polyclonal, Santa Cruz Biotechnology) overnight at 4°C. After extensive washing in TBS with 0.1% Tween 20, a 1:2,000 dilution of goat anti-rabbit HRP secondary antibody (Cell Signaling Technology) was applied, and incubated for 1 h at room temperature. After extensive washing, signals were detected with Western Lightning ECL (PerkinElmer Life Sciences) and Biomax film (Amersham) and quantified by densitometry or by quantification on a Kodak Image Station 2000R (Eastman Kodak/SIS, Rochester, NY). Nuclear protein extracts preparation. Nuclear protein was isolated to provide substrate for HDAC nuclear activity assays. Whole brains were ground under liquid nitrogen. Tissue that was used to prepare nuclear extracts for the HDAC activity assay was first washed with ice-cold PBS to lyse red blood cells. The ground tissue was resuspended in 5 ml of ice-cold PBS and then centrifuged (2,000 g) for 5 min. The washing step was repeated until all color was removed. The ground tissue was resuspended in 5 volumes of buffer A (in mM: 1 DTT, 0.5 PMSF, 10 KCl, 10 HEPES, pH 7.9, 1.5 MgCl2) plus protease inhibitors, incubated for 15 min on ice, and then centrifuged (2,000 g) for 5 min. The supernatant was removed by aspiration, and the tissue pellet was resuspended in 2 volumes of buffer A. The tissue was disrupted with a dounce homogenizer, using the tight pestle. Lysis was checked for every 10 strokes with Trypan blue (39). The lysate was centrifuged (1,000 g) for 10 min. The nuclear pellet was resuspended in 0.5 ml of buffer C [in mM: 1.5 MgCl2, 1 DTT, 420 NaCl, 0.5 PMSF, 0.2 EDTA, 20 HEPES, pH 7.9, with glycerol 25% (vol/vol)] plus protease inhibitors, incubated at 4°C for 30 min, and then centrifuged at 17,000 g for 15 min. The supernatant was collected and stored at ⫺80°C. HDAC enzyme activity assay. An HDAC activity assay kit (Abcam, Cambridge, MA) was used to measure HDAC activity in the d0 brain nuclear extracts as described by the manufacturer. Fifty micrograms of nuclear protein was added to each well of a 96-well plate. Two microliters of the HDAC inhibitor Trichostatin A at a final concentration of 1 mg/ml was added to the negative control wells. Mineral analysis. Whole brain zinc, iron, and copper levels were measured as previously described (43). Briefly, brain tissue was minced and digested with concentrated nitric acid and wet-ashed with

Table 1. PCR primers for real-time PCR Gene

Forward

Reverse

DNMT1 CAGATGTTCCATGCACACT Probe: 6FAM-ACCTCTGACCCTCTGGAGCTGTTCCTTGT-TAMRA HDAC1 TGAGAATGCTGCCCCATACC Probe: 6FAM-TCCCTGAGGATGCCATCCCAGAAG-TAMRA MeCP2 CGCGAAAGCTTAAACAGAGGA Probe: 6FAM-TACATCATACTTTCCAGCAGAGCGACCAGA-TAMRA

TGTGGATGTAGGAAAGTTGCA

NM_053354

GGAAATTGGTTTGTCAGGGTCTT

XM_346065

TGCAATCAATTCTACTTTAGAGCGA

NM_022673

DNMT, DNA methyltransferase; HDAC, histone deacetylase.

Physiol Genomics • VOL

25 •

Accession No.

www.physiolgenomics.org


a modification of the method of Clegg et al. (14). Whole brain zinc, iron, and copper levels were analyzed by flame atomic absorption spectroscopy (model Smith-Heifjie 4000, Thermo Jarrell Ash, Franklin, MA). One-carbon metabolite measurement. Intracellular SAM, SAH, homocysteine, methionine, cysteine, and adenosine were measured by HPLC with coulometric electrochemical detection as previously described (72, 73). Briefly, samples of frozen brain (10 –15 mg wet wt) were homogenized in 200 ␮l of PBS. To reduce sulfhydral bonds, 50 ␮l of freshly prepared 1.43 M sodium borohydride solution containing 1.5 mM EDTA, 66 mM NaOH, and 10 ␮l isoamyl alcohol was added. To precipitate proteins, 250 ␮l of ice-cold 10% meta-phosphoric acid was added and mixed well, and the sample was incubated for 30 min on ice. After centrifugation (18,000 g) for 15 min at 4°C, the supernatant was filtered through a 0.2-␮m nylon membrane filter (PGC Scientific, Frederick, MD). Metabolite elution was performed by HPLC with a Shimadzu solvent delivery system (ESA model 580) and a reverse-phase C18 column (5 ␮m; 4.6 ⫻ 150 mm; MCM, Tokyo, Japan) obtained from ESA (Chelmsford, MA). An isocratic elution at 0.9 ml/min was used. A 20-␮l aliquot of plasma extract was directly injected onto the column with a Beckman Autosampler (model 507E). All plasma metabolites were quantified with a model 5200A Coulochem II and CoulArray electrochemical detection systems (ESA) equipped with a dual analytical cell (model 5010), a four-channel analytical cell (model 6210), and a guard cell (model 5020). The concentrations of plasma metabolites were calculated from peak areas and standard calibration curves with ESA HPLC software provided by the manufacturer. Collection of breast milk and characterization of content. Dams were separated from d21 pups for 4 h and subsequently anesthetized by intraperitoneal injection with 60 mg/kg ketamine and 12 mg/kg xylazine. Each dam was injected intraperitoneally with 100 U of oxytocin. Gentle pressure was applied around each gland to collect milk drops by capillary action into a sterile glass Pasteur pipette. The dams were killed after milk collection. Caloric, fat, and protein content were determined as previously described (10, 64, 92). Mineral analysis was performed by atomic absorption spectrometry as described above. Statistics. All data are expressed as mean ⫾ SE percentages of control. ANOVA (Fisher’s protected least significant difference) and the Student’s unpaired t-test determined statistical significance. P ⬍ 0.05 was accepted as indicating statistical difference.

19

RESULTS

d0 and d21 cerebral DNA methylation. At d0, uteroplacental insufficiency significantly decreased genome-wide DNA methylation and CpG island methylation to 52.8 ⫾ 11.3% and 65.0 ⫾ 7.4% of control values, respectively (Fig. 1A; P ⬍ 0.05). As expected, no difference was noted in the MspI digests. No sex-specific differences were noted at d0 in terms of DNA methylation. In contrast, at d21, sex-specific differences were noted. For d21 female rats, uteroplacental insufficiency and subsequent IUGR resulted in a persistence of CpG island hypomethylation to 55 ⫾ 10 of control values (Fig. 1B; P ⬍ 0.01). No differences were noted in global DNA methylation between female Con and IUGR rats. For d21 male rats, no significant differences were noted in either global or CpG island methylation (Fig. 1C). d0 and d21 cerebral histone acetylation. In the d0 IUGR rat brain, total histone H3 acetylation was increased to 157 ⫾ 16.1% of control values (P ⬍ 0.05), whereas no difference was noted in total H4 histone acetylation. Site-specific changes were also evident; uteroplacental insufficiency significantly increased whole brain histone acetylation at H3/ K14 to 188 ⫾ 24 of control values (P ⬍ 0.05), without affecting H3/K9 acetylation (129 ⫾ 27% of control values) (Fig. 2A). Interestingly, immunohistochemistry revealed that that H3/K14 acetylation (Fig. 3A) and H3/K9 acetylation (Fig. 4A) were increased in d0 white matter and hippocampus, respectively, in the IUGR brains relative to control. No sex-specific differences were noted at d0 in terms of histone acetylation. In d21 female IUGR rats, total brain H3/K14 acetylation persisted to 123 ⫾ 5.6% of control values (*P ⬍ 0.05; Fig. 2B). This persistence did not hold true for total brain H3/K9 acetylation, which was not significantly different between d21 IUGR and Con female rats. However, localized changes in H3/K14 and H3/K9 acetylation persisted in the d21 female rats, because immunohistochemistry demonstrated increased

Fig. 1. Levels of global and CpG island DNA methylation from control (C) and intrauterine growth retardation (IUGR; I) whole brains. A: day of life 0 (d0). B: day of life 21 (d21) female. C: d21 male. Results are expressed as mean ⫾ SE % relative to sham-operated controls (n ⫽ 6 litters). *P ⬍ 0.05, **P ⬍ 0.01.


25 •


20


Fig. 2. Quantification of Western blots for histone 3 lysine 9 (H3/K9) and histone 3 lysine 14 (H3/K14) for d0 control and IUGR brain (A), d21 female control and IUGR brain (B), and d21 male control and IUGR brain (C). *P ⬍ 0.05; †P ⬍ 0.001. D: representative Western blots for d21 female acetyl-H3/K14 and d21 male acetyl-H3/K9. Top bands are acetylated H3, and bottom bands are total H3 internal control; n ⫽ 6 litters.

H3/K14 acetylation in the white matter and increased H3/K9 acetylation in the hippocampus, respectively (Figs. 3B and 4B). In contrast, in d21 male rats, total brain H3/K14 acetylation was not significantly different between IUGR and Con animals, whereas H3/K9 acetylation was significantly reduced in brain from IUGR male rats to 68.3 ⫾ 1.9 of control values (P ⬍ 0.001; Fig. 2C). Moreover, decreased acetylated H3/K14 and H3/K9 immunostaining were evident in the internal capsule and hippocampus of the male IUGR rats, respectively (Figs. 3C and 4C). d0 Transmission electron microscopy. The ultrastructural appearance of nuclei of neurons in the hippocampus was dependent on the rat group. Nuclei appeared smaller with more condensed chromatin around the nuclear envelope in the brains from IUGR pups compared with the Con group, whereas the larger nuclei in the Con group had an open-faced vesicular profile (Fig. 5). Image analysis supported the observed difference in size and showed that neuronal nuclei were significantly smaller in the hippocampus from the IUGR pups (Table 2). d0 Cerebral MeCP2 and DNMT1 gene expression. Uteroplacental insufficiency decreased DNMT1 mRNA and protein levels in IUGR pup brains to 50 ⫾ 8.0% (P ⬍ 0.01) and 71.5 ⫾ 8.0% (P ⬍ 0.05) of control values, respectively (Fig. 6A). Similarly, cerebral mRNA levels of MeCP2 in IUGR pups were decreased to 49.6 ⫾ 8% (P ⬍ 0.01) of control values (Fig. 6B). Likewise, d0 cerebral protein levels of MeCP2 in IUGR pups were also decreased to 62 ⫾ 7.8% of control values (P ⬍ 0.01; Fig. 6B). Immunohistochemistry revealed dePhysiol Genomics • VOL

25 •

creased expression of both DNMT1 and MeCP2 within the hippocampus of the IUGR pups relative to controls (Fig. 6, A and B). No sex-specific differences were noted at d0 for either DNMT1 or MeCP2. d0 Cerebral HDAC1 gene expression and HDAC activity. Although d0 HDAC1 mRNA levels were not affected, uteroplacental insufficiency significantly decreased HDAC1 protein levels in d0 IUGR brains to 68.3 ⫾ 13.5 of control values (P ⬍ 0.05; Fig. 6C). In association with this change, IUGR brain HDAC nuclear activity decreased to 75 ⫾ 7.9% of control values (P ⬍ 0.05; Fig. 6C). No sex-specific differences were noted at d0 for these measures of HDAC expression and activity. As with MeCP2 and DNMT1, differences in HDAC1 protein expression between d0 IUGR and Con brains localized to the hippocampus, where decreased HDAC1 staining was observed in IUGR rats (Fig. 6C). d0 Cerebral mineral concentrations and one-carbon metabolites. Uteroplacental insufficiency also significantly increased whole brain levels of zinc, while decreasing whole brain levels of iron (Table 3). Copper levels were not significantly affected by uteroplacental insufficiency. Uteroplacental insufficiency significantly increased cerebral levels of adenosine, cysteinylglycine, and cysteine in the IUGR pups relative to the shamoperated controls (Table 3). No significant differences were noted in homocysteine, methionine, SAM, and SAH between the two groups. d21 Breast milk content. Breast milk from dams that underwent the IUGR surgery did not significantly differ from Con breast milk in terms of caloric, fat, and protein www.physiolgenomics.org


21

Fig. 3. Representative immunohistochemistry of H3/K14 (brown staining) from periventricular white matter of d0 control and IUGR brains (A), as well as internal capsule of d21 of female (B) and male (C) control and IUGR brains (n ⫽ 6 litters).

content (Table 4). Furthermore, no differences existed between Con and IUGR breast milk in terms of zinc and sodium content (Table 4). Interestingly, increased iron content characterized the breast milk from the IUGR dams vs. breast milk from the Con dams (36.3 ⫾ 5.3 vs. 26.5 ⫾ 7.1 ␮g/dl; P ⬍ 0.05). DISCUSSION

Uteroplacental insufficiency causes IUGR, complicates ⬃6% of all pregnancies, and impacts human health because of morbidities such as neurodevelopmental delay and neuroendocrine reprogramming (13, 27, 32, 102, 103). These long-term morbidities suggest epigenetics as a responsible mechanism. Epigenetics involves changing determinants of chromatin structure and allows adaptation to the deprived environment through gene expression via an initial investment of energy. The latter is true because DNA methylation and histone acetylation can be maintained through cell division and therefore encode heritable information (45, 95). However, little has been Physiol Genomics • VOL

25 •

presented identifying specific molecular epigenetic changes in the brain of animals suffering a prenatal insult. We therefore focused this study on the IUGR brain. The novel findings from this work include 1) IUGR affects DNA methylation and histone acetylation; 2) epigenetic alterations occur through d21 and show sex specificity; 3) the effects of IUGR on cerebral epigenetic determinants are region specific; 4) a possible trigger for these changes includes cerebral zinc levels; and 5) at d21, caloric, protein, and fat breast milk content do not differ between Con and IUGR dams, although iron content is significantly increased in IUGR breast milk. Our findings of H3 hyperacetylation and DNA hypomethylation in IUGR rat brain at d0 demonstrate that IUGR impacts epigenetic determinants of cerebral chromatin structure, which is visible in the hippocampus by transmission electron microscopy. To understand the process though which these changes occur, we initially targeted DNMT1, as opposed to other DNA methyltransferases, because DNMT1 represents the majority of methyltransferase activity in embryo lysates (62, 107). The www.physiolgenomics.org

22


Fig. 4. Representative immunohistochemistry of H3/K9 (brown staining) from hippocampal region of control and IUGR brains of d0 pups (A), d21 females (B), and d21 males (C) (n ⫽ 6 litters).

association between decreased cerebral DNMT1 mRNA and protein expression suggests that DNMT1 plays a role in IUGR hypomethylation. Similarly, global cerebral DNA hypomethylation characterizes transgenic animals in which DNMT1 is knocked out in neuroblasts (25). In these transgenic animals, cerebral cells affected by DNA hypomethylation were lost within the first 3 wk of life, and global DNA methylation normalized relative to the wild-type animals. Our postnatal findings that global methylation was similar between d21 Con and IUGR pups also suggest a loss of postnatal hypomethylated cells. A notable difference between the transgenic study and the present study is that we assessed CpG island methylation and found that CpG hypomethylation persisted in the female IUGR rats at d21. These latter data support the concept that separate mechanisms regulate global DNA methylation and CpG methylation (45). Interestingly, adult mice with decreased levels of DNMT1 expression resist mild to moderate cerebral ischemia (22, 23). These findings raise the intriguing possibility that the decrease in fetal DNMT1 expression in the IUGR brain may be a protective response to minimize Physiol Genomics • VOL

25 •

the impact of uteroplacental insufficiency on the central nervous system. The decreased levels of MeCP2 within the IUGR brain may also contribute to cerebral DNA hypomethylation. MeCP2 is required to maintain CpG status of genomic DNA (44, 61). As a result, the appearance of decreased MeCP2 in the hippocampus of the IUGR brain is consistent with the notion that DNA from this region is relatively hypomethylated. This notion is further supported by the finding of decreased HDAC1 protein in the IUGR fetal hippocampus because DNA hypomethylation associates with histone hyperacetylation, which occurs if HDAC activity is reduced. We focused on HDAC1 because it complexes with DNMT1 and in vitro studies demonstrate that hypoxia decreases HDAC1 protein levels (30, 38). Other investigators have found that multiple stimuli affect hippocampal neuronal histone acetylation. Levenson et al. (60) found that activation of N-methyl-D-aspartate receptors increased hippocampal H3 acetylation, although their studies did not identify the lysines that were specifically affected. Crosio et al. (15) demonstrated that kainic acid (a www.physiolgenomics.org


23

Fig. 5. Transmission electron micrographs of nuclei of hippocampal neurons in the brain of rat pups that were in the IUGR group (A and B) or the sham control group (C and D). Two nuclei are shown per group. Nuclei of neurons in the IUGR group appear smaller and have more electron density (condensed chromatin) than nuclei of neurons in the sham control group. All panels are at the same magnification.

glutamate receptor agonist) increased H3/K14 acetylation. We found increased acetylation of both H3/K9 and H3/K14 in the d0 IUGR and d21 female hippocampus and white matter, respectively. Several studies provide insight into the meaning of these findings. In yeast, different cellular stresses induced specific histone acetylation patterns that led to expression of genes from similar functional classes (46). This referenced study found that acetylation of H3/K9 associated with intergenic regions of expressed genes and acetylation of H3/K9 and H3/K14 associated with open reading frames of expressed genes (46). Similarly, a large-scale study of histone modification patterns in human and mouse cells for chromosomes 21 and 22 found that 58% of the acetylated H3/K9 and H3/14 sites coincided within 1 kb of the transcription start of a known gene (5). These studies identify histone acetylation as a mechanism through which uteroplacental insufficiency affects chromatin structure near transcription start sites. Our findings of altered H3/K14 and H3/K9 acetylation in white matter and hippocampus, respectively, are consistent with these regions being vulnerable to perinatal insults. In rats, uteroplacental insufficiency decreases hippocampal weight and Table 2. Size of hippocampal nuclei

Nuclear Nuclear Nuclear Nuclear

area, ␮m perimeter, ␮m maximum diameter, ␮m minimum diameter, ␮m 2

Control

IUGR

P-Value

37.0⫾1.9 22.0⫾0.6 7.5⫾0.2 6.1⫾0.1

28.0⫾1.2 19.2⫾0.4 6.6⫾0.9 5.3⫾0.2

0.0083 0.0070 0.0077 0.016

Values are means ⫾ SD for n ⫽ 4 litters. IUGR, intrauterine growth retardation.


25 •

neurogenesis as well as decreasing gliogenesis in the white matter of the cerebellum (11). In humans, placental abnormalities such as infarction and intrauterine hypoxia have been associated with white matter injury (8, 31). Furthermore, voxel-based morphometry has been used to demonstrate that perinatal asphyxia is also associated with hippocampal atrophy in “healthy adolescents” (67). The vulnerability of the hippocampus to injury is particularly interesting in light of its function and the adult morbidities associated with IUGR. The function of the hippocampus is to “sense” soluble molecules in the blood to perform feedback control, and evidence exists that the hippocampus modulates body physiology, including the hypothalamus-pituitary-adrenal (HPA) axis (26, 39, 59). A major morbidity of IUGR is the neuroreprogramming of the HPA axis. Fernald and GranthamMcGregor (27) found that IUGR in school-aged Jamaican children altered their stress response to psychological and physiological stimuli. Similarly, Cianfarani et al. (13) demonstrated that the neuroendocrine response is permanently altered is some IUGR children, which may affect their catch-up growth. Of particular interest in the latter study, IUGR children who did not catch up were characterized by increased serum levels of cortisol. Little is known about how sex influences the cerebral epigenetics and subsequent gene expression response to the IUGR insult, although animal studies focusing on other tissues provide some insight. Studies utilizing rats rendered IUGR through uteroplacental insufficiency demonstrate sexspecific differences in growth, serum triglycerides, and gene expression (37, 52, 54). In liver, IUGR rats of both sexes showed decreased liver expression of CPTI at d21, but only the male IUGR rats showed decreased expression of CPTI at www.physiolgenomics.org

24


Fig. 6. A: quantification of real-time RT-PCR and Western blots of DNA methyltransferase 1 (DNMT1) species, as well as representative Western blots from d0 control and IUGR brain. Representative immunohistochemistry of DNMT1 (brown staining) is on right. B: quantification of real-time RT-PCR and Western blots of methyl-CpG binding protein 2 (MeCP2) as well as representative Western blots from d0 control and IUGR brain. Representative immunohistochemistry of MeCP2 (brown staining) from the hippocampal region of a d0 control brain is on right. C: quantification of real-time RT-PCR and Western blots of histone deacetylase (HDAC)1 and HDAC activity, as well as representative Western blots from d0 control and IUGR brain. Representative immunohistochemistry of HDAC1 (brown staining) from the hippocampal region of a d0 IUGR brain is on right. For A–C, protein was quantified with NIH Image software. Results are expressed as mean ⫾ SE % relative to sham-operated controls (n ⫽ 6 litters). *P ⬍ 0.05, **P ⬍ 0.01.

day 120 of postnatal life relative to the controls (52). Furthermore, at d21, the livers of male IUGR rats are characterized by a relative H3 hyperacetylation, whereas the livers of female IUGR rats are characterized by a relative H3 hypoacetylation. We speculate that these differences between tissues explain, at least in part, why the general IUGR phenotype is grossly Physiol Genomics • VOL

25 •

similar between the sexes but many specific characteristics appear to differ. To identify a possible cellular trigger of the IUGR cerebral epigenetic response, we measured cerebral zinc levels. Zinc deficiency is associated with IUGR, and zinc is a cofactor for DNMT1 and HDAC1 (4, 26, 41, 68, 69, 74, 99, 100). Furtherwww.physiolgenomics.org

25


more, zinc deficiency markedly alters histone solubility compared with other ion deficiencies (24, 70). In our model, IUGR significantly increased cerebral zinc levels, which is likely caused by the rise in metallothionein levels that other investigators have observed in rodent brains stressed by ischemia (93, 101, 106). We also measured cerebral levels of the important trace elements iron and copper. Considering the association between IUGR and neurodevelopmental delay, our findings of decreased cerebral iron in the IUGR brain are relevant because of the link between decreased hippocampal iron and function in infants of diabetic mothers (75, 80, 87). Unfortunately, little is known about the effects of IUGR on cerebral iron concentrations. Georgieff et al. (34) suggest that live born infants who suffer from restricted maternal-fetal blood flow may be at significant risk for postnatal iron deficiency in multiple tissues, including brain. Moreover, a study from this group found that fetal iron deficiency increased the vulnerability of the rat hippocampus to hypoxic ischemic insult (84). To investigate another possible cellular mechanism through which uteroplacental insufficiency alters epigenetic determinants of chromatin structure, we measured cerebral levels of metabolites involved in one-carbon metabolism. The most relevant of these metabolites are SAH and SAM, which play a role in the regulation of genome-wide DNA methylation (86). In liver, IUGR significantly increases SAH, a response previously demonstrated to be associated with DNA hypomethylation (9, 66). The subsequent failure of IUGR to affect cerebral SAH levels in association with DNA hypomethylation highlights the tissue-specific nature of the IUGR response. This tissue-specific response is not surprising in light of previous work that demonstrated that folate/methyl donor deficiency causes DNA hypomethylation and decreased DNMT activity in liver but not in other tissues (83). Interestingly, although cerebral SAH levels were not affected, uteroplacental insufficiency did increase cerebral cysteine, cysteinylglycine, and adenosine levels, all by-products of one-carbon metabolism. Cysteine is the rate-limiting precursor for glutathione synthesis (6). Astrocytes provide cysteine to neurons by releasing cysteinylglycine (105). Adenosine is Table 3. One-carbon metabolite and trace mineral levels in control and IUGR d0 brain Control

IUGR

Trace mineral levels, ppm/g tissue Zinc 43.0⫾2.2 45.9⫾1.7 Iron 134⫾14 115⫾9.3 Copper 2.9⫾0.4 3.2⫾0.2 One-carbon metabolites, nmol/mg protein SAH 11⫾0.003 0.10⫾0.006 SAM 0.50⫾0.03 0.47⫾0.02 Adenosine 2.96⫾0.22 5.50⫾0.21 Glutathione 13.81⫾0.68 11.87⫾0.81 Cysteinylglycine 1.52⫾0.14 2.87⫾0.16 Cysteine 2.52⫾0.12 3.20⫾0.16 Homocysteine 1.11⫾0.09 1.38⫾0.17 Methionine 4.96⫾0.25 6.11⫾0.55

P-Value

0.01 0.05 0.18 0.11 0.51 0.001 0.092 0.001 0.006 0.191 0.08

Values are means ⫾ SE for a minimum of 6 litters. SAH, S-adenosylhomocystine; SAM, S-adenosylmethionine; d0, day of life 0.


25 •

Table 4. d21 rat breast milk composition Component

Con

IUGR

P-Value

kcal/dl Protein, g/dl Fat, g/dl Zn, ␮g/dl Fe, ␮g/dl Na, meq/l

135.9⫾16.5 10.6⫾0.2 7.3⫾1.1 286⫾8.4 26.5⫾7.1 31.2⫾3.0

116.1⫾18 10.5⫾0.09 6.1⫾1.3 278⫾16.8 36.5⫾5.3 27.8⫾2.5

0.16 0.80 0.21 0.46 0.027 0.19

Values are means ⫾ SE for n ⫽ 8 litters. d21, Day of life 21.

released from cells under oxidative stress and acts as a neuroprotectant in the rodent hippocampus by attenuating the cellular consequences of reactive oxygen species (1, 85). As a result, the increased levels of all three metabolites (cysteine, cysteinylglycine, adenosine) may reflect an attempt by the IUGR fetus to protect the brain from oxidative stress. Early postnatal nutrition is important, and the d21 cerebral epigenetic response may also reflect differences in postnatal nutrition, which is why we characterized breast milk from Con and IUGR dams after 21 days of supporting their respective pups. No significant differences in calories, protein, fat, or zinc were noted between the two groups, although differences may have existed earlier. Furthermore, other components of the breast milk not assessed in this study may have contributed to the differences at d21 between the epigenetic characteristics of the Con and IUGR rat brains. The differences in iron content between Con and IUGR dam breast milk are intriguing, because iron content is independent of maternal mineral status and decreased iron levels characterize the IUGR brain (17). We chose not to cross-foster, because this rarely occurs in the human situation and is unlikely to be recommended in the future because of infection issues. Despite our best efforts, this latter point emphasizes that caution is always necessary when attempting to apply data from a rat model to human pathophysiology. The fetal and juvenile rat is physiologically immature relative to the human, and the insult imposed on the fetal rat in this model of uteroplacental insufficiency is severe. In contrast, the impact of uteroplacental insufficiency experienced by humans ranges across a continuum. In summary, uteroplacental insufficiency and subsequent IUGR affect epigenetic determinants of chromatin structure in regions of the fetal brain that are known to be vulnerable to perinatal insults such as hypoxia or ischemia. The effects are both sex- and tissue specific. We speculate that changes in epigenetic determinants of chromatin structure alter gene expression in the IUGR rat hippocampus and subsequently trigger the neuroendocrine reprogramming that complicates the IUGR phenotype. ACKNOWLEDGMENTS We thank Nancy Chandler (staff member of the Health Sciences Center Research Microscopy Facility at the University of Utah) for technical assistance with transmission electron microscopy. We also thank Dr. Bo Lonnerdal for guidance and expertise in the studies involving zinc, iron, and copper.


26


GRANTS This research was supported by National Institutes of Health Grants HD-41075 (R. H. Lane) and HL-62875 (K. H. Albertine), Children’s Health Research Center, and the March of Dimes (R. H. Lane). REFERENCES 1. Almeida CG, de Mendonca A, Cunha RA, and Ribeiro JA. Adenosine promotes neuronal recovery from reactive oxygen species induced lesion in rat hippocampal slices. Neurosci Lett 339: 127–130, 2003. 2. American Physiological Society. Guiding principles for research involving animals and human beings. Am J Physiol Regul Integr Comp Physiol 283: R281–R283, 2002. 3. Barker DJ, Hales CN, Fall CH, Osmond C, Phipps K, and Clark PM. Type 2 (non-insulin-dependent) diabetes mellitus, hypertension and hyperlipidaemia (syndrome X): relation to reduced fetal growth. Diabetologia 36: 62– 67, 1993. 4. Berg JM and Shi Y. The galvanization of biology: a growing appreciation for the roles of zinc. Science 271: 1081–1085, 1996. 5. Bernstein BE, Kamal M, Lindblad-Toh K, Bekiranov S, Bailey DK, Huebert DJ, McMahon S, Karlsson EK, Kulbokas EJ 3d, Gingeras TR, Schreiber SL, and Lander ES. Genomic maps and comparative analysis of histone modifications in human and mouse. Cell 120: 169 – 181, 2005. 6. Beutler E. Nutritional and metabolic aspects of glutathione. Annu Rev Nutr 9: 287–302, 1989. 7. Bolender RP, Hyde DM, and Dehoff RT. Lung morphometry: a new generation of tools and experiments for organ, tissue, cell, and molecular biology. Am J Physiol Lung Cell Mol Physiol 265: L521–L548, 1993. 8. Burke CJ, Tannenberg AE, and Payton DJ. Ischaemic cerebral injury, intrauterine growth retardation, and placental infarction. Dev Med Child Neurol 39: 726 –730, 1997. 9. Caudill MA, Wang JC, Melnyk S, Pogribny IP, Jernigan S, Collins MD, Santos-Guzman J, Swendseid ME, Cogger EA, and James SJ. Intracellular S-adenosylhomocysteine concentrations predict global DNA hypomethylation in tissues of methyl-deficient cystathionine ␤-synthase heterozygous mice. J Nutr 131: 2811–2818, 2001. 10. Chan MM, Nohara M, Chan BR, Curtis J, and Chan GM. Lecithin decreases human milk fat loss during enteral pumping. J Pediatr Gastroenterol Nutr 36: 613– 615, 2003. 11. Chanez C, Privat A, Flexor MA, and Drian MJ. Effect of intrauterine growth retardation on developmental changes in DNA and [14C]thymidine metabolism in different regions of rat brain: histological and biochemical correlations. Brain Res 353: 283–292, 1985. 12. Cheutin T, McNairn AJ, Jenuwein T, Gilbert DM, Singh PB, and Misteli T. Maintenance of stable heterochromatin domains by dynamic HP1 binding. Science 299: 721–725, 2003. 13. Cianfarani S, Geremia C, Scott CD, and Germani D. Growth, IGF system, and cortisol in children with intrauterine growth retardation: is catch-up growth affected by reprogramming of the hypothalamic-pituitary-adrenal axis? Pediatr Res 51: 94 –99, 2002. 14. Clegg MS, Keen CL, Lonnerdal B, and Hurley LS. Influence of ashing techniques on the concentrations of trace elements in animal tissues. Biol Trace Elem Res 3: 107–115, 1981. 15. Crosio C, Heitz E, Allis CD, Borrelli E, and Sassone-Corsi P. Chromatin remodeling and neuronal response: multiple signaling pathways induce specific histone H3 modifications and early gene expression in hippocampal neurons. J Cell Sci 116: 4905– 4914, 2003. 16. D’Mello SR, Galli C, Ciotti T, and Calissano P. Induction of apoptosis in cerebellar granule neurons by low potassium: inhibition of death by insulin-like growth factor I and cAMP. Proc Natl Acad Sci USA 90: 10989 –10993, 1993. 17. Domellof M, Lonnerdal B, Dewey KG, Cohen RJ, and Hernell O. Iron, zinc, and copper concentrations in breast milk are independent of maternal mineral status. Am J Clin Nutr 79: 111–115, 2004. 18. Economides DL and Nicolaides KH. Blood glucose and oxygen tension levels in small-for-gestational-age fetuses. Am J Obstet Gynecol 160: 385–389, 1989. 19. Economides DL, Nicolaides KH, Gahl WA, Bernardini I, Bottoms S, and Evans M. Cordocentesis in the diagnosis of intrauterine starvation. Am J Obstet Gynecol 161: 1004 –1008, 1989.


25 •

20. Economides DL, Nicolaides KH, Gahl WA, Bernardini I, and Evans MI. Plasma amino acids in appropriate- and small-for-gestational-age fetuses. Am J Obstet Gynecol 161: 1219 –1227, 1989. 21. Economides DL, Proudler A, and Nicolaides KH. Plasma insulin in appropriate- and small-for-gestational-age fetuses. Am J Obstet Gynecol 160: 1091–1094, 1989. 22. Endres M, Fan G, Meisel A, Dirnagl U, and Jaenisch R. Effects of cerebral ischemia in mice lacking DNA methyltransferase 1 in postmitotic neurons. Neuroreport 12: 3763–3766, 2001. 23. Endres M, Meisel A, Biniszkiewicz D, Namura S, Prass K, Ruscher K, Lipski A, Jaenisch R, Moskowitz MA, and Dirnagl U. DNA methyltransferase contributes to delayed ischemic brain injury. J Neurosci 20: 3175–3181, 2000. 24. Falchuk KH, Gordon PR, Stankiewicz A, Hilt KL, and Vallee BL. Euglena gracilis chromatin: comparison of effects of zinc, iron, magnesium, or manganese deficiency and cold shock. Biochemistry 25: 5388 – 5391, 1986. 25. Fan G, Beard C, Chen RZ, Csankovszki G, Sun Y, Siniaia M, Biniszkiewicz D, Bates B, Lee PP, Kuhn R, Trumpp A, Poon C, Wilson CB, and Jaenisch R. DNA hypomethylation perturbs the function and survival of CNS neurons in postnatal animals. J Neurosci 21: 788 –797, 2001. 26. Fatemi M, Hermann A, Pradhan S, and Jeltsch A. The activity of the murine DNA methyltransferase Dnmt1 is controlled by interaction of the catalytic domain with the N-terminal part of the enzyme leading to an allosteric activation of the enzyme after binding to methylated DNA. J Mol Biol 309: 1189 –1199, 2001. 27. Fernald LC and Grantham-McGregor SM. Growth retardation is associated with changes in the stress response system and behavior in school-aged Jamaican children. J Nutr 132: 3674 –3679, 2002. 28. Flanagan DE, Moore VM, Godsland IF, Cockington RA, Robinson JS, and Phillips DI. Fetal growth and the physiological control of glucose tolerance in adults: a minimal model analysis. Am J Physiol Endocrinol Metab 278: E700 –E706, 2000. 29. Fu Q, McKnight RA, Yu X, Wang L, Callaway CW, and Lane RH. Uteroplacental insufficiency induces site-specific changes in histone H3 covalent modifications and affects DNA-histone H3 positioning in day 0 IUGR rat liver. Physiol Genomics 20: 108 –116, 2004. 30. Fuks F, Burgers WA, Brehm A, Hughes-Davies L, and Kouzarides T. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet 24: 88 –91, 2000. 31. Gaffney G, Squier MV, Johnson A, Flavell V, and Sellers S. Clinical associations of prenatal ischaemic white matter injury. Arch Dis Child Fetal Neonatal Ed 70: F101–F106, 1994. 32. Gagnon R. Placental insufficiency and its consequences. Eur J Obstet Gynecol Reprod Biol 110, Suppl 1: S99 –S107, 2003. 33. Galasinski SC, Louie DF, Gloor KK, Resing KA, and Ahn NG. Global regulation of post-translational modifications on core histones. J Biol Chem 277: 2579 –2588, 2002. 34. Georgieff MK, Petry CD, Wobken JD, and Oyer CE. Liver and brain iron deficiency in newborn infants with bilateral renal agenesis (Potter’s syndrome). Pediatr Pathol Lab Med 16: 509 –519, 1996. 35. Hay WW Jr, Catz CS, Grave GD, and Yaffe SJ. Workshop summary: fetal growth: its regulation and disorders. Pediatrics 99: 585–591, 1997. 36. Holst K, Andersen E, Philip J, and Henningsen I. Antenatal and perinatal conditions correlated to handicap among 4-year-old children. Am J Perinatol 6: 258 –267, 1989. 37. Houdijk EC, Engelbregt MJ, Popp-Snijders C, and Delemarre-Vd Waal HA. Endocrine regulation and extended follow up of longitudinal growth in intrauterine growth-retarded rats. J Endocrinol 166: 599 – 608, 2000. 38. Huang H, Zhang Z, Xu Y, and Shao J. Expression of p53, p21 in human lung adenocarcinoma A549 cell strains under hypoxia conditions and the effect of TSA on their expression. J Huazhong Univ Sci Technolog Med Sci 23: 359 –361, 2003. 39. Ishihara SL and Morohashi K. A boundary for histone acetylation allows distinct expression patterns of the Ad4BP/SF-1 and GCNF loci in adrenal cortex cells. Biochem Biophys Res Commun 329: 554 –562, 2005. 40. Jones PL and Wolffe AP. Relationships between chromatin organization and DNA methylation in determining gene expression. Semin Cancer Biol 9: 339 –347, 1999. 41. Kambe T, Yamaguchi-Iwai Y, Sasaki R, and Nagao M. Overview of mammalian zinc transporters. Cell Mol Life Sci 61: 49 – 68, 2004.


EPIGENETIC MODIFICATIONS IN IUGR BRAINS 42. Ke X, McKnight RA, Wang ZM, Yu X, Wang L, Callaway CW, Albertine KH, and Lane RH. Nonresponsiveness of the cerebral p53MDM2 functional circuit in newborn rat pups rendered IUGR via uteroplacental insufficiency. Am J Physiol Regul Integr Comp Physiol 288: R1038 –R1045, 2005. 43. Kelleher SL and Lonnerdal B. Long-term marginal intakes of zinc and retinol affect retinol homeostasis without compromising circulating levels during lactation in rats. J Nutr 131: 3237–3242, 2001. 44. Kimura H and Shiota K. Methyl-CpG-binding protein, MeCP2, is a target molecule for maintenance DNA methyltransferase, Dnmt1. J Biol Chem 278: 4806 – 4812, 2003. 45. Kress C, Thomassin H, and Grange T. Local DNA demethylation in vertebrates: how could it be performed and targeted? FEBS Lett 494: 135–140, 2001. 46. Kurdistani SK, Tavazoie S, and Grunstein M. Mapping global histone acetylation patterns to gene expression. Cell 117: 721–733, 2004. 47. Lane RH, Chandorkar AK, Flozak AS, and Simmons RA. Intrauterine growth retardation alters mitochondrial gene expression and function in fetal and juvenile rat skeletal muscle. Pediatr Res 43: 563–570, 1998. 48. Lane RH, Crawford SE, Flozak AS, and Simmons RA. Localization and quantification of glucose transporters in liver of growth-retarded fetal and neonatal rats. Am J Physiol Endocrinol Metab 276: E135–E142, 1999. 49. Lane RH, Dvorak B, MacLennan NK, Dvorakova K, Halpern MD, Pham TD, and Philipps AF. IGF alters jejunal glucose transporter expression and serum glucose levels in immature rats. Am J Physiol Regul Integr Comp Physiol 283: R1450 –R1460, 2002. 50. Lane RH, Flozak AS, Ogata ES, Bell GI, and Simmons RA. Altered hepatic gene expression of enzymes involved in energy metabolism in the growth-retarded fetal rat. Pediatr Res 39: 390 –394, 1996. 51. Lane RH, Flozak AS, and Simmons RA. Measurement of GLUT mRNA in liver of fetal and neonatal rats using a novel method of quantitative polymerase chain reaction. Biochem Mol Med 59: 192–199, 1996. 52. Lane RH, Kelley DE, Gruetzmacher EM, and Devaskar SU. Uteroplacental insufficiency alters hepatic fatty acid-metabolizing enzymes in juvenile and adult rats. Am J Physiol Regul Integr Comp Physiol 280: R183–R190, 2001. 53. Lane RH, Kelley DE, Ritov VH, Tsirka AE, and Gruetzmacher EM. Altered expression and function of mitochondrial ␤-oxidation enzymes in juvenile intrauterine-growth-retarded rat skeletal muscle. Pediatr Res 50: 83–90, 2001. 54. Lane RH, Maclennan NK, Daood MJ, Hsu JL, Janke SM, Pham TD, Puri AR, and Watchko JF. IUGR alters postnatal rat skeletal muscle peroxisome proliferator-activated receptor-␥ coactivator-1 gene expression in a fiber specific manner. Pediatr Res 53: 994 –1000, 2003. 55. Lane RH, MacLennan NK, Hsu JL, Janke SM, and Pham TD. Increased hepatic peroxisome proliferator-activated receptor-␥ coactivator-1 gene expression in a rat model of intrauterine growth retardation and subsequent insulin resistance. Endocrinology 143: 2486 –2490, 2002. 56. Lane RH, Maclennan NK, Shi T, Fang CT, Chiu CT, and Horvath S. IUGR affects postnatal hepatic gene expression of enzymes involved in sterol synthesis in 21-day-old rats (Abstract). Pediatr Res 53: 852, 2003. 57. Lane RH, Ramirez RJ, Tsirka AE, Kloesz JL, McLaughlin MK, Gruetzmacher EM, and Devaskar SU. Uteroplacental insufficiency lowers the threshold towards hypoxia-induced cerebral apoptosis in growth-retarded fetal rats. Brain Res 895: 186 –193, 2001. 58. Lane RH, Tsirka AE, and Gruetzmacher EM. Uteroplacental insufficiency alters cerebral mitochondrial gene expression and DNA in fetal and juvenile rats. Pediatr Res 47: 792–797, 2000. 59. Lathe R. Hormones and the hippocampus. J Endocrinol 169: 205–231, 2001. 60. Levenson JM, O’Riordan KJ, Brown KD, Trinh MA, Molfese DL, and Sweatt JD. Regulation of histone acetylation during memory formation in the hippocampus. J Biol Chem 279: 40545– 40559, 2004. 61. Lewis JD, Meehan RR, Henzel WJ, Maurer-Fogy I, Jeppesen P, Klein F, and Bird A. Purification, sequence, and cellular localization of a novel chromosomal protein that binds to methylated DNA. Cell 69: 905–914, 1992. 62. Li E, Bestor TH, and Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 69: 915–926, 1992.


25 •

27

63. Liu L, Wylie RC, Andrews LG, and Tollefsbol TO. Aging, cancer and nutrition: the DNA methylation connection. Mech Ageing Dev 124: 989 –998, 2003. 64. Lonnerdal B, Woodhouse LR, and Glazier C. Compartmentalization and quantitation of protein in human milk. J Nutr 117: 1385–1395, 1987. 65. Low JA, Handley-Derry MH, Burke SO, Peters RD, Pater EA, Killen HL, and Derrick EJ. Association of intrauterine fetal growth retardation and learning deficits at age 9 to 11 years. Am J Obstet Gynecol 167: 1499 –1505, 1992. 66. MacLennan NK, James SJ, Melnyk S, Piroozi A, Jernigan S, Hsu JL, Janke SM, Pham TD, and Lane RH. Uteroplacental insufficiency alters DNA methylation, one-carbon metabolism, and histone acetylation in IUGR rats. Physiol Genomics 18: 43–50, 2004. 67. Maneru C, Serra-Grabulosa JM, Junque C, Salgado-Pineda P, Bargallo N, Olondo M, Botet-Mussons F, Tallada M, and Mercader JM. Residual hippocampal atrophy in asphyxiated term neonates. J Neuroimaging 13: 68 –74, 2003. 68. Marks PA, Richon VM, Breslow R, and Rifkind RA. Histone deacetylase inhibitors as new cancer drugs. Curr Opin Oncol 13: 477– 483, 2001. 69. Marks PA, Richon VM, and Rifkind RA. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst 92: 1210 –1216, 2000. 70. Mazus B, Falchuk KH, and Vallee BL. Histone formation, gene expression, and zinc deficiency in Euglena gracilis. Biochemistry 23: 42– 47, 1984. 71. McNairn AJ and Gilbert DM. Epigenomic replication: linking epigenetics to DNA replication. Bioessays 25: 647– 656, 2003. 72. Melnyk S, Pogribna M, Pogribna I, Hine RJ, and James SJ. A new HPLC method for the simultaneous determination of oxidized and reduced plasma aminothiols using coulometric electrochemical detection. J Nutr Biochem 10: 490 – 497, 1999. 73. Melnyk S, Pogribna M, Pogribny IP, Yi P, and James SJ. Measurement of plasma and intracellular S-adenosylmethionine and S-adenosylhomocysteine utilizing coulometric electrochemical detection: alterations with plasma homocysteine and pyridoxal 5⬘-phosphate concentrations. Clin Chem 46: 265–272, 2000. 74. Neggers YH, Cutter GR, Alvarez JO, Goldenberg RL, Acton R, Go RC, and Roseman JM. The relationship between maternal serum zinc levels during pregnancy and birthweight. Early Hum Dev 25: 75– 85, 1991. 75. Nelson CA, Wewerka S, Thomas KM, Tribby-Walbridge S, deRegnier R, and Georgieff M. Neurocognitive sequelae of infants of diabetic mothers. Behav Neurosci 114: 950 –956, 2000. 76. Ng HH and Bird A. DNA methylation and chromatin modification. Curr Opin Genet Dev 9: 158 –163, 1999. 77. Ogata ES, Bussey ME, and Finley S. Altered gas exchange, limited glucose and branched chain amino acids, and hypoinsulinism retard fetal growth in the rat. Metabolism 35: 970 –977, 1986. 78. Ogata ES, Bussey ME, LaBarbera A, and Finley S. Altered growth, hypoglycemia, hypoalaninemia, and ketonemia in the young rat: postnatal consequences of intrauterine growth retardation. Pediatr Res 19: 32–37, 1985. 79. Ogata ES, Swanson SL, Collins JW Jr, and Finley SL. Intrauterine growth retardation: altered hepatic energy and redox states in the fetal rat. Pediatr Res 27: 56 – 63, 1990. 80. Petry CD, Eaton MA, Wobken JD, Mills MM, Johnson DE, and Georgieff MK. Iron deficiency of liver, heart, and brain in newborn infants of diabetic mothers. J Pediatr 121: 109 –114, 1992. 81. Pham TD, MacLennan NK, Chiu CT, Laksana GS, Hsu JL, and Lane RH. Uteroplacental insufficiency increases apoptosis and alters p53 gene methylation in the full-term IUGR rat kidney. Am J Physiol Regul Integr Comp Physiol 285: R962–R970, 2003. 82. Pogribny I, Yi P, and James SJ. A sensitive new method for rapid detection of abnormal methylation patterns in global DNA and within CpG islands. Biochem Biophys Res Commun 262: 624 – 628, 1999. 83. Pogribny IP, James SJ, Jernigan S, and Pogribna M. Genomic hypomethylation is specific for preneoplastic liver in folate/methyl deficient rats and does not occur in non-target tissues. Mutat Res 548: 53–59, 2004. 84. Rao R, de Ungria M, Sullivan D, Wu P, Wobken JD, Nelson CA, and Georgieff MK. Perinatal brain iron deficiency increases the vulnerability of rat hippocampus to hypoxic ischemic insult. J Nutr 129: 199 –206, 1999.


28


85. Saransaari P and Oja SS. Enhanced release of adenosine under celldamaging conditions in the developing and adult mouse hippocampus. Neurochem Res 28: 1409 –1417, 2003. 86. Sibani S, Melnyk S, Pogribny IP, Wang W, Hiou-Tim F, Deng L, Trasler J, James SJ, and Rozen R. Studies of methionine cycle intermediates (SAM, SAH), DNA methylation and the impact of folate deficiency on tumor numbers in Min mice. Carcinogenesis 23: 61– 65, 2002. 87. Siddappa AM, Georgieff MK, Wewerka S, Worwa C, Nelson CA, and Deregnier RA. Iron deficiency alters auditory recognition memory in newborn infants of diabetic mothers. Pediatr Res 55: 1034 –1041, 2004. 88. Simmons RA, Templeton LJ, and Gertz SJ. Intrauterine growth retardation leads to the development of type 2 diabetes in the rat. Diabetes 50: 2279 –2286, 2001. 89. Spinillo A, Capuzzo E, Egbe TO, Fazzi E, Colonna L, and Nicola S. Pregnancies complicated by idiopathic intrauterine growth retardation. Severity of growth failure, neonatal morbidity and two-year infant neurodevelopmental outcome. J Reprod Med 40: 209 –215, 1995. 90. Storm-Mathisen J and Ottersen OP. Immunocytochemistry of glutamate at the synaptic level. J Histochem Cytochem 38: 1733–1743, 1990. 91. Szathmari M, Vasarhelyi B, and Tulassay T. Effect of low birth weight on adrenal steroids and carbohydrate metabolism in early adulthood. Horm Res 55: 172–178, 2001. 92. Thomas MR, Chan GM, and Book LS. Comparison of macronutrient concentration of preterm human milk between two milk expression techniques and two techniques for quantitation of energy. J Pediatr Gastroenterol Nutr 5: 597– 601, 1986. 93. Trendelenburg G, Prass K, Priller J, Kapinya K, Polley A, Muselmann C, Ruscher K, Kannbley U, Schmitt AO, Castell S, Wiegand F, Meisel A, Rosenthal A, and Dirnagl U. Serial analysis of gene expression identifies metallothionein-II as major neuroprotective gene in mouse focal cerebral ischemia. J Neurosci 22: 5879 –5888, 2002. 94. Tsirka AE, Gruetzmacher EM, Kelley DE, Ritov VH, Devaskar SU, and Lane RH. Myocardial gene expression of glucose transporter 1 and glucose transporter 4 in response to uteroplacental insufficiency in the rat. J Endocrinol 169: 373–380, 2001. 95. Turner BM. Cellular memory and the histone code. Cell 111: 285–291, 2002.


25 •

96. Unterman T, Lascon R, Gotway MB, Oehler D, Gounis A, Simmons RA, and Ogata ES. Circulating levels of insulin-like growth factor binding protein-1 (IGFBP-1) and hepatic mRNA are increased in the small for gestational age (SGA) fetal rat. Endocrinology 127: 2035–2037, 1990. 97. Unterman TG, Simmons RA, Glick RP, and Ogata ES. Circulating levels of insulin, insulin-like growth factor-I (IGF-I), IGF-II, and IGFbinding proteins in the small for gestational age fetal rat. Endocrinology 132: 327–336, 1993. 98. Urnov FD. Methylation and the genome: the power of a small amendment. J Nutr 132: 2450S–2456S, 2002. 99. Vallee BL and Auld DS. Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochemistry 29: 5647–5659, 1990. 100. Vallee BL and Falchuk KH. The biochemical basis of zinc physiology. Physiol Rev 73: 79 –118, 1993. 101. Van Lookeren Campagne M, Thibodeaux H, van Bruggen N, Cairns B, Gerlai R, Palmer JT, Williams SP, and Lowe DG. Evidence for a protective role of metallothionein-1 in focal cerebral ischemia. Proc Natl Acad Sci USA 96: 12870 –12875, 1999. 102. Villar J, de Onis M, Kestler E, Bolanos F, Cerezo R, and Bernedes H. The differential neonatal morbidity of the intrauterine growth retardation syndrome. Am J Obstet Gynecol 163: 151–157, 1990. 103. Vossbeck S, de Camargo OK, Grab D, Bode H, and Pohlandt F. Neonatal and neurodevelopmental outcome in infants born before 30 wk of gestation with absent or reversed end-diastolic flow velocities in the umbilical artery. Eur J Pediatr 160: 128 –134, 2001. 104. Walther FJ. Growth and development of term disproportionate smallfor-gestational age infants at the age of 7 years. Early Hum Dev 18: 1–11, 1988. 105. Wang XF and Cynader MS. Astrocytes provide cysteine to neurons by releasing glutathione. J Neurochem 74: 1434 –1442, 2000. 106. Yanagitani S, Miyazaki H, Nakahashi Y, Kuno K, Ueno Y, Matsushita M, Naitoh Y, Taketani S, and Inoue K. Ischemia induces metallothionein III expression in neurons of rat brain. Life Sci 64: 707–715, 1999. 107. Yoder JA, Soman NS, Verdine GL, and Bestor TH. DNA (cytosine5)-methyltransferases in mouse cells and tissues. Studies with a mechanism-based probe. J Mol Biol 270: 385–395, 1997.
