efficiency in extract from K21 mouse mastocytoma cells but is strongly affected in HeLa cell extract, whereas an identical hairpin mutant of the H4-1 gene.
.=) 1993
Oxford University Press
Nucleic Acids Research, 1993, Vol. 21, No. 7 1569-1575
Variable effects of the conserved RNA hairpin element upon 3' end processing of histone pre-mRNA in vitro Adrian Streit, Tom Wittop Koning, Dominique Soldati1 +, Lars Melin§ and Daniel Schumperli* Abteilung fur Entwicklungsbiologie, Zoologisches Institut der Universitat Bern, Baltzerstrasse 4, 3012 Bern and 1lnstitut fur Molekularbiologie 11 der Universitat Zurich, Honggerberg, 8093 Zurich, Switzerland Received January 20, 1993; Revised and Accepted March 2, 1993
ABSTRACT We have studied the requirements for efficient histonespecific RNA 3' processing in nuclear extract from mammalian tissue culture cells. Processing is strongly impaired by mutations in the pre-mRNA spacer element that reduce the base-pairing potential with U7 RNA. Moreover, by exchanging the hairpin and spacer elements of two differently processed H4 genes, we find that this difference is exclusively due to the spacer element. Finally, processing is inhibited by the addition of competitor RNAs, if these contain a wild-type spacer sequence, but not if their spacer element is mutated. Conversely, the importance of the hairpin for histone RNA 3' processing is highly variable: A hairpin mutant of the H4-12 gene is processed with almost wild-type efficiency in extract from K21 mouse mastocytoma cells but is strongly affected in HeLa cell extract, whereas an identical hairpin mutant of the H4-1 gene is affected in both extracts. The hairpin defect of H4-12-specific RNA in HeLa cells can be overcome by a compensatory mutation that increases the base complementarity to U7 snRNA. Very similar results were also obtained in RNA competition experiments: processing of H4-12-specific RNA can be competed by RNA carrying a wild-type hairpin element in extract from HeLa, but not K21 cells, whereas processing of H4-1-specific RNA can be competed in both extracts. With two additional histone genes we obtained results that were in one case intermediate and in the other similar to those obtained with H4-1. These results suggest that hairpin binding factor(s) can cooperatively support the ability of U7 snRNPs to form an active processing complex, but is(are) not directly involved in the processing mechanism. INTRODUCTION The 3' ends of replication-dependent histone mRNAs are formed from longer precursors by a specific RNA cleavage reaction (reviewed in 1). This reaction is one of the levels at which histone *
To whom
gene expression is controlled in response to changes in cell proliferation (2) or during the cell cycle (3). In contrast, the genes for basal or replacement variant histones (which are synthesised constitutively throughout the cell cycle) produce polyadenylated mRNAs and often contain introns (4, 5). Certain histone genes have been described, which can alternatively undergo polyadenylation or histone-specific RNA 3' processing (6, 7). Furthermore, histone RNA processing also plays a certain role in controlling the relative mRNA abundances from the various non-allelic histone genes (8, 9). The signal for the processing reaction resides in a hairpin structure immediately preceding the cleavage site and a purinerich spacer element located a few nucleotides (nt) further downstream (1). In addition, three trans-acting factors have been characterised. The U7 small nuclear ribonucleoprotein (snRNP) plays an active role through complementary base-pairing between the 5' end of U7 RNA and the spacer element of histone premRNA (10). Additional trans-acting components comprise a hairpin binding factor (HBF; 11, 12) and a heat-labile factor (HLF; 13). The HLF is down-regulated in proliferation-arrested cells (2), but its precise function or possible mode of interaction with the pre-mRNA have not been elucidated. Whereas HLF is absolutely indispensible, in vitro processing can apparently occur even when the pre-mRNA is prevented from binding to HBF (12, 14, 15). However, in these studies, mutations of the hairpin sequence or titration of HBF by unprocessable competitor RNAs reduced the efficiency of processing by about 80-90%. Using native gel analysis of complexes formed between the pre-mRNA and factors present in a mouse cell (K21 mastocytoma) nuclear extract, we have recently obtained evidence confirming the importance of U7:pre-mRNA base-pairing but questioning a direct involvement of hairpin interactions in the processing reaction (16). We have therefore undertaken to analyse in more detail the relative importance of the hairpin and spacer elements for the efficiency of histone RNA processing. Our results confirm the necessity of the spacer element, whereas the contribution of the hairpin element to processing efficiency in vitro depends both on the genes and on the extracts used.
correspondence should be addressed
Present addresses: Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305-5402, USA and Institute for Cancer Research, PO Box 60202, 10401 Stockholm, Sweden +
§Ludwig
1570 Nucleic Acids Research, 1993, Vol. 21, No. 7
MATERIALS AND METHODS Templates used for in vitro transcription Double-stranded DNA oligonucleotides corresponding to the hairpin or spacer element of the H4 genes on clones 12 and 53 (17) as well as specific mutants thereof were synthesized with appropriate 5'- and 3'-overhanging ends and cloned in various combinations between the SacI and HindmI sites of pSP65 (see Fig. 1). These plasmids were linearised for transcription with HindH. Templates for short RNAs from the H4 gene on clone mus-hi-1 ('H4 wt', here called 1/1, and 'false pal', here called B/1; see Fig.3 of Ref. 12) were obtained from M.L. Birnstiel and were linearised with PstI. For the construct containing te 3' end of the H3 gene from clone 53 (18), a 213-nt HinPI (codon 11 1)-PstI fragment was cloned between the AccI and PstI sites of pSP65. This plasmid was linearised in the polylinker with HindIl. From the H3 gene of clone 614 (19, 20), a 82-nt HinPI (1 nt downstrem of the stop codon)-DdeI fragment was cloned between the Accd and SnaI sites of pSP64. This plasmid was linearised in the polylinker with EcoRI. All templates were sequenced in their final form (21). transcriptions Templates were linearized by digestion with the appropriate restriction enzyme (see above), successively extracted with phenol, phenol:chloroform (1:1) and chloroform and precipitated with ethanol. I jg of linear template was incubated for 1 hr at 400C in presence of 40 mM Tris-HCI, pH 7.5, 6 mM MgCl2, 13 mM DTT, 2 mM spermidine, 0.1 mg/ml bovine serum albumin, 2.5 mM m7G(5')ppp(5')G (Boehringer Mannheim), 0.1 mM rGTP, 0.5 mM each of rATP, rCTP, rUTP, 25 ytCi a-32P GTP (800 Ci/mmol; New England Nuclear), 40 U RNAsin (Promega or Biofinex, Praroman, Switzerland), and SU SP6 RNApolymerase (Boehringer Mannheim) in a total volume of 10 1. Uncapped transcripts were synthesised by the same protocol omitting m7G(5')ppp(5')G. Capping is not required for processing in these in vitro systems. For unlabelled transcripts used in competition experiments, the protocol for uncapped transcripts was scaled up six-fold (60 ji), except that all nucleoside triphosphates were used at 0.5 mM, and was followed by an incubation with 50 U DNAse I (Boehringer Mannheim) and 40 U RNAsin for 30 min at 370C. Radiolabelled RNA was purified by electrophoresis on 42% urea, 5% polyacrylamide gels (22), excised and eluted in 300 pl of 0.3 M NaCl, 0.1% SDS, 0.1 M EDTA, 10 mM Tris-HCl, pH 7.5 for 2 hrs. Unlabelled RNA was purified by gel filtration on spin columns of Sephadex G-25 (Pharmacia). In both cases, the samples were then extracted twice with phenol and once with chloroform and the RNA was precipitated with ethanol. Unlabelled RNA was quantitated by comparison with standards of E. coli tRNA on agarose gels stained with ethidium bromide.
In vito
In vitro processing Reaction mixtures contained: 30 fmoles of radiolabelled RNA in 25 p1 of 25 mM EDTA, 0.25 mg/ml tRNA; 10i1 buffer D (23; 20 mM HEPES-KOH, pH 7.9, 20% glycerol, 100 mM KCI, 0.2 mM EDTA, 0.5mM DTT); and 5 Al nuclear extract from K21 mouse mastocytoma cells (24; gifts from C.Stauber, U.Albrecht, or R.Mital) or from human HeLa cells (kindly provided by A. Krdmer, Um'versity of Basel). Incubation was at
30°C for 2 hrs. In some cases, unlabelled competitor RNA was added as specified in Results. Reactions were stopped by adding 100 itg proteinase K in 30 yd of 300 mM NaCl, 25 mM EDTA, 200 mM Tris, pH 7.5, 2% SDS and incubating at 37°C for 20 min. After addition of NaCl (250 mM final concentration), the RNA was purified by extraction with phenol:chloroform (1:1) and precipitation with ethanol. The samples were analysed by electrophoresis on 8.3 M urea, 6% polyacrylamide gels (22). For quantitation, the processed and unprocessed RNAs were excised and Cerenkov counts measured in a liquid scintillation counter. Background values were subtracted. The counts were multiplied with a correction factor to compensate for differences in the number of labelled G residues per molecule. Since processing efficiencies (ratios of processed to total RNA) were dependent on the batch of extract used and differed between experiments, they were normalised relative to the efficiency of 12/12 RNA which was analysed in each experiment. 5' and 3' end-labelling of trnscripts For 5' end-labelling, unlabelled, uncapped transcripts were incubated for 1 hour at 37°C with 3 U of alkaline phosphatase from calf intestine (Boehringer, Mannheim) in 50 mM Tris-HCI, pH 8.5, 0.1 mM EDTA and isolated by polyacrylamide gel electrophoresis as described above. To locate the RNA on the gel, an identical universally labeled RNA was run next to the unlabelled reaction. The RNA was then labelled with 600 1tCi -y32P-ATP (3000 Ci/mmol) and 10 U of T4 polynucleotide kinase (Boehringer, Mannheim) according to the suppliers' manual and reisolated by electrophoresis on an acrylanide gel as described. For 3' end-labelling, the gel-purified unlabeled RNAs were ligated to ai32P-pCp with T4 RNA ligase (Phanracia, Sweden; 25). KOH- and adenosine sequence ladders 5' or 3' end-labelled transcripts were incubated for 8 min at 42°C in 20 Al of 0.15 M KOH containing 1 sg/Il tRNA (26). The cleavage reaction was stopped by adding 2 Al of 1 M acetic acid containing phenol red, diluted to 200 A1 with 300 mM sodium acetate, 10 mM MgCl2, and precipitated with ethanol. The adenosine-specific sequencing reaction was performed as described (27).
RESULTS Importance of the hairpin and spacer elements for histone RNA 3' processing in K21 nuclear extract To analyse the relative importance of hairpin and spacer elements upon histone RNA 3' processing, we initially made use of an in vitro system from K21 mouse mastocytoma cells (2, 24). As substrates, we used short RNAs synthesised by SP6 RNA polymerase and encompassing the conserved RNA processing signals of cloned mouse histone genes (Fig.1). The starting construct was derived from the H4 gene on clone 12 (17; hereafter called H4-12 gene) which, in our in vitro system, is the most efficiently processed histone gene analysed (28). The nomenclature used indicates the origin of the sequences preceding and following the processing site, respectively, separated by a virgule (/); thus the starting construct is called 12/12. In mutant B/12, the hairpin was completely altered to a sequence that had already been analysed in the context of the H4 gene on clone
Nucleic Acids Research, 1993, Vol. 21, No. 7 1571 49
A
36
hI -
Common vector sequence (pSP65):
~~~I 5'
I
_
..444
1
B
I
I
3 3'
5' GAAUACACGGAAUUCGAGCU...
1 2 3 4 5 6 7
12/12 CAACAAAAGGCCCUUUUCAGGGCCACCCACAAAUU CCUAGAAGGAGUUGUUCACUUACCGAAGCU 53/53 CAACAAAAGGUCCUUUUCAGGACCACUCACUGAUU CCCUUAAAAAGCUGUGCAUUUUGCUAAGCU 12/53 CAACAAAAGGCCCUUUUCAGGGCCACCCACAAAUU CCCUUAAAAAGCUGUGCAUUUUGCUAAGCU
PAN PAN PAN 2 1 5
53/12 CAACAAAAGGUCCUUUUCAGGACCACUCACUGAUU CCUAGAAGGAGUUGUUCACUUACCGAAGCU 12/Sup CAACAAAAGGCCCUUUUCAGGGCCACCCACAAAUU CCCUAAAAGAGCUGUAACACUUCCGAAGCU 12/Del CAACAAAAGGCCCUUUUCAGGGCCACCCACAAAUU CCUAGAAGG--- UGUUCACUUACCGAAGCU 12/Mut CAACAAAAGGCCCUUUUCAGGGCCACCCACAAAUU CCCUIAAIJIG1ACUUCACUUACCGAAGCU B/12 CAACAAAACCGGAAAGCCUUCCGGACCCACAAAUU CCUAGAAGGAGUUGUUCACUUACCGAAGCU B/Sup CAACAAAACCGGAAAGCCUUCCGGACCCACAAAUU CCCUAAAAGAGCUGUAACACUUCCGAAGCU B/Mut CAACAAAACCGGAAAGCCUUCCGGACCCACAAAUU CCCUUAAUCUGIACUUCACUUACCGAAGCU
Common vector sequence (pSP64): 5' GAAUACAAGCUU...
1/1 B/1
UUCCCUAAGGCCCUUUUUAGGGCCAACCACAGUCUCUUCAGGAGAGCUGACACUGAC UUCCCUAACCGGAAAGCCUUCCGGAACCACAGUCUCUUCAGGAGAGCUGACACUGAC
Figure 1. Structure of pre-mRNAs used. Synthetic oligodeoxynucleotides corresponding to the upstream (stipled bar) and downstream (white bar) parts of the histone RNA processing signal were cloned into pSP65. Black bar, vector sequences at the 5' end of resulting pre-mRNAs. Cleavage (scissors) results in 49 nt upstream and 36 nt downstream fragments. 12, 53, sequences from the H4 genes on clones 12 and 53, respectively (17). Other sequences contain deliberately introduced mutations. For upstream segments, differences in the hairpin with respect to H4-12 are underlined. For downstream segments, complementarities to the first 20 nt of mouse U7 RNA (36) are underlined. Asteriscs indicate seven point mutations in the Mut downstream segment which should prevent any basepairing with U7 snRNA. The center of a four-nucleotide 5' overlap (TTCC) used to join upstream and downstream fragments is indicated by a space. The bottom shows the structures of two processing substrates derived from the H4-1 gene (12). Table 1. Processing efficiencies of wild-type and mutant pre-mRNAs in nuclear extract from K21 mouse mastocytoma cells RNA substrate
12/12 53/53 12/53 53/12 12/Sup 12/Del 12/Mut B/12 B/Sup B/Mut
Relative processing efficiency (%)a
100.0a
1.7k 1.1 3.1 3.1 112.6- 13.7 114.4 11.0 3.2 X 2.2 0.8 X 0.6 79.6-413.8 78.7 0.5
No. of
experiments 15 3 5 4 3 4 3 11 ib ib
aProcessing efficiencies are expressed as percent of the levels produced by 12/12 RNA in the same experiment. For 12/12, 31.9 A 17.8% of total input RNA was processed after 2 hours incubation. Capped transcripts were used for all these experiments. bAdditional experiments, but using uncapped transcripts, were carried out and produced similar results.
mus-hi-1 (29; construct 'false pal'; see Fig.3 of Ref. 12). In that context, this mutation which retains the potential to form a hairpin but has a completely different sequence had allowed processing at 17 -22% of wild-type activity (12; see also Fig.5 below). In addition, three different mutations were introduced into the spacer element: 12/Del is a 3 nt deletion and 12/Mut has 7 nt substituted so that base-pairing with U7 RNA should be completely abolished. In contrast, 12/Sup has a spacer sequence which is
I-
D
215
hairpin
1 2/1 2 (1)
...GGCCCUUUUCAGGGCCACCCACAAAUUCCUAGAAGGAGUUGUUCACUUACCGAAGCU
B/t 2 (5)
... CCGGAAAGCCUUCCGGACCCACAAAULUCCUAGAAGGAGUUGUUCACUUACCGAAGCU
1 2/Sup (2)
...
GGCCCUUUUCAGGGCCACCCACAAAUUCCCUAAAAGAGCUGUAACACUUCCGAAGCU
Figure 2. Processing of wild-type and mutant histone pre-mRNAs in nuclear extract from K21 mouse mastocytoma cells. (A) Processing of uniformly labelled transcripts. Lanes 1, 12/12 RNA; 2, 12/Sup; 3, 12/Del; 4, 12/Mut; 5, B/12; 6, B/Sup; 7, B/Mut. The positions of unprocessed input RNA (1) and the produced 5' and 3' fragments are indicated. (B) Processing of 5' end-labelled transcripts. Lanes A and N contain adenosine-specific cleavages (27) and mononucleotide ladders (obtained by KOH digestion), respectively, of the same input RNAs used for processing Oanes P). The substrate RNAs are numbered as in panel A. The 5' cleavage products contain 3'-terminal hydroxyl groups (T.W.K., unpublished results) and therefore migrate approximately 1.5 nt slower than the corresponding bands in lanes A that have the corresponding nucleotide removed but carry 3'-terminal phosphates. (C) Processing of 3' end-labelled transcripts. The 3' cleavage products contain 5'-terminal phosphate groups (T.W.K., unpublished results). (D) Schematic representation of the cleavage products observed.
perfectly complementary to the first 20 nt of mouse U7 RNA. Certain combinations of hairpin and spacer mutations, such as B/Mut and B/Sup were also constructed. The results of processing experiments carried out with these mutant RNA substrates are shown in Fig.2A and summarised in table 1. Regarding the spacer element, both the 3 nt deletion (lane 3) and the 7 nt substitution (lane 4) are very drastic down mutations. However, for 12/Del RNA, faint bands corresponding to processed RNA could reproducibly be detected on long autoradiographic exposures, whereas this was not the case for 12/Mut RNA (data not shown). These results confirm the importance of the spacer element and of its base pairing with U7 RNA for efficient in vitro processing. In contrast, the processing efficiency of 12/Sup RNA (lane 2) is marginally higher than that of 12/12 RNA (lane 1), suggesting that improving the potential base pairing with U7 RNA over that of an efficiently processed histone pre-mRNA may lead to better processing, but that this effect is very moderate at the most. Mutating the hairpin element, but without affecting the potential secondary structure (mutant B/12, lane 5), causes only a minor reduction in processing efficiency (approx. 80% of 12/12). Thus, this mutation does not show the pronounced effect previously observed in similar experiments (12). This is also the case in the context of the more extensive U7 homology in the spacer (B/Sup, lane 6). Finally, B/Mut RNA (lane 7) is similarly deficient in processing as 12/Mut RNA. Despite a slower electrophoretic mobility of the 5' cleavage product (Fig.2A, lane 5), processing of B/12 RNA is U7-dependent, since it can be inhibited by pre-incubating the extract with an oligodeoxynucleotide complementary to the 5'
~ ~ ~ B/1
1572 Nucleic Acids Research, 1993, Vol. 21, No. 7 1.4 oa 1.2 01 cm .
(a
4
0.8
0 0.6
X 0.4
.
> 0.2 0 cO
0
1x
3x
lOx
30x
t.
'-k
_
_
_0
2
12/12 100x 300x 1000x
Excess competitor RNA
Figure 3. Competition experiment. Radiolabelled 12/12 RNA was incubated in K21 nuclear extract in the presence of the indicated amounts of competitor RNAs and processing efficiency was quantitated after denaturing gel electrophoresis. The competitor RNAs used were: 12/12 (closed circles), wild-type hairpin and spacer elements; B/12 (open circles), mutated hairpin and wild-type spacer; 12/Mut (closed squares), wild-type hairpin and mutated spacer; B/Mut (open squares), mutated hairpin and spacer.
end of U7 RNA (but not with an unrelated oligo) under conditions activating endogenous RNAse H present in the extract (data not shown). A similar difference in electrophoretic migration had also been evident in the context of the H44 gene from clone mus-hi-1 (12; see also Fig.5 below). The mobility difference is not due to a qualitative effect of the mutation, as was shown by direct comparison of the 5' and 3' cleavage products with RNA sequencing ladders of the cognate 5' or 3' end-labelled RNAs (Fig.2B and C, lanes 1 and 5). Rather, the wild-type hairpin sequence causes a compression artefact which also affects the migration of the slightly longer 5' cleavage products. The only RNA which is cleaved with a somewhat different specificity is 12/Sup (lanes 2), in which the spacer sequence has been altered. The exact 5' and 3' cleavage products obtained with the different RNA substrates are shown schematically in Fig.2D. At least for 12/12 RNA, all 5' and 3' products accumulate similarly with time (data not shown). The pattern of in vitro cleavage products is very similar to the one originally reported for H44 pre-mRNA (26). The surprisingly efficient processing observed with the hairpin mutant B/12 caused us to investigate this reaction in more detail. B/12 RNA fails to interact with a nuclear hairpin binding component (data not shown) that had previously been identified by native gel electrophoresis (16, 30). This is in agreement with the observation made by others that even smaller sequence changes completely prevent the formation of the hairpin-specific complex (W.F. Marzluff, personal communication). Moreover, a comparison of 12/12 and B/12 RNAs in time course and substrate titration experiments did not reveal any significant differences (data not shown). A more definitive proof for whether the hairpin element quantitatively contributes to histone RNA 3' processing can be obtained from competion experiments. We therefore performed processing experiments with labelled 12/12 substrate RNA in the presence of various concentrations of either 12/12, B/12, 12/Mut or B/Mut competitor RNAs (Fig.3). Competition with up to a 1000-fold excess of 12/Mut or B/Mut RNAs (approx. 1.2 itM or 34 sg/ml) has no significant effect on processing. In contrast, both 12/12 and B/12 RNAs are efficient competitors. We have previously reported similar results
am~~~~~a
Figure 4. Processing experiment with short synthetic histone pre-mRNAs in nuclear extract from K21 mouse mastocytoma (A) and human HeLa cells (B). The RNA substrates used were: lanes 1, 12/12; 2, 53/53; 3, 12/53; 4, 53/12. The bands are designated as in Figure 2A.
(16), although those expeiments had been carried out with a single concentration (100-fold excess) of competitor RNAs. We therefore conclude that hairpin interactions do not play a critical role during the processing of 12/12 pre-mRNA in K21 nuclear extract, but that most if not all important interactions involve the spacer element.
Different in vitro processing efficiencies of two non-alielic histone H4 genes depend upon spacer rather than hairpin sequences
We then wanted to investigate whether the hairpin and spacer elements also played a role in determining differences in processing efficicency between various non-allelic histone genes. For this purpose, we focused on a large difference in in vitro processing efficiency observed between pre-mRNAs derived from the two H4 genes present on clones 12 and 53, H4-12 and H4-53 (28). We constructed SP6 templates containing the hairpin and spacer elements from these two genes in all four possible combinations (Fig. 1) and analysed the processing efficiencies of the corresponding pre-mRNAs as described above (Fig.4A). The data from several such experiments are summarised in table 1. The two constructs which contain the spacer element from the efficiently processed H4-12 gene and either of the two stem-loop elements (12/12 and 53/12; lanes 1 and 4 of Fig.4A, respectively) are processed efficiently, whereas both RNAs containing the spacer element from H4-53 (53/53 and 12/53; lanes 2 and 3) are inefficiently processed. The same conclusion could also be reached from a similar experiment performed with nuclear extract from human HeLa cells (Fig.4B), although the constructs with the H4-53 spacer were relatively more efficiently processed in this system (approx. 20% of 12/12). Therefore, the spacer element must be the single most important determinant for the difference in processing efficiency between these two genes.
~ .-
H3-53 I
5,
_. 1
1 2 3 4 5 6 7 8 9101112
12/12 RNA _II .~~~~~~~~~~
3'
..
2 3 4 5
1
6 7 8 9 10
K21
B
HeLa
1/1 RNA I
i
_
~ ~
I +
_
IS
_m
5'
-~~~~
:~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
3'
1245
1 2 3 4 5
6 7 8 9 10
K21
HeLa
Figure 6. Competition experiments using labelled 12/12 (A) or 1/1 (B) substrate RNAs and nuclear extract from either K21 (anes 1-5) or HeLa cells (anes 6-10). The competitors, used in 100-fold molar excess, were: lanes 1 and 6, no competitor; 2 and 7, 12/12 RNA; 3 and 8, 12/Mut RNA; 4 and 9, B/12 RNA; 5 and 10, B/Mut RNA. The bands are designated as in Figure 2A. The cut-off 3' spacer fragments are only faintly visible on these particular autoradiographs.
The importance of the hairpin element for procssing depends the genes and extracts used The apparent discrepancy with published results regarding the importance of the hairpin element (see above) could have been due either to use of different extracts or of different genes. To analyse the importance of the cell line used as source of the extract, we tested the different hairpin constructs in HeLa cell nuclear extract, which had been used in two of the previous studies (14, 15). In this case, processing of the hairpin mutant B/12 (Fig.5, lane 9) was significantly reduced with respect to 12/12 RNA (lane 7). To analyse the possibility of gene-specific hairpin effects, we used two short synthetic pre-mRNAs derived from the H4-1 gene (gifts of Max L.Birnstiel, Research Institute on
..
I
AIm
1 2 3 4 5 6 7 8 9 10
Figure 5. Processing of wild-type and mutant histone pre-mRNAs in nuclear extract from K21 mouse mastocytoma (lanes 1-6) or human HeLa cells (lanes 7-12). The RNA substrates used were: lanes 1 and 7, 12/12; 2 and 8, 12/Sup; 3 and 9, B/12; 4 and 10, B/Sup; 5 and 11, 1/1; 6 and 12, B/1. The positions of bands corresponding to unprocessed input RNA (I) and processed 5' fragments are indicated.
_
H3-6 14
.. ....
-4m
A
~~ ~ ~. I
Nucleic Acids Research, 1993, Vol. 21, No. 7 1573
Fgure 7. Competition experiments using labelled substrate RNAs from the H3-53 (lanes 1-5) or H3-614 (lanes 6-10) genes and nuclear extract from K21 cells. The competitors, used in 100-fold molar excess, were: lanes 1 and 6, no competitor; 2 and 7, 12/12 RNA; 3 and 8, 12/Mut RNA; 4 and 9, B/12 RNA; 5 and 10, B/Mut RNA. The bands are designated as in Figure 5.
of Molecular Pathology, Vienna). The first, originally called 'H4 wt' (see Fig.3 in Ref. 12), contains 41 nt preceding and 28 nt following the processing site of the H4-1 gene, respectively. The second, 'false pal', has the hairpin replaced by the very same sequence also present in B/12. To follow the previously used nomenclature we will therefore call these two RNA substrates 1/1 and B/1, respectively. In complete agreement with the results of Vasserot et al. (12), the hairpin mutation B, in the context of the H4-1 gene (B/1 vs. 1/1), caused a significant reduction in processing efficiency in both K21 and HeLa nuclear extracts (Fig.5, lanes 5-6 and 11-12, respectively), whereas the same mutation in the context of the H4-12 gene (B/12 vs. 12/12) only affected processing in HeLa extract. An interesting observation is that, in HeLa nuclear extract, B/Sup RNA (lane 10) is processed with a similar efficiency as 12/12 RNA (lane 7), whereas the processing of B/12 RNA (lane 9), as mentioned, is drastically reduced. This is in contrast to the behaviour of B/Sup RNA in K21 extract or 12/Sup RNA in either extract which cause little or no increase in processing efficiency over the level of their cognate RNAs with the wildtype H4-12 spacer. Thus it appears that a higher base-pairing potential with U7 RNA can counteract the deleterious effect of the hairpin mutation, but cannot significantly increase the processing of an already efficiently processed RNA. To assess in more detail the gene and extract specificity of hairpin contributions to the efficiency of histone RNA 3' processing, we undertook further RNA competition experiments. Radioactively labelled 12/12 and 1/1 RNA substrates were incubated in either K21 or HeLa nuclear extract in the presence of a 100-fold excess of various competitor RNAs. In agreement with the data presented in Fig.3, processing of 12/12 RNA in K21 nuclear extract (Fig.6A, lane 1) can be competed by 12/12 (lane 2) and B/12 (lane 4), but not by 12/Mut (lane 3) or B/Mut RNA (lane 5). However, in HeLa extract, processing is also significantly, albeit not completely, competed by 12/Mut RNA (lane 8), confirming the conclusion from the direct analysis of mutants that the hairpin does contribute to efficient processing in this system. Processing of radioactively labelled 1/1 RNA in both K21 and Hela nuclear extracts (Fig.6B, lanes 1 and 6, respectively) is also completely prevented by competition with 12/12 (lanes 2 and 7) or B/12 Oanes 4 and 9) but not by B/Mut RNA (lanes 5 and 10). However, in this case, competition with 12/Mut RNA results in a strong reduction in processing efficiency in both extracts. This again confirms the conclusion reached from the direct analysis of mutants that the hairpin does contribute to
1574 Nucleic Acids Research, 1993, Vol. 21, No. 7 efficient processing of the H4-1 gene in both nuclear extracts. Identical competition experiments to the ones shown in Fig.6A and B were also performed with longer H4-12 and H4-1 RNA substrates yielding comparable results (data not shown). Thus, the effect of the hairpin element on processing efficiency seems to be both extract- and gene-dependent. However, our experiments obtained with 12/12 RNA in K21 nuclear extract clearly demonstrate that efficient processing of histone premRNAs can occur in the absence of hairpin interactions. To study if the almost complete hairpin-independence of 12/12 RNA in K21 cell extract represents an exception or a more general phenomenon, we analysed the sensitivity of processing of pre-mRNAs from two further histone genes to competition by 12/12, 12/Mut, B/12 or B/Mut RNAs in this extract (Fig.7). RNA corresponding to the 3' end of the H3-53 gene (18) which is processed with an efficiency similar to H4-1 RNA (28) shows a marked hairpin effect, i.e. its processing is significantly reduced by competition with 12/Mut RNA (lane 3). In contrast, RNA from the 3' end of the H3-614 gene (20) shows an intermediate hairpin effect, i.e. its processing efficiency is reduced by competition with 12/Mut RNA more strongly than that of H4-12 RNA, but less strongly hn that of H4-1 or H3-53 RNA. Since H3-614 RNA is also efficiently processed in vitro, albeit less so than H4-12 RNA (9, 28), it is possible that the relative hairpinindependence of various histone pre-mRNAs in K21 nuclear extract may correlate with their processing efficiency in this extract.
DISCUSSION Our study demonstrates th the contribution of the evolutionarily strongly conserved hairpin element (31) to in vitro histone RNA 3' processing is highly variable. In agreement with previous findings (12, 14, 15), we find that the hairpin is not absolutely required but that a strong stimulatory effect upon processing can be observed if RNAs from the H4-1 or H3-53 genes are used as substrates or if any of the genes we have analysed here are tested in HeLa cell nuclear extract. Conversely, however, our results indicate that processing of pre-mRNAs from the H4-12 gene in nuclear extract from K21 cells is almost completely independent of hairpin interactions. An intermediate hairpin dependence in this extract was observed for pre-mRNA from the H3-614 gene. The fact that the 'Sup' spacer element can complement the processing deficiency in HeLa nuclear extract caused by the 'B' hairpin mutation (Fig.5), strongly suggests that hairpin binding factor(s) (HBF) and the U7 snRNP can functionally cooperate in the same step of the reaction. Since the 'Sup' mutation was designed to increase the stability of base-pairing between the premRNA and the U7 snRNP, it is likely that HBF helps to stabilise this interaction. However at least one further component must become limiting, once the formation of the U7:pre-mRNA complex reaches a certain efficiency, be it with or without the hairpin element. This is suggested by the fact that the 'Sup' spacer mutation has little or no effect under conditions where the cognate RNA with the wild-type H4-12 spacer is already processed efficiently. We can only speculate that the additional limiting factor(s) may be involved in the catalytic step itself. One may then ask, why certain genes show a strong hairpin dependence of processing in K21 nuclear extract, whereas others don't. It may be important in this respect that both H4-12 and H3-614, i.e. the genes with almost complete and partial hairpin independence, respectively, are processed very efficiently in this
extract. Thus the presence or absence of a hairpin effect for various genes, at least considering the limited amount of data available, appears to correlate with their processing efficiency. Following the line of arguments presented above, it is therefore possible that the formation of the U7:pre-mRNA complex for an RNA (e.g. 12/12) that shows no hairpin effect in K21 extract is efficient enough even without any help by HBF. Under these circumstances, the rate of processing would be entirely limited by the putative additional factor(s), whether HBF is allowed to interact with the pre-mRNA or not. Why, then, is this variability observed in extract from K21 cells but not in HeLa cell extract? A likely explanation is that the extact may differ in the relative concentraions of their active components. More specifically, Smith et al. (32) have recently found that extracts from 21-Th cells, a subclone of the K21 cell line used in our study, contain about twice as many U7 snRNPs than EBI myeloma cells. Similarly, we have found about 5-10 times higher U7 RNA levels in K21 cells than in C127 mouse fibroblasts (33). It will be interesting to see whether similar differences also exist between K21 and HeLa cells. A cooperative effect of HBF, as the one described above, should be more important when U7 snRNPs are limiting and less important when they are very abundant, as they may be in K21 extract. However such a difference in U7 snRNP concentration is most likely not the complete explanation for the different behaviour of the two extracts used in this study. Preliminary experiments, in which we have tried to reduce the concentration of U7 snRNPs in K21 extract either by oligonucleotide-targeted RNAse H digestion, digestion with micrococcal nuclease or by immunoprecipitation with anti-Sm antibodies have gradually reduced the processing of 12/12 RNA but have, so far, failed to render it hairpindependent as in HeLa extract (A.Streit and D.Schumperli,
unpublished results). As mentioned above, the most likely role in processing for HBF appears to be to stabilise the interaction between histone pre-mRNA and the U7 snRNP, perhaps by interacting with U7 snRNP structural proteins. However, it is extremely unlikely from all the present data, that HBF participates in the catalytic process itself. Rather, the potential additional factor(s), one of which may be the previously described heat-labile factor (13), or perhaps even U7 RNA itself may be catalytic components. Although this explanation is still speculative, it provides a conceptual framework for further experiments. Alternatively, or perhaps in addition to the above, a nuclear hairpin binding component might be required to remove mature histone mRNA from the processing machinery and to target it for export to the cytoplasm in a fashion similar to poly(A) binding proteins. In this case, hairpin mutants, in vivo, might have the effect of 'clogging up' the processing system. It may be relevant in this respect that a nuclear hairpin binding component may bind processed histone mRNA more efficiently hn unprocessed premRNA (30). Other recent data also indicate that the hairpin element is a necessary feature to target histone mRNA to the cytoplasm (34). A possibly distinct but related polysomeassociated hairpin binding factor may be involved in controlling histone mRNA stability in the cytoplasm (30, 35).
ACKNOWLEDGEMENTS We thank W.F.Marzluff and Max L.Birnstiel for providing us with DNA clones, A.Kramer for HeLa cell nuclear extract,
M.Burri, A.Gruber and E.Kurt for technical help, T.Wyler and H.Brigger for artwork and W.-D.Heyer, Ch.Grimm and
Nucleic Acids Research, 1993, Vol. 21, No. 7 1575 B.Stefanovic for critical comments on the manuscript. This work was supported by the States of Bern and Zurich and by grants 3.036.87 and 3100-27753.89 of the Swiss National Science Foundation. L.M. was the recipient of an EMBO long term
fellowship. REFERENCES 1. Birnstiel, M.L. and Schaufele, F.J. (1988) In Birnstiel, M.L. (Ed.), Structure and function of major and minor small nuclear ribonucleoprotein particles. Springer Verlag, Berlin, pp. 155-182. 2. Liischer, B. and Schiimperli, D. (1987) EMBO J. 6, 1721-1726. 3. Harris, M.E., B6hni, R., Schneiderman, M.H., Ramamurthy, L., Schiimperli, D. and Marzluff, W.F. (1991) Moi. Cell. Biol. 11, 2416-2424. 4. Brush, D., Dodgson, J.B., Choi, O.R., Stevens, P.W. and Engel, J.D. (1985) Mol. Cell. Biol. 5, 1307-1317. 5. Wells, D. and Kedes, L. (1985) Proc. Natl. Acad. Sci. USA 82, 2834-2838. 6. Cheng, G., Nandi, A., Clerk, S. and Skoultchi, A.I. (1989) Proc. Natl. Acad. Sci. USA 86, 7002-7006. 7. Mannironi, C., Bonner, W.M. and Hatch, C.L. (1989) Nucl. Acids Res. 17, 9113-9126. 8. Levine, B.J., Liu, T.J., Marzluff, W.F. and Skoultchi, A.I. (1988) Mol. Cell. Biol. 8, 1887-1895. 9. Liu, T.J., Levine, B.J., Skoultchi, A.I. and Marzluff, W.F. (1989) Mol. Cell. Biol. 9, 3499-3508. 10. Schaufele, F., Gilmartin, G.M., Bannwarth, W. and Birnstiel, M.L. (1986) Nature 323, 777-781. 11. Mowry, K.L. and Steitz, J.A. (1987) Mol. Cell. Biol. 7, 1663-1672. 12. Vasserot, A.P., Schaufele, F.J. and Bimstiel, M.L. (1989) Proc. Natl. Acad. Sci. USA 86, 4345-4349. 13. Gick, O., Kralmer, A., Vasserot, A. and Birnstiel, M.L. (1987) Proc. Natl. Acad. Sci. USA 84, 8937-8940. 14. Cotten, M., Gick, O., Vasserot, A., Schaffner, G. and Birnstiel, M.L. (1988) EMBOJ. 7, 801-808. 15. Mowry, K.L., Oh, R. and Steitz, J.A. (1989) Mol. CeUl. Biol. 9, 3105-3108. 16. Melin, L., Soldati, D., Mital, R., Streit, A. and Schilmperli, D. (1992) EMBO J. 11, 691-697. 17. Meier, V.S., B6hni, R. and Schiimperli, D. (1989) Nucl. Acids Res. 17, 795. 18. Gruber, A., Streit, A., Reist, M., Benninger, P., B6hni, R. and Schiimperli, D. (1990) Gene 95, 303-304. 19. Graves, R.A., Welhman, S.E., Chiu, I.M. and Marzluff, W.F. (1985) J. Mol. Biol. 183, 179-194. 20. Taylor, J.D., Weilman, S.E. and Marzluff, W.F. (1986) J. Mol. Evol. 23, 242-249. 21. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 22. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: A laboratory manual. 2nd Ed. Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY. 23. Dignam, J.D., Lebovitz, R.M. and Roeder, R.G. (1983) Nucl. Acids Res. 11, 1475-1489. 24. Stauber, C., Soldati, D., Liischer, B. and Schiimperli, D. (1990) Meth. Enzymol. 181, 74-89. 25. England, T.E. and Uhlenbeck, O.C. (1978) Nature 275, 560-561. 26. Gick, O., Kramer, A., Keller, W. and Birnstiel, M.L. (1986) EMBO J. 5, 1319-1326. 27. Peattie, D.A. (1979) Proc. Natl. Acad. Sci. USA 76, 1760-1764. 28. Streit, A. (1990) Diploma thesis, Universitait Bern. 29. Seiler-Tuyns, A. and Birnstiel, M.L. (1981) J. Mol. Biol. 151, 607-625. 30. Pandey, N.B., Sun, J.H. and Marzluff, W.F. (1991) Nucl. Acids Res. 19, 5653-5659. 31. Busslinger, M., Portnann, R. and Birnstiel, M.L. (1979) Nucl. Acids Res. 6, 2997-3008. 32. Smith, H.O., Tabiti, K., Schaffner, G., Soldati, D., Albrecht, U. and Birnstiel, M.L. (1991) Proc. Natl. Acad. Sci. USA 88, 9784-9788. 33. Grimm, C., Stefanovic, B. and Schiimperli, D. (1993) EMBO J. 12, in press. 34. Eckner, R., Ellmeier, W. and Birnstiel, M.L. (1991) EMBO J. 10, 3513-3522. 35. Graves, R.A., Pandey, N.B., Chodchoy, N. and Marzluff, W.F. (1987) Cell 48, 615-626. 36. Soldati, D. and Schiimperli, D. (1988) Mol. Cell. Biol. 8, 1518-1524.
