APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2009, p. 6282–6291 0099-2240/09/$08.00⫹0 doi:10.1128/AEM.00873-09 Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Vol. 75, No. 19
Virulence Genes and Molecular Typing of Different Groups of Escherichia coli O157 Strains in Cattle䌤 Istva´n To ´th,1* Herbert Schmidt,2 Ga´bor Kardos,3 Zsuzsanna Lancz,4 Kristina Creuzburg,2 Ivelina Damjanova,5 Judit Pa´szti,5 Lothar Beutin,6 and Be´la Nagy1 Veterinary Medical Research Institute of the Hungarian Academy of Sciences, Budapest, Hungary1; University of Hohenheim, Institute of Food Science and Biotechnology, Laboratory of Food Microbiology, Stuttgart, Germany2; National Veterinary Institute, Microbiology, Debrecen, Hungary3; National Food Investigation Institute, Budapest, Hungary4; National Center for Epidemiology, Budapest, Hungary5; and Federal Institute for Risk Assessment, Berlin, Germany6 Received 17 April 2009/Accepted 20 July 2009
Characterization of an Escherichia coli O157 strain collection (n ⴝ 42) derived from healthy Hungarian cattle revealed the existence of diverse pathotypes. Enteropathogenic E. coli (EPEC; eae positive) appeared to be the most frequent pathotype (n ⴝ 22 strains), 11 O157 strains were typical enterohemorrhagic E. coli (EHEC; stx and eae positive), and 9 O157 strains were atypical, with none of the key stx and eae virulence genes detected. EHEC and EPEC O157 strains all carried eae-gamma, tir-gamma, tccP, and paa. Other virulence genes located on the pO157 virulence plasmid and different O islands (O island 43 [OI-43] and OI-122), as well as espJ and espM, also characterized the EPEC and EHEC O157 strains with similar frequencies. However, none of these virulence genes were detected by PCR in atypical O157 strains. Interestingly, five of nine atypical O157 strains produced cytolethal distending toxin V (CDT-V) and carried genes encoding long polar fimbriae. Macro-restriction fragment enzyme analysis (pulsed-field gel electrophoresis) revealed that these E. coli O157 strains belong to four main clusters. Multilocus sequence typing analysis revealed that five housekeeping genes were identical in EHEC and EPEC O157 strains but were different in the atypical O157 strains. These results suggest that the Hungarian bovine E. coli O157 strains represent at least two main clones: EHEC/EPEC O157:H7/NM (nonmotile) and atypical CDT-V-producing O157 strains with H antigens different from H7. The CDT-V-producing O157 strains represent a novel genogroup. The pathogenic potential of these strains remains to be elucidated. Escherichia coli O157:H7 is a food- and waterborne zoonotic pathogen with serious effects on public health. E. coli O157:H7 causes diseases in humans ranging from uncomplicated diarrhea to hemorrhagic colitis and hemolytic-uremic syndrome (HUS) (30). Typically, enterohemorrhagic E. coli (EHEC) strains express two groups of important virulence factors: one or more Shiga toxins (Stx; also called verotoxins), encoded by lambda-like bacteriophages, and a pathogenicity island called the locus of enterocyte effacement (LEE) encoding all the proteins necessary for attaching and effacing lesions of epithelial cells (41). Comparative genomic studies of E. coli O157:H7 strains revealed extensive genomic diversity related to the structures, positions, and genetic contents of bacteriophages and the variability of putative virulence genes encoding nonLEE effector proteins (29, 43). Ruminants and, in particular, healthy cattle are the major reservoir of E. coli O157:H7, although the prevalence of O157:H7 strains in cattle may vary widely, as reviewed by Caprioli et al. (12). E. coli O157:H7 has been found to persist and remain infective in the environment for a long time, e.g., for at least 6 months in water trough sediments, which may be an important environmental niche. In Hungary, infections with E. coli O157 and other Shiga
toxin-producing E. coli (STEC) strains in humans in cases of “enteritidis infectiosa” have been notifiable since 1998 on a case report basis. Up to now, the disease has been sporadic, and fewer than 100 (n ⫽ 83) cases of STEC infection among 2,700 suspect cases have been reported since 2001. However, until the present study, no systematic, representative survey of possible animal sources had been performed. In this study, our aim was to investigate healthy cattle in Hungary for the presence of strains of E. coli O157 and the genes encoding Shiga toxins (stx1 and stx2) and intimin (eae) and a wide range of putative virulence genes found in these strains. In addition, the phage type (PT) was determined, and pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) were used to further compare the strains at the molecular level. Shiga toxin and cytolethal distending toxin (CDT) production was also examined, and phage induction experiments were conducted. The high incidence of enteropathogenic E. coli (EPEC; eae-positive) O157:H7 strains and atypical (eae- and stx-negative) O157 strains indicates that cattle are a major reservoir of not only EHEC O157 but also EPEC O157 and atypical E. coli O157 strains. These atypical, non-sorbitol-fermenting O157 strains frequently produced CDT-V and may represent a novel O157 clade as demonstrated by MLST and PFGE.
* Corresponding author. Mailing address: Veterinary Medical Research Institute of the Hungarian Academy of Sciences, 1143 Budapest, Hunga´ria krt. 21, Hungary. Phone: 36-1-2522455. Fax: 36-12521069. E-mail:
[email protected]. 䌤 Published ahead of print on 14 August 2009.
Isolation of E. coli O157 strains. Altogether, 756 samples—colon specimens (n ⫽ 428), feces and rectal scrapings (n ⫽ 214), and milk samples (n ⫽ 114)— from 542 healthy cattle were collected. The 114 milk and 174 fecal samples were obtained from a large dairy farm (Enying), and all the other samples were taken
MATERIALS AND METHODS
6282
VOL. 75, 2009
TYPICAL AND ATYPICAL E. COLI O157 STRAINS
6283
TABLE 1. Primers used for non-LEE effector genes Primera
Sequence
Position in control strain/gene
M-EspJf2 M-EspJr2 M-EspJf1 M-EspJr1 M-EspKLIC1 M-EspKLIC2 M-EspM1-pKK-F M-EspM1-pKK-R M-EspM2-pKK-F M-EspM2-pKK-R M-EspT-HA-F M-EspT-HA-R
ATGTCAATTATAAAAAACTGCTTATC TTTTTTGAGAGGATATATGTCAAC ATGCCAATCATAAAGAACTGC TTTTTTGAGTGGGTGGATAT ATGCTTCCTACATCGCAATTAC GAATATTTATATGTGGAACC ATGCCAGTAAATGCGACAGG ACCCCTGTATAACACGACTCA ATGCCGATGAATACTACAGGTATGT TCCCTGTATAGCACGCATCAA ATGCCGGGAACAATAAGCTCCAG TAGGTTCTCTGAGCCTCCTGAA
2668573–2668598 2669223–2669200 771364–771344 770714–770733 1589509–1589488 1588152–1588171 1811677–1811696 1812265–1812245 3477573–3477549 3476986–3477006 1–23 569–548
a b
Amplicon size (bp)
Control strain
Reference(s)
650
E. coli Sakai O157
21, 37
650
E. coli E2348/69
21, 37
1,357
E. coli Sakai O157
56
588
E. coli Sakai O157
4
587
E. coli Sakai O157
4
548
Citrobacter rodentium ICC169b
11
M, modified. In the absence of C. rodentium control strains, espT-specific PCR amplicons were sequenced.
from five slaughterhouses representing different regions of Hungary in the years 2002 and 2003. Samples were transferred to the laboratory on ice and investigated immediately after arrival or kept at ⫺70°C until processing. For the isolation of E. coli O157 and STEC, the following procedures were applied. First, polymyxin B extraction was used to detect Stx with the Seiken verotoxigenic E. coli screening kit. In the case of Shiga toxin detection, the samples were plated onto cefixime-tellurite-sorbitol-MacConkey agar and the presence of stx genes was investigated by stx universal and stx1- and stx2-specific PCR analyses of up to 50 colonies. In addition to being utilized for the isolation of E. coli O157 strains, the samples were processed according to the International Organization for Standardization reference method (ISO 16654) using an O157-specific immunomagnetic separation (IMS) kit (Dynal, Oslo, Norway). For enrichment, novobiocincontaining modified tryptic soy broth was applied, and the suspensions were plated onto cefixime-tellurite-sorbitol-MacConkey agar, CHROMagar, and bromothymol blue agar plates. Five to 10 non-sorbitol-fermenting coliform colonies were agglutinated with O157 latex (Oxoid Ltd.) particles and with O26- and O111-specific immune sera. The agglutinating colonies were subcultured and confirmed biochemically to be E. coli. Only one E. coli O157 colony per sample was selected and analyzed further. One-third of samples were assayed by using O26 and O111 IMS kits. The isolated colonies were tested with O26 and O111 antibodies. Phenotypic methods. Serotyping of O (lipopolysaccharide) and H (flagellar) antigens was performed with O-specific and H-specific rabbit antisera prepared at the Federal Institute for Risk Assessment (Berlin, Germany) according to standard methods (44). Antigens O1 to O181 and H1 to H56 were investigated, and nonmotile (NM) E. coli O157 strains were evaluated by PCR and restriction fragment length polymorphism analyses of RsaI-digested fliC PCR products (16). Phage typing was performed by the method of Khakria et al. (33) at the National Center for Epidemiology (Budapest, Hungary). By using the 16 typing phages all together, 90 PTs could be differentiated. Colicin production was tested as described previously (1) using an E. coli K-12 strain sensitive to a wide range of colicins. The resistance of E. coli strains to the following antimicrobials was investigated by the disk diffusion method using antibiotic disks (Oxoid Ltd.) on MuellerHinton agar: ampicillin, cefotaxime, chloramphenicol, ciprofloxacin, gentamicin, kanamycin, nalidixic acid, streptomycin, sulfonamide, sulfamethoxazole-trimethoprim, and tetracycline. The zones of growth inhibition were evaluated according to the 2005 recommendations of the Clinical and Laboratory Standards Institute. (i) Shiga toxin production. Vero cell assays were used to detect Shiga toxin production by E. coli O157 strains as described previously (49). Briefly, doubling dilutions of E. coli O157 culture supernatants were examined for the presence of Stx on Vero cell monolayers (104 cells per well). The degree of cytotoxicity was determined after 2 days of incubation at 37°C in 5% CO2 by microscopic examination. The wells showing at least 50% cytotoxicity were considered positive. CDT production was investigated with bacterial lysates as described previously (54). The morphological changes in HeLa cells characteristic of the presence of CDT were investigated after staining of the cells with Giemsa stain. CDT-Vproducing E. coli strain 493/89 (27) was used as a positive control, and E. coli C600 was used as a negative control.
(ii) Prophage induction. For phage induction, mitomycin C at a final concentration of 0.5 g/ml and a subinhibitory concentration of norfloxacin (34) were used, and plaques were isolated as described previously using E. coli K-12 derivative C600 as the indicator strain (55). Single plaques were picked up and investigated by stx2- and stx1-specific PCR analyses. DNA methods. (i) Genotypic characterization by PCR. E. coli O157 strains were first examined for O157:H7 rfbE (rfbEO157:H7) by diagnostic PCR analysis as described by Paton and Paton (47) and for the fliC gene as described by Fields et al. (16). The presence of stx genes was evaluated with Lin up/Lin down stx universal primers (36), and stx genes were typed using stx1-specific B54/B55 and stx2-specific B56/B57 PCR primers (13). B52/B53 primers were used for eae (13). EAF1/EAF2 PCR primers were used for eaf (17) and BFP1/BFP2 were used for bfp (22) according to the published protocols. The eae genes were typed as described by Oswald et al. (45), and tir genes were typed as described by Ogura et al. (42). Ehly1/Ehly5 primers were used for ehxA (57). The presence of efa1 5⬘ and efa1 3⬘ regions was investigated with primers Efa1-upper/Efa1-lower (R. La Ragione, unpublished data) and Efa1 3⬘fwd/Efa1 3⬘rev (39), respectively. The tccP-F1/tccP-R1 primers (21) were used for tccP genes, urea-F/urea-R primers (18) were used for ureA, and terB1/terB2 primers (52) were used for terB. Z4321-a/Z4321-b, Z4326-a/Z4326b, Z4332-a/Z4332-b, and Z4333-a/Z4333-b PCR primers were used for detecting O island 122 (OI-122)-specific marker genes pagC, sen, and efa1 as described by Karmali et al. (32). Detection and typing of cdt genes were performed with previously described PCR primers (54), as well as cdt-VA-specific (c338f/c2135r) and cdt-VC-specific (P105/c2767r) primers (8). Q antiterminator genes were typed with primers 595, Q 933, and Q 21 as described by Lejeune et al. (35). The presence of fuyA was detected with FyuAF/FyuA-R primers (51), and lpfA-F/lpfA-R primers (15) were used for detecting lpfAO113. The sodC-specific O157-2For/O157-2Rev primers were used as described previously (14), and icf-specific primers were kindly provided by R. La Ragione (Veterinary Laboratories Agency, Weybridge, United Kingdom). Modified versions of PCR primers described previously were used for detecting the non-LEE effector genes espJ, espK, espM1, espM2, and espT (Table 1). (ii) MLST. In this study, the sequences of the housekeeping genes adk, arcA, fumC, mdh, and mtlD were determined and compared as described previously (7). Briefly, fresh single colonies, which were grown overnight on Luria-Bertani agar plates, were suspended in 50 l of a 0.9% NaCl solution by using sterile toothpicks and subsequently diluted 1:6 in 0.9% NaCl solution. PCR samples were prepared in a total volume of 50 l containing 5 l of this bacterial suspension, 5 l of 10-fold-concentrated polymerase reaction buffer with 15 mM MgCl2 (Promega, Mannheim, Germany), 200 M (each) deoxynucleoside triphosphates, 30 pmol of each primer, and 1.5 U of Taq DNA polymerase (Promega). PCR was performed in a GeneAmp PCR system 2700 (Applied Biosystems Applera, Weiterstadt, Germany). Samples of 8 l of the PCR products were analyzed for purity on 0.7 to 1% Tris-borate-EDTA agarose gels using a maximum voltage of 5 V/cm. The primers used are listed in Table 2. (iii) Purification of PCR products. For the removal of PCR primers, 5-l samples of the PCR products were combined with 2 l of a reaction mixture containing 10 U of exonuclease I (New England Biolabs) and 2 U of shrimp alkaline phosphatase (USB Biochemicals). Exonuclease I was diluted to 1 U/l in 50 mM Tris-HCl, pH 7.5, and incubated at 37°C for 30 min and subsequently at 80°C for 15 min to inhibit further enzymatic activity.
6284
´ TH ET AL. TO
APPL. ENVIRON. MICROBIOL. TABLE 2. Primers used for MLST analysis
Primer
Sequence (5⬘–3⬘)
adk3 adk4 arcA-p1 arcA-p2NW arcA-p3 arcA-p4 mlp-p3 mlp-p4 mlp-3A mlp-4A fumC-1 fumC-2 mdh⫹55 mdh-872 mdh⫹307 mdh⫹443 mdh-441 mdh-544
GGGGAAAGGGACTCAGGCTCAG AACTTTCGCGTATTTGGTATT GAAGACGAGTTGGTAACACG CTTCCAGATCACCGCAGAAGC CCATGAATCTGGGTACTGTC TGCCTGGGTTTTCACAGAAG CGTTGATCTGATTGCTCAGG TGATCAGTACCGCACCACTT CAAAGCGTGGGTAGAAGAAC CCAGCGGATCGTTAGTTGC CGGCTCCGGCACGCAAAGTAA ATCGCCACGTCGTTCCCCATCA CTGTTAAAAACCCAACTGCC GCGTTCTGTTCAAATGCG CAGCAAGTTGCGAAAACCTG CGCTGGATATCATTCGTTC GGTAACGCCGAACAGTTTG AGCGGCAGAATGGTAACAC
PCR product size (bp)
Length (bp) of sequence used
Adenylate kinase gene (adk)
556
462
7
ArcA respiration control protein gene (arcA)
645
544
7
410
This study This study 7
Target gene
Mannitol-1-phosphate dehydrogenase gene (mtlD)
580
Reference
Fumarate dehydrogenase gene (fumC)
753
514
This study This study 7
Malate dehydrogenase gene (mdh)
817
496
7
(iv) Sequencing. The treated PCR products were sequenced with a CEQTM 8000 genetic analysis system (Beckmann Coulter, Krefeld, Germany). The applied DNA concentration was 50 fmol. Precipitation of DNA with ethanol and sequence analysis were conducted with the GenomeLab dye terminator cycle sequencing with quick start kit according to the instructions of the manufacturer (Beckmann Coulter). The program for amplification consisted of 30 cycles of 96°C for 20 s, 50°C for 20 s, and 60°C for 360 s. In general, the reading lengths were between 400 and 650 bp. The single fragments were assembled with BioEdit sequence alignment software (version 7.0.7.0.; Ibis Biosciences, Carlsbad, CA). (v) Software for DNA analysis. Following double-strand sequencing, the sequences were edited and aligned. DNA fragments between 410 and 725 bp long from each sequence were used for sequence analysis (Table 2). Raw DNA sequence data were analyzed with ABI 377 software. DNA sequences were edited and aligned with BioEdit, version 4.8.10 (http://www.mbio.ncsu.edu /BioEdit/bioedit.html) (23), converted into FASTA files, and loaded into S.T.A.R.T. (Sequence Type Analysis and Recombinational Tests; http://outbreak .ceid.ox.ac.uk/software.htm). The dendrograms were compiled with S.T.A.R.T. using the unweighted-pair group method with arithmetic mean (UPGMA). This software constructs a phylogenetic tree on the basis of allele numbers. Split decomposition analysis (5, 25) was performed with SplitsTree, version 2.0 (http: //bibiserv.techfak.uni-bielefeld.de/splits/). (vi) PFGE. PFGE was performed by following the PulseNet protocol for EHEC with XbaI (Fermentas) as the restriction enzyme. The same plugs were also digested with 20 U/150 l NotI (Fermentas) in the buffer provided by the manufacturer. Fingerprints were analyzed using the software Fingerprinting II (Bio-Rad). Similarity was assessed using the Dice coefficient (optimization, 1%; position tolerance, 1 to 1.5%), and clustering was performed using UPGMA. The threshold for relatedness was chosen at 90%. Nucleotide sequence accession numbers. The nucleotide sequences obtained by sequencing of the PCR products from all alleles of five E. coli housekeeping genes have been entered into the EMBL nucleotide database under continuous accession numbers from FN257307 to FN257337 for adk, FN257338 to FN257368 for arcA, FN257369 to FN257399 for fumC, FN257400 to FN257430 for mdh, and FN257431 to FN257461 for mtlD.
RESULTS Isolation of E. coli O157 and STEC. Using the verotoxigenic E. coli screening kit, the E. coli O157-specific IMS technique, and a latex agglutination kit, we were able to isolate a total of 42 E. coli O157 and 13 non-O157 STEC strains. In these isolation trials, 756 samples originating from 542 healthy cattle were processed. The detailed investigation was conducted with strains that proved to be E. coli O157.
This This This This
study study study study
Virulence gene typing of E. coli O157 strains. E. coli O157 isolates were subjected to numerous PCR assays, but first, the presence of stx and eae genes was established and the strains were grouped. We defined an E. coli O157 strain as EHEC if it carried both eae and stx genes; EPEC was identified if the strain carried only the eae gene. Finally, in the absence of these key virulence genes, the E. coli O157 strains were designated atypical O157. Of the 42 E. coli O157 strains, 11 proved to be EHEC, 22 proved to be EPEC, and 9 strains were classified as atypical O157. Ten EHEC strains carried stx1 and stx2 genes, and in one strain, only stx2 was detected (Table 3). The EPEC and EHEC O157 strains carried eae-gamma and tir-gamma genes and the tccP gene. The other investigated virulence genes also characterized the EPEC and EHEC O157 strains at similar frequencies (Fig. 1). Like the EHEC EDL933 and Sakai strains, none of our E. coli O157 strains carried the complete efa (EHEC factor for adherence) gene. Nine EHEC and 13 EPEC O157 strains carried the 5⬘ fragment of the efa gene. Interestingly, in one EPEC O157 strain the terminal fragment of the efa1 gene was detected, but this strain did not carry the initial fragment of efa1. The genes icf (synonymous with paa) and sodC were present in all EHEC strains and in 21 and 20 EPEC strains, respectively. Five EHEC and 11 EPEC O157 strains harbored the ureA gene. The tenB gene was detected in 8 EHEC and 19 EPEC strains. Two EHEC and two EPEC O157 strains carried fyuA. The lpfO113 gene occurred in one EHEC and six EPEC O157 strains. The OI-122-specific genes were detected in all the EHEC O157 strains, while sen was detected in 18, pagC was detected in 21, efa1 open reading frame (ORF) Z4332 was found in 21, and efa1 ORF Z4333 occurred in 21 EPEC O157 strains (Fig. 1). In addition to tccP, the strains were tested for other nonLEE effector protein genes, including espJ, espK, espM1, espM2, and espT. The Sakai-specific espJ gene was present in 10 EHEC O157 strains (90.9%) and in 19 EPEC O157 strains (86.4%). The espK gene was found in four EHEC O157 strains (36.4%). The espM1 gene was present in 8 EHEC
VOL. 75, 2009
TYPICAL AND ATYPICAL E. COLI O157 STRAINS
6285
TABLE 3. Origins, serotypes, pathotypes, and PTs of E. coli O157 bovine strains isolated in Hungary Strain
a
34 52 254 R4 R67 F67 318 319 320 321 4979 64 65 67 68 103 121 122 127 129 137 138 144 165 168 169 174 177 178 179 R6 R30 F30 B20 B47 B54 T4 T22 T16 T50 T34 T49 EDL933 Sakai
Origin
Serotype
Pathotypeb
stx gene(s) present
eae-gamma
tir-gamma
PTc
Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Dairy farm Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Slaughterhouse Dairy farm Dairy farm Dairy farm Dairy farm Dairy farm Dairy farm Dairy farm Dairy farm Dairy farm
O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:NM O157:NM O157:NM O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H12 O157:NM O157(rough):H12d O157(rough):H12d O157:H43 O157:H43 O157:H43 O157(rough):H9d O157(rough):H37rd O157:H7 O157:H7
EHEC EHEC EHEC EHEC EHEC EHEC EHEC EHEC EHEC EHEC EHEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC EPEC AT AT AT AT AT AT AT AT AT EHEC EHEC
stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx1, stx2 stx2
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹
PT21 PT33 PT21 PT21 PT21 PT21 PT8 PT8 PT8 PT8 PT8 PT8 PT33 PT33 PT8 PT50d PT50d PT50d PT50d PT50d PT50d PT50d NT-R PT50d PT50d NT-R NT-R NT-R PT50d NT-R PT50d PT50d PT50d NT-R NT-R NT-R NT-R NC NC NC PT21 NC PT21 PT14
stx1, stx2 stx1, stx2
a
Bovine O157 isolates with designations highlighted in bold were used for MLST analysis. EHEC, stx and eae positive; EPEC, eae positive; AT, atypical (eae and stx negative). c NT, nontypeable; R, phage resistant; NC, noncharacteristic PT; d, derivative. d Identified as O157 and rfbE positive by PCR and by latex agglutination and as O rough by tube agglutination. b
O157 strains (72.7%) and in 15 EPEC O157 strains (68.2%), and espM2 was found in 10 EHEC O157 strains (90.9%) and in 17 EPEC O157 strains (77.3%). The espT gene was absent from all O157 strains. None these effector genes were detected in the atypical O157 strains (Fig. 1). In one atypical E. coli O157 strain, the ehxA gene was present, while three strains carried the ureA gene. However, in five atypical O157 strains, cdt-VABC genes were detected, and CDT production was demonstrated in tissue cultures (data not shown). Interestingly, these CDT-V-producing strains also carried the lpfAO113 gene, encoding the major fimbrial subunit of long polar fimbriae (Fig. 1). Phage induction experiments were performed with 11 EHEC O157 strains. Lytic phages induced from eight strains and the purified plaques were lysed and investigated by PCR
for the presence of stx genes. The results revealed that all eight functioning lytic phages carried stx2 genes (Table 4). Interestingly, in the three strains with noninducible stx2 phages, the Q21-like antiterminator gene sequences were identified, while in seven of eight inducible stx2 phages, the EDL99-like Q antiterminator gene was detected. Stx production by EHEC strains was proven in Vero tissue cultures (data not shown). Serotypes, PTs, and colicin production. E. coli O157 strains all carried the rfbE gene (specific for O157 antigen), detected by PCR. Four strains positive for O157 antigen by PCR and latex agglutination proved to be O rough by O tube agglutination. Three E. coli O157 EHEC strains did not produce detectable H antigen. However, PCR-restriction fragment length polymorphism analysis revealed that the RsaI-digested fliC PCR products from these strains yielded the same patterns as
6286
´ TH ET AL. TO
APPL. ENVIRON. MICROBIOL.
FIG. 1. Distribution of virulence genes in E. coli O157 bovine strains isolated in Hungary. None of the O157:H7 strains carried eaf, bfp, and espT genes. efa1*, ORF Z4332, and efa1**, ORF Z4333 (32).
those from H7-producing E. coli O157 strains (data not shown). Three atypical O157 strains produced H43, one strain produced H12, and one was NM. The O rough but PCRpositive O157 strains carried flagella associated with H12 (n ⫽ 2), H9 (n ⫽ 1), and H37 (n ⫽ 1) (Table 3). None of the 42 E. coli O157 strains fermented sorbitol, produced colicin, or showed multidrug resistance. Only some strains were resistant to one or two antibiotics (data not shown). The EHEC and EPEC O157 strains proved to belong to PTs typical for O157 EHEC, including PT8, PT21, and PT33. The atypical O157 strains could not be classified by the typing phages used: all these strains either proved to be phage resistant or belonged to noncharacteristic PTs. Results of serotyping and phage typing are shown in Table 3. MLST. The virulence gene profiles and the subtyping of eae and tir genes clearly indicate a strong relationship between the EHEC and EPEC O157 strains and substantial diversity between these strains and the E. coli O157 atypical strains. To explore further the phylogenetic relationship among O157 strains, MLST and PFGE were conducted. Altogether, 31 E. coli O157 strains, including 11 EHEC, 11 EPEC, and 9 atypical O157 strains, were compared by investigating the sequences of five housekeeping genes. The genes chosen for MLST were distributed evenly throughout the chromosome. DNA sequences of corresponding housekeeping genes from the E. coli K-12 strain MG1655 (accession no.
TABLE 4. Genotypic and phenotypic characteristics of EHEC O157 bovine strainsa Strain
Serotype
QEDL933 antiterminator gene
Q21 antiterminator gene
stx2 phage induction
Stx production
34 52 254 R4 R67 F67 321 320 318 319 4979
O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:H7 O157:NM O157:NM O157:NM O157:H7
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺
⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹ ⫹
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫹
a
⫹, present; ⫺, absent.
NC_000913) and the O157:H7 strains EDL933 (accession no. NC_002655) and Sakai (accession no. NC_002695) were compiled from the respective published genome sequences. DNA sequences were obtained from all 31 E. coli O157 bovine strains studied, and the sequences of all five housekeeping genes could be aligned without gaps. The corresponding DNA sequences from E. coli K-12 strains (MG1655 and C600) and O157:H7 strains (EDL933 and Sakai) were included in our scheme. The alleles of the five genes analyzed were numbered in ascending order. Numbers and types of base substitutions were not taken into account for allele designation (7). The allele frequencies and combinations of allele numbers for all isolates are shown in Table 5. Each unique combination of allele numbers represents one sequence type (profile). As a result, seven MLST profiles (I to VII) were established; six MLST profiles (I to VI) were attributed to the E. coli O157 strains, while MLST profile VII characterized the K-12 strains. The 11 EPEC and 11 EHEC O157 strains showed MLST profile I, and the 9 atypical strains showed five different MLST profiles: II to VI (Table 6). One of the five dendrograms is shown in Fig. 2 as an example. PFGE. PFGE was performed on 42 bovine O157 isolates, 1 human (C81) O157:NM strain (53), and 2 EHEC reference strains: O157:H7 EDL933 (48) and Sakai (24). Macro-restriction fragment analysis using the enzyme XbaI yielded 45 patterns (Fig. 3). Two human EHEC type strains (Sakai and EDL933) and two epidemiologically unrelated Hungarian EHEC strains (a bovine isolate, 4979, and a human isolate, C81) were also tested for comparison. PFGE typing was very useful for the identification of genetically closely related stx-positive and stx-negative MLST profile I strains. Four main clusters (A, B, C, and D) were outlined by enzyme XbaI (Table 5). XbaI cluster A included 17 EPEC strains from different slaughterhouses in Hungary; cluster B comprised 7 EHEC isolates, interestingly including the single human Hungarian O157:NM EHEC isolate; cluster C comprised four EHEC strains isolated from cattle on the same farm; and cluster D consisted of four atypical CDT-V-producing strains, all derived from milk samples from that dairy farm (Fig. 3. and Table 5). The 22 MLST profile I E. coli O157 bovine strains were subdivided by PFGE into three XbaI clusters, A to C. Interestingly, EDL933 and Sakai strains gave very similar XbaI patterns and belonged to none of the four clusters.
VOL. 75, 2009
TYPICAL AND ATYPICAL E. COLI O157 STRAINS
6287
TABLE 5. Pathotypes, serotypes, and allelic and MLST profiles of E. coli O157 and E. coli K-12 strains MLST result for: Pathotype or group
Serotype
No. of strains
MLST profile adk
arcA
fumC
mdh
mtlD
XbaI PFGE groupa
O157:H7b O157:H7 O157:H7 O157:NM O157:H7
2 6 1 3 1
I I I I I
1 1 1 1 1
1 1 1 1 1
1 1 1 1 1
1 1 1 1 1
1 1 1 1 1
B C C
EPEC
O157:H7
11
I
1
1
1
1
1
A
Atypical
O157:H12 O157(rough):H12c O157:H43 O157(rough):H37rc O157(rough):H9c O157:NM O157(rough):H12c
1 1 3 1 1 1 1
II III IV V V V VI
2 2 3 3 3 3 4
3 3 4 4 4 4 4
2 2 3 3 3 3 4
2 2 3 3 3 3 2
3 4 5 6 6 6 1
K-12
2
VII
2
2
2
2
2
EHEC
Nonpathogenic strains
D D
a
PFGE groups A to D are listed. Five atypical (eae- and stx-negative) O157 strains and the epidemiologically unrelated bovine E. coli O157 strain 4979 did not establish a further PFGE group. b Two EHEC prototype strains (EDL933 and Sakai) and two epidemiologically unrelated strains (4979 of bovine origin and C81 关53兴 of human origin) were used in PFGE studies (Fig. 3). The allelic profile of C81 was not investigated. c Identified as O157 and rfbE positive by PCR and by latex agglutination and as O rough by tube agglutination.
DISCUSSION In the present study, 42 E. coli O157 strains isolated from dairy and slaughterhouse cattle in Hungary were characterized genetically and phenotypically. This process entailed determining the PT, serotype, and antibiotic resistance profile; detecting the presence of key virulence genes and a wide range of putative virulence genes; and identifying genomic DNA macro-restriction fragment patterns and MLST profiles. Stx production by EHEC O157:H7 strains and CDT production by atypical O157 strains were also examined, and phage induction experiments were conducted. Our results show that E. coli O157 strains are relatively common in the Hungarian cattle population: indeed, E. coli O157 strains were isolated from more than 7% of the cattle investigated. In our non-sorbitol-fermenting EPEC and EHEC O157 strains, as in the sequenced prototype EHEC O157:H7 strains EDL933 and Sakai, only initial or terminal fragments of the
TABLE 6. Allelic and MLST profiles of E. coli O157 and E. coli K-12 strains Profile
Serotype(s) (pathotype关s兴)c
1,1,1,1,1a 2,3,2,2,3 2,3,2,2,4 3,4,3,3,5 3,4,3,3,6
O157:H7/NM (EHEC, EPEC) O157:H12 (AT) O157(rough):H12 (AT) O157:H43 (AT) O157:NM (AT), O157(rough): H9 (AT), O157(rough):H37 (AT) O157(rough):H12 (AT) K-12
4,4,4,2,1 2,2,2,2,2b
Profile Frequencyd (%) designation
I II III IV V
24/35 (68.6) 1/35 (2.8) 1/35 (2.8) 3/35 (8.6) 3/35 (8.6)
VI VII
1/35 (2.8) 2/35 (5.7)
a
Profile of bovine and E. coli O157:H7 EDL933 and Sakai strains. Profile of E. coli K-12 strains C600 and MG1655. AT, atypical. d Number of strains with indicated profile/number of strains analyzed. b c
FIG. 2. UPGMA-based dendrogram of mtlD sequences in the example of bovine O157 E. coli strains. AT, atypical.
6288
´ TH ET AL. TO
APPL. ENVIRON. MICROBIOL.
FIG. 3. Dendrogram of PFGE patterns of E. coli O157 bovine strains. DNA samples were digested with XbaI, and the patterns were calculated with the Dice coefficient as described in Materials and Methods. A, B, C, and D are the main PFGE clusters.
VOL. 75, 2009
efa1 gene (also called lifA, for lymphocyte inhibitory factor) were detected (24, 48). These results are in accord with the data reported in the literature since the whole efa1 gene has never been found in non-sorbitol-fermenting E. coli strains. However, the large, 9,669-bp gene was detected previously in sorbitol-fermenting EHEC O157:NM strains (28). The efa1 gene in these strains showed 99.9% sequence homology to efa1 from EHEC O111:NM and lifA from EPEC strain E2348/69 of the O127:H6 serotype (28). In harmony with the findings described in the literature, non-LEE effector genes tccP and espJ (21), as well as espM (3), were detected frequently in EHEC and EPEC O157 strains, while espT was absent from all O157 strains (3). In contrast, none of these effector genes were present in atypical O157 strains. The urease gene cluster is located within OI-43 and OI-48 (48) in EDL933. Urease genes were detected in the major EHEC groups O26, O111, and O157, as well as in sorbitolfermenting EHEC O157:NM strains, but were absent from diarrheagenic E. coli strains of several other pathogroups, including enteroaggregative E. coli, enteroinvasive E. coli, and EPEC strains (18, 40). In enterotoxigenic E. coli, there is a homologue of the O157 urease-encoding OI-48 (46). These investigations indicate the virulence potential of urease in EHEC. Not only do the tellurite resistance (52) and the periplasmic or membrane-associated superoxide dismutase (6) characterize the prototype EHEC strains, but these virulence factors also were identified in EHEC clinical isolates. The fact that the marker genes for urease (ureA), potassium tellurite resistance (terB), and superoxide dismutase (sodC) frequently characterized our EPEC and EHEC O157 bovine strains is suggestive of their pathogenic and zoonotic potential. MLST demonstrates that our non-sorbitol-fermenting O157 EHEC and EPEC strains represent a single clone complex that may belong to the non-sorbitol-fermenting O157:H7 worldwide clone and that the atypical E. coli O157 strains are independent. Our genotyping results indicate that stx genes may be part of the gain and loss of Stx-converting bacteriophages among E. coli O157 strains isolated from healthy bovines. Evidence in support of either possibility exists. First, Schmidt et al. (50) lysogenized laboratory strains as well as a broad range of enteric E. coli strains, including two EPEC strains, with a derivative of a Shiga toxin 2-encoding phage originating from an E. coli O157 strain. James et al. (26) also lysogenized several wild-type E. coli and Shigella strains in vitro by using an aph3 gene-labeled Stx2-encoding phage. Acheson et al. (2) were able to transduce a laboratory strain in the murine gastrointestinal tract with a derivative of phage H-19B encoding Stx1, while To ´th et al. (55) were able to lysogenize a porcine EPEC O45 strain with a derivative of an Stx2-encoding phage in porcine ligated ileal loops. The results of these transduction experiments are consistent with the idea that EHEC emerged from EPEC by the acquisition of stx genes. Recently, Mellmann et al. (38) reported the loss of Stx phages from some EHEC strains in HUS patients within a short interval. Comparative molecular analyses of the E. coli strains isolated from original and sequential stool samples from 210 HUS patients revealed that of the 137 stx- and eae-positive E. coli strains originally isolated, 6 strains lost their Stx phages. Five of these six strains were serotype O26:H11, and one was O157:NM.
TYPICAL AND ATYPICAL E. COLI O157 STRAINS
6289
Bielaszewska et al. (10) also verified the gain and loss of the stx gene in E. coli O26 in vitro. We observed a similar spontaneous loss of the stx2 gene during the storage of one of our EHEC O157 strains (data not shown). Although our atypical E. coli O157 strains did not carry stx and/or eae genes, five atypical O157 strains carried cdt-VABC genes and produced CDT. It was reported previously that the cdt-V allele is present in the majority of sorbitol-fermenting E. coli O157:NM strains (27) and in 5% of non-O157 EHEC clinical isolates (8). CDT-V occurs frequently in EHEC serotypes O113:H21 and O91:H21, the rare eae-negative EHEC types that cause HUS (31). These data suggest that CDT may contribute to the pathogenicity of eae-negative EHEC. Previously, Friedrich et al. (19) identified cdt-V in 4.9% of “classical” non-sorbitol-fermenting EHEC O157:H7 strains. The cdt-V EHEC O157:H7 strains belonged to five different PTs, including PT2, PT4, PT8, PT14, and PT34. Here, we report CDT-V production by non-sorbitol-fermenting O157 strains. The fact that these atypical O157 strains lack not only eae but also all the known key virulence genes underlines the virulence potential of CDT-V in E. coli O157:H37/H9. Furthermore, the CDT-V-producing atypical E. coli O157 strains harbored the major fimbrial subunit gene lpfA as well. The presence of polar fimbria genes in the CDT-V-producing strains may also be an important virulence characteristic since lpfO113 was reported to function as an adhesin in LEE-negative isolates of O113:H21 EHEC (15). These CDT-producing strains may represent a potentially novel clone, as demonstrated by PFGE and MLST. E. coli O157 strains that lack Shiga toxin genes (stx) and the EPEC adherence factor plasmid are classified as atypical EPEC and cause diarrhea worldwide, especially in children. In our case, the bovine EPEC O157 strains isolated from healthy cattle resembled EHEC O157 strains on the basis of their serotypes and virulence gene profiles, and their multilocus sequence types were identical to those of the investigated stxand eae-positive O157 (EHEC) strains, suggesting the zoonotic potential of these bovine EPEC O157 strains. Thus, our results confirm the recently published results of Bielaszewska et al. (9), who gave epidemiological and clinical evidence for the pathogenic significance of stx-negative atypical EPEC O157 strains in human patients with bloody diarrhea. Furthermore, they also stated that these stx-negative, EPEC adherence factor-negative attaching and effacing O157 strains are most likely former EHEC strains that lost Shiga toxin genes during infection, and they termed them EHEC-LST. Similarly, Friedrich et al. (20) were able to isolate strains of stx-negative E. coli O157 from stool samples obtained from patients with uncomplicated diarrhea and from HUS patients. The bovine E. coli O157 strains described in our study represent different pathotypes, including EHEC, EPEC O157:H7, and atypical O157, and most of them possess virulence genes with zoonotic potential. These results indicate that in addition to the typical EHEC strains, the bovine O157 EPEC and CDTV-producing atypical O157 strains deserve attention. Based on these observations, we conclude that calves and cattle represent important reservoirs of eae-positive E. coli O157 and that CDT-producing lpfO113-positive O157 strains may represent a novel pathogroup of E. coli O157 with virulence potential for animals and humans.
6290
´ TH ET AL. TO
APPL. ENVIRON. MICROBIOL.
ACKNOWLEDGMENTS This study was supported by grants from NKTH (4/040/2001), EU NoEs EPG, and MedVetNET. Short-term mission support by MedVetNet for I.T. is also acknowledged. We thank Ma´rta Puruczki (Budapest) and Marcus Kranz (Stuttgart) for skillful technical assistance and Roberto La Ragione for the PCR primers. We also thank Noe´mi No ´gra´dy for testing antimicrobial resistance and Vic Norris for critical reading of the manuscript. REFERENCES 1. Abbott, J. D., and R. Shannon. 1958. A new method for typing Shigella sonnei using colicin production as a marker. J. Clin. Pathol. 11:71–77. 2. Acheson, D. W., J. Reidl, X. Zhang, G. T. Keusch, J. J. Mekalanos, and M. K. Waldor. 1998. In vivo transduction with Shiga toxin 1-encoding phage. Infect. Immun. 66:4496–4498. 3. Arbeloa, A., M. Blanco, F. C. Moreira, R. Bulgin, C. Lo ´pez, G. Dahbi, J. E. Blanco, A. Mora, M. P. Alonso, R. C. Mamani, T. A. Gomes, J. Blanco, and G. Frankel. 2009. Distribution of espM and espT among enteropathogenic and enterohaemorrhagic Escherichia coli. J. Med. Microbiol. 58:988–995. 4. Arbeloa, A., R. R. Bulgin, G. MacKenzie, R. K. Shaw, M. J. Pallen, V. F. Crepin, C. N. Berger, and G. Frankel. 2008. Subversion of actin dynamics by EspM effectors of attaching and effacing bacterial pathogens. Cell. Microbiol. 10:1429–1441. 5. Bandelt, H. J., and A. W. Dress. 1992. Split decomposition: a new and useful approach to phylogenetic analysis of distance data. Mol. Phylogenet. Evol. 1:242–252. 6. Battistoni, A. 2003. Role of prokaryotic Cu,Zn superoxide dismutase in pathogenesis. Biochem. Soc. Trans. 31:1326–1329. 7. Beutin, L., S. Kaulfuss, S. Herold, E. Oswald, and H. Schmidt. 2005. Genetic analysis of enteropathogenic and enterohemorrhagic Escherichia coli serogroup O103 strains by molecular typing of virulence and housekeeping genes and pulsed-field gel electrophoresis. J. Clin. Microbiol. 43:1552–1563. 8. Bielaszewska, M., M. Fell, L. Greune, R. Prager, A. Fruth, H. Tscha ¨pe, M. A. Schmidt, and H. Karch. 2004. Characterization of cytolethal distending toxin genes and expression in Shiga toxin-producing Escherichia coli strains of non-O157 serogroups. Infect. Immun. 72:1812–1816. 9. Bielaszewska, M., B. Middendorf, R. Ko ¨ck, A. W. Friedrich, A. Fruth, H. Karch, M. A. Schmidt, and A. Mellmann. 2008. Shiga toxin-negative attaching and effacing Escherichia coli: distinct clinical associations with bacterial phylogeny and virulence traits and inferred in-host pathogen evolution. Clin. Infect. Dis. 47:208–217. 10. Bielaszewska, M., R. Prager, R. Ko ¨ck, A. Mellmann, W. Zhang, H. Tscha ¨pe, P. I. Tarr, and H. Karch. 2007. Shiga toxin gene loss and transfer in vitro and in vivo during enterohemorrhagic Escherichia coli O26 infection in humans. Appl. Environ. Microbiol. 73:3144–3150. 11. Bulgin, R. R., A. Arbeloa, J. C. S. Chung, and G. Frankel. 2009. EspT triggers formation of lamellipodia and membrane ruffles through activation of Rac-1 and Cdc42. Cell. Microbiol. 11:217–229. 12. Caprioli, A., S. Morabito, H. Brugereb, and E. Oswald. 2005. Enterohaemorrhagic Escherichia coli: emerging issues on virulence and modes of transmission. Vet. Res. 36:289–311. 13. China, B., V. Pirson, and J. Mainil. 1996. Typing of bovine attaching and effacing Escherichia coli by multiplex in vitro amplification of virulenceassociated genes. Appl. Environ. Microbiol. 62:3462–3465. 14. D’Orazio, M., R. Scotti, L. Nicolini, L. Cervoni, G. Rotilio, A. Battistoni, and R. Gabbianelli. 2008. Regulatory and structural properties differentiating the chromosomal and the bacteriophage-associated Escherichia coli O157:H7 Cu,Zn superoxide dismutases. BMC Microbiol. 8:166. 15. Doughty, S., J. Sloan, V. Bennett-Wood, M. Robertson, R. M. RobinsBrowne, and E. L. Hartland. 2002. Identification of a novel fimbrial gene cluster related to long polar fimbriae in locus of enterocyte effacementnegative strains of enterohemorrhagic Escherichia coli. Infect. Immun. 70: 6761–6769. 16. Fields, P. I., K. Blom, H. J. Hughes, L. O. Helsel, P. Feng, and B. Swaminathan. 1997. Molecular characterization of the gene encoding H antigen in Escherichia coli and development of a PCR-restriction fragment length polymorphism test for identification of E. coli O157:H7 and O157:NM. J. Clin. Microbiol. 35:1066–1070. 17. Franke, J., S. Franke, H. Schmidt, A. Schwarzkopf, L. H. Wieler, G. Baljer, L. Beutin, and H. Karch. 1994. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J. Clin. Microbiol. 32:2460–2463. 18. Friedrich, A. W., R. Ko ¨ck, M. Bielaszewska, W. Zhang, H. Karch, and W. Mathys. 2005. Distribution of the urease gene cluster among and urease activities of enterohemorrhagic Escherichia coli O157 isolates from humans. J. Clin. Microbiol. 43:546–550. 19. Friedrich, A. W., S. Lu, M. Bielaszewska, R. Prager, P. Bruns, J. G. Xu, H. Tscha ¨pe, and H. Karch. 2006. Cytolethal distending toxin in Escherichia coli
20.
21.
22.
23.
24.
25. 26.
27.
28.
29. 30. 31. 32.
33. 34.
35.
36.
37.
38.
39.
40.
41. 42.
O157:H7: spectrum of conservation, structure, and endothelial toxicity. J. Clin. Microbiol. 44:1844–1846. Friedrich, A. W., W. Zhang, M. Bielaszewska, A. Mellmann, R. Ko ¨ck, A. Fruth, H. Tscha ¨pe, and H. Karch. 2007. Prevalence, virulence profiles, and clinical significance of Shiga toxin-negative variants of enterohemorrhagic Escherichia coli O157 infection in humans. Clin. Infect. Dis. 45:39–45. Garmendia, J., Z. Ren, S. Tennant, M. A. Midolli Viera, Y. Chong, A. Whale, K. Azzopardi, S. Dahan, M. P. Sircili, M. R. Franzolin, L. R. Trabulsi, A. Phillips, T. A. Gomes, J. Xu, R. Robins-Browne, and G. Frankel. 2005. Distribution of tccP in clinical enterohemorrhagic and enteropathogenic Escherichia coli isolates. J. Clin. Microbiol. 43:5715–5720. Gunzburg, S. T., N. G. Tornieporth, and L. W. Riley. 1995. Identification of enteropathogenic Escherichia coli by PCR-based detection of the bundleforming pilus gene. J. Clin. Microbiol. 33:1375–1377. Hall, T. A. 2004. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41:95–98. Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K. Yokoyama, C. Han, E. Ohtsubo, K. Nakayama, T. Murata, M. Tanaka, T. Tobe, T. Iida, H. Takami, T. Honda, C. Sasakawa, N. Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H. Shinagawa. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res. 8:11–22. Huson, D. H. 1998. SplitsTree: analyzing and visualizing evolutionary data. Bioinformatics 14:68–73. James, C. E., K. N. Stanley, H. E. Allison, H. J. Flint, C. S. Stewart, R. J. Sharp, J. R. Saunders, and A. J. McCarthy. 2001. Lytic and lysogenic infection of diverse Escherichia coli and Shigella strains with a verocytotoxigenic bacteriophage. Appl. Environ. Microbiol. 67:4335–4337. Janka, A., M. Bielaszewska, U. Dobrindt, L. Greune, M. A. Schmidt, and H. Karch. 2003. Cytolethal distending toxin gene cluster in enterohemorrhagic Escherichia coli O157:H⫺ and O157:H7: characterization and evolutionary considerations. Infect. Immun. 71:3634–3638. Janka, A., M. Bielaszewska, U. Dobrindt, and H. Karch. 2002. Identification and distribution of the enterohemorrhagic Escherichia coli factor for adherence (efa1) gene in sorbitol-fermenting Escherichia coli O157:H⫺. Int. J. Med. Microbiol. 292:207–214. Kaper, J. B., and M. A. Karmali. 2008. The continuing evolution of a bacterial pathogen. Proc. Natl. Acad. Sci. USA 105:4535–4536. Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2:123–140. Karch, H., P. I. Tarr, and M. Bielaszewska. 2005. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol. 295:405–418. Karmali, M. A., M. Mascarenhas, S. Shen, K. Ziebell, S. Johnson, R. ReidSmith, J. Isaac-Renton, C. Clark, K. Rahn, and J. B. Kaper. 2003. Association of genomic O island 122 of Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes that are linked to epidemic and/or serious disease. J. Clin. Microbiol. 41:4930–4940. Khakria, R., D. Duck, and H. Lior. 1990. Extended phage-typing scheme for Escherichia coli O157:H7. Epidemiol. Infect. 105:511–520. Ko ¨hler, B., H. Karch, and H. Schmidt. 2000. Antibacterials that are used as growth promoters in animal husbandry can affect the release of Shiga-toxin2-converting bacteriophages and Shiga toxin 2 from Escherichia coli strains. Microbiology 146:1085–1090. Lejeune, J. T., S. T. Abedon, K. Takemura, N. P. Christie, and S. Sreevatsan. 2004. Human Escherichia coli O157:H7 genetic marker in isolates of bovine origin. Emerg. Infect. Dis. 10:1482–1485. Lin, Z., H. Kurazono, S. Yamasaki, and Y. Takeda. 1993. Detection of various variant verotoxin genes in Escherichia coli by polymerase chain reaction. Microbiol. Immunol. 37:543–548. Marche`s, O., V. Covarelli, S. Dahan, C. Cougoule, P. Bhatta, G. Frankel, and E. Caron. 2008. EspJ of enteropathogenic and enterohaemorrhagic Escherichia coli inhibits opsono-phagocytosis. Cell. Microbiol. 10:1104–1115. Mellmann, A., M. Bielaszewska, L. B. Zimmerhackl, R. Prager, D. Harmsen, H. Tscha ¨pe, and H. Karch. 2005. Enterohemorrhagic Escherichia coli in human infection: in vivo evolution of a bacterial pathogen. Clin. Infect. Dis. 41:785–792. Morabito, S., R. Tozzoli, E. Oswald, and A. Caprioli. 2003. A mosaic pathogenicity island made up of the locus of enterocyte effacement and a pathogenicity island of Escherichia coli O157:H7 is frequently present in attaching and effacing E. coli. Infect. Immun. 71:3343–3348. Nakano, M., T. Iida, M. Ohnishi, K. Kurokawa, A. Takahashi, T. Tsukamoto, T. Yasunaga, T. Hayashi, and T. Honda. 2001. Association of the urease gene with enterohemorrhagic Escherichia coli strains irrespective of their serogroups. J. Clin. Microbiol. 39:4541–4543. Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142–201. Ogura, Y., T. Ooka, A. Whale, J. Garmendia, L. Beutin, S. Tennant, G. Krause, S. Morabito, I. Chinen, T. Tobe, H. Abe, R. Tozzoli, A. Caprioli, M. Rivas, R. Robins-Browne, T. Hayashi, and G. Frankel. 2007. TccP2 of O157:H7 and non-O157 enterohemorrhagic Escherichia coli (EHEC): chal-
VOL. 75, 2009
43.
44.
45.
46.
47.
48.
49.
lenging the dogma of EHEC-induced actin polymerization. Infect. Immun. 75:604–612. Ohnishi, M., J. Terajima, K. Kurokawa, K. Nakayama, T. Murata, K. Tamura, Y. Ogura, H. Watanabe, and T. Hayashi. 2002. Genomic diversity of enterohemorrhagic Escherichia coli O157 revealed by whole genome PCR scanning. Proc. Natl. Acad. Sci. USA 99:17043–17048. Orskov, F., and I. Orskov. 1984. Serotyping of Escherichia coli, p. 43–112. In T. Bergan (ed.), Methods in microbiology, vol. 14. Academic Press, London, United Kingdom. Oswald, E., H. Schmidt, S. Morabito, H. Karch, O. Marches, and A. Caprioli. 2000. Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun. 68:64–71. Parreira, V. R., J. H. Liao, S. H. Kim, and C. L. Gyles. 2008. A homolog of the O157 urease-encoding O island 48 is present in porcine O149:H10 enterotoxigenic Escherichia coli. Vet. Res. 39:38. Paton, A. W., and J. C. Paton. 1998. Detection and characterization of Shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. J. Clin. Microbiol. 36:598–602. Perna, N. T., G. Plunkett III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529–533. Rahn, K., J. B. Wilson, K. A. McFadden, S. C. Read, A. G. Ellis, S. A. Renwick, R. C. Clarke, and R. P. Johnson. 1996. Comparison of Vero cell assay and PCR as indicators of the presence of verocytotoxigenic Escherichia coli in bovine and human fecal samples. Appl. Environ. Microbiol. 62:4314– 4317.
TYPICAL AND ATYPICAL E. COLI O157 STRAINS
6291
50. Schmidt, H., M. Bielaszewska, and H. Karch. 1999. Transduction of enteric Escherichia coli isolates with a derivative of Shiga toxin 2-encoding bacteriophage ⌽3538 isolated from Escherichia coli O157:H7. Appl. Environ. Microbiol. 65:3855–3861. 51. Schubert, S., A. Rakin, H. Karch, E. Carniel, and J. Heesemann. 1998. Prevalence of the “high pathogenicity island” of Yersinia species among Escherichia coli strains that are pathogenic to humans. Infect. Immun. 66: 480–485. 52. Taylor, D. E., M. Rooker, M. Keelan, L. K. Ng, I. Martin, N. T. Perna, N. T. Burland, and F. R. Blattner. 2002. Genomic variability of O islands encoding tellurite resistance in enterohemorrhagic Escherichia coli O157:H7 isolates. J. Bacteriol. 184:4690–4698. 53. To ´th, I., M. Csík, and L. Emo ˝dy. 2003. Spontaneous antibiotic resistance mutation associated pleiotropic changes in Escherichia coli O157:H7. Acta Vet. Hung. 51:29–44. 54. To ´th, I., F. Herault, L. Beutin, and E. Oswald. 2003. Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J. Clin. Microbiol. 41:4285–4291. 55. To ´th, I., H. Schmidt, M. Dow, A. Malik, E. Oswald, and B. Nagy. 2003. Transduction of porcine enteropathogenic Escherichia coli with a derivative of a Shiga toxin 2-encoding bacteriophage in a porcine ligated ileal loop system. Appl. Environ. Microbiol. 69:7242–7247. 56. Vlisidou, I., O. Marche´s, F. Dziva, R. Mundy, G. Frankel, and M. P. Stevens. 2006. Identification and characterization of EspK, a type III secreted effector protein of enterohaemorrhagic Escherichia coli O157:H7. FEMS Microbiol. Lett. 263:32–40. 57. Wieler, L. H., M. Tigges, F. Ebel, S. Scha ¨ferkordt, S. Djafari, T. Schlapp, G. Baljer, and T. Chakraborty. 1996. The enterohemolysin phenotype of bovine Shiga-like toxin-producing Escherichia coli (SLTEC) is encoded by the EHEC-hemolysin gene. Vet. Microbiol. 52:153–164.
