Antonie van Leeuwenhoek (2009) 96:441–457 DOI 10.1007/s10482-009-9358-z
ORIGINAL PAPER
Virulotyping of Salmonella enterica subsp. enterica isolated from indigenous vegetables and poultry meat in Malaysia using multiplex-PCR Chai-Hoon Khoo Æ Yoke-Kqueen Cheah Æ Learn-Han Lee Æ Jiun-Horng Sim Æ Noorzaleha Awang Salleh Æ Shiran Mohd Sidik Æ Son Radu Æ Sabrina Sukardi
Received: 8 December 2008 / Accepted: 11 June 2009 / Published online: 30 June 2009 Ó Springer Science+Business Media B.V. 2009
Abstract The increased occurrence of Salmonella occurrence in local indigenous vegetables and poultry meat can be a potential health hazards. This study is aimed to detect the prevalence of twenty different virulence factors among Salmonella enterica strains isolated from poultry and local indigenous vegetables in Malaysia via an optimized, rapid and specific multiplex PCR assay. The assay encompasses a total of 19 Salmonella pathogenicity islands genes and a quorum sensing gene (sdiA) in three multiplex reaction sets. A total of 114 Salmonella enterica isolates
C.-H. Khoo Y.-K. Cheah (&) L.-H. Lee J.-H. Sim S. Sukardi Department of Biomedical Science, Faculty of Medicine and Health Sciences, University Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia e-mail:
[email protected];
[email protected] N. A. Salleh Department of Chemistry Malaysia, Section of Biotechnology, Unit Microbiology, Jalan Sultan, 46661 Petaling Jaya, Selangor, Malaysia S. M. Sidik Department of Pathology, Faculty of Medicine and Health Sciences, University Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia S. Radu Department of Food Science, Faculty of Food Science and Technology, University Putra Malaysia, 43400 UPM Serdang, Selangor Darul Ehsan, Malaysia
belonging to 38 different serovars were tested. Each isolate in under this study was found to possess up to 70% of the virulence genes tested and exhibited variable pathogenicity gene patterns. Reproducibility of the multiplex PCR assay was found to be 100% and the detection limit of the optimized multiplex PCR was tested with lowest detectable concentration of DNA 0.8 pg ll-1. This study demonstrated various Salmonella pathogenicity island virulence gene patterns even within the same serovar. This sets of multiplex PCR system provide a fast and reliable typing approach based on Salmonella pathogenicity islands, thus enabling an effective monitoring of emerging pathogenic Salmonella strains as an additional tool in Salmonella surveillance studies. Keywords Virulotyping Salmonella enterica Salmonella pathogenicity islands (SPIs) Multiplex PCR
Introduction Salmonella is one of the primary causes of bacterial foodborne infections in humans that continues to be a global problem (Soumet et al. 1999; Yoke-Kqueen et al. 2008). There are over 1.3 billion foodborne diarrhea cases occurred worldwide annually, resulting in 3 million deaths (Mastropeni and Maskell 2006). In Malaysia, the incidence rate of foodborne disease is
123
442
about 8,640 cases reported by the Ministry of Health for the year 1999, where 811 (9.4%) cases were due to Salmonella infections (Thong et al. 2002). Most Salmonella enterica serovars can cause illnesses in humans. Ingestion of live Salmonella in food leads to salmonellosis, which includes gastroenteritis and typhoid fever, depending on the nature of the infected host and on the serovar of the infecting bacteria (Blanc-Potard et al. 1999). Besides raw and undercooked meat, poultry, eggs, and dairy products as the primary source of human salmonellosis, there are also increasing reports of outbreaks associated with vegetables and fresh fruit (Thong et al. 2002; Noorzaleha et al. 2003). An outbreak of 1,196 cases of salmonellosis nationwide caused by Salmonella serovar Saintpaul (S. Saintpaul), an uncommon Salmonella type occurred in 2008 in 42 states of United States and District of Columbia. At least 69 hospitalized cases were reported. This outbreak was linked to consumption of certain raw red plums, red Roma or red round tomatoes, and products containing these raw tomatoes (CDC 2008; FDA 2008). In Malaysia, several types of fresh indigenous vegetables are consumed raw in locally known ‘‘ulam’’ which is equivalent to salad in western countries. The indigenous vegetables commonly in Malaysian is the ‘‘ulam’’ are mostly gathered from natural growth and eaten either fresh as salad, blanched cooked as pot herbs, or cooked to impart a distinct flavor to dishes which are popular among the Malay ethnic people (AVRDC 2004; Yoke-Kqueen et al. 2008). These include ‘selom’ (Oenanthe stolonifera), ‘pegaga’ (Centella asiatica), ‘kesum’ (Polygonum minus) and ‘kangkong’ (Ipomoea aquatica). The contamination of vegetables with Salmonella is common in areas where raw or untreated waste water is used for irrigation (Ait Melloul et al. 2001). Therefore, the growing consumption of minimally processed fresh vegetables has led into an increase number of foodborne diseases outbreaks (Anon 2002). However, salmonellosis that is associated with isolates from vegetable sources is not commonly reported in Malaysia. Salmonella infections exhibit a complex pathogenesis and the etiology of salmonellosis mostly relies on multiple genes for full virulence with many of these genes clustered within Salmonella pathogenicity islands [SPIs] (Hensel 2004; Soto et al. 2006). According to Marcus et al. (2000), SPIs are large
123
Antonie van Leeuwenhoek (2009) 96:441–457
gene cassettes within the Salmonella chromosome that encode determinants responsible for establishing specific interactions with the host and contributes to a particular virulence phenotype. The concentration of these virulence genes in cassettes of the genome probably indicates that the acquisition of the genes occurred by horizontal transfer from inter and intraspecies that are then integrated into the chromosome. The newly acquired genes are preserved by vertical transfer within in a single pathogenic clone (Salama and Falkow 1999; Courtney et al. 2006). SPI 1 and SPI 2 each encode distinct type III secretion systems which consist of many components, including more than twenty proteins, some of which are homologous to those involved in flagellar assembly. The type III secretion systems deliver effector proteins that are unique to each pathogen into the host cell cytosol and which contribute to the specific virulence phenotypes (Marcus et al. 2000). By delivery of these effectors, SPI 1 enables Salmonella to efficiently penetrate into the intestinal epithelium and induce apoptosis in macrophages (Lostroh and Lee 2001; Courtney et al. 2006). On the other hand, SPI 2 encodes genes that are essential for intracellular replication and growth inside host epithelial cells and macrophages for the establishment of systemic diseases (Shea et al. 1996). SPI 3 is believed to be necessary for the survival in a low Mg2? environment within macrophages during the systemic phase of the disease. Recently, SPI 4 has been suspected to play a vital role in the invasion of cultured epithelial cells (Marcus et al. 2000). Finally, SPI 5 genes encode proteins that are associated with enteropathogenesis which is most likely involved in fluid secretion and neutrophil recruitment (Fierer and Guiney 2001). To date, there is no major report published on any outbreak of food poisoning caused by Salmonella in Malaysia. However, according to previous studies the incidence of Salmonella species isolated from humans, animals and food sources in Malaysia has increased noticeably (Jegathesan et al. 1993; Yee and Ayob 1994; Son et al. 1995; Rusul et al. 1996; Sahilah et al. 2000). Therefore, this study was undertaken to gather information about different serovars of S. enterica recovered from local indigenous vegetable and poultry meat, focusing on virulence factor gene identification by multiplex PCR targeting SPI genes.
Antonie van Leeuwenhoek (2009) 96:441–457
Materials and methods Bacterial strains and growth conditions A total of 116 S. enterica isolates (2 reference strains and 114 from food sources) as shown in Table 1 were included in this study. All Salmonella isolates from food sources were recovered from poultry meat (commercial chickens) and indigenous vegetables (wet markets) around Selangor state, Malaysia in the year of 2000. No specific criteria were applied in the sample selection. The Salmonella isolates were presumptively identified and then forwarded to the Chemistry Department of Malaysia. The Chemistry Department of Malaysia is a national reference laboratory for microbiology food testing in Malaysia. Serotyping of the Salmonella isolates were carried out by the Veterinary Research Institute (Ipoh, Malaysia). Multiplex PCR Genomic DNA was isolated using the RBC Genomic DNA extraction kit (Realbiotech, Taiwan) according to the manufacturer’s protocol. The concentration and purity of the isolated DNA was measured using the Biophotometer system (Eppendorf, Hamburg, Germany). Virulence factors in SPI 7 to SPI 10 are not included in this study as they are less stable than SPI 1 to SPI 5 according to Hensel (2004). Primers for the SPI 1 to SPI 5 and a quorum sensing gene used in the PCR assays to detect different virulence genes are shown in Table 2. The primers were first assessed in a singleplex PCR and followed by the multiplex PCR format. Two sets of Heptaplex PCR and a set of Hexaplex PCR were developed using an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany). The final 50 ll reaction conditions of the multiplex PCR consisted of 20 ng of DNA, 19 PCR buffer with 2 mM MgCl2, 50 mM KCl and 10 mM Tris–HCl, 0.8 mM dNTPs, 3 unit of Taq polymerase (Intron, Korea) and primer’s (Sigma, Singapore) concentration as in Table 1 (0.06–0.6 lM). A three step PCR amplification process with 30 cycles was performed in an Eppendorf Mastercycler (Eppendorf, Germany) with the program listed according in Table 2. A non template control was included in each run. The amplified PCR products were resolved by electrophoresis in 3.5% agarose gel (Bioline, London, UK) for 90 min with 110 V and 0.05 mAmps, which was then
443
stained with ethidium bromide (0.5 lg ml-1) and the amplified DNA fragments were visualized under a gel documentation system (Alpha Imager, Alpha Innotech, U.S.A). Several reference cultures from the American Type Culture Collection (ATCC14028, ATCC9150) were also included as positive controls. Each of the different PCR amplification products were purified and subjected to sequencing analysis for confirmation. The multiplex PCR set assays were repeated three times with the same method as mentioned above to assess reproducibility. This assessment also involved the use of multiplex PCR on different days and different biological preparations of the same strain. In addition, a tenfold serial dilution of 80 ng/ll initial extracted S. enterica DNA was performed with the multiplex PCR for the sensitivity testing. Concentration of the diluted DNA was determined using a Biophotometer (Eppendorf, Hamburg, Germany). A total of three amplicons of a specific gene amplifications were subjected to direct sequencing reaction using a BigDye Terminator cycle sequencing kit with AmpliTaq DNA polymerase in ABI 3730 XL DNA Analyzer (Applied Biosystem, Foster City, California). The positive bands detected after from gel electrophoresis were analyzed by band matching using Bionumerics version 5.10 software (Applied Maths, Kortrijk, Belgium) to generate a dendrogram for a better clustering view. The discriminatory power of virulotyping was determined by calculating the discriminatory index using Simpson’s index of diversity, as described by Hunter (1990).
Results and discussion Multiplex PCR is an essential tool for the a high throughput screening of pathogenic genes in bacteria which allows the simultaneous amplification of more than one target sequence in a single PCR reaction (Elnifro et al. 2000; Jofre´ et al. 2005; Trafny et al. 2006). However, designing and optimizing multiplex PCR primers with regards to annealing temperatures, combination, distinguishable product size and high specificity without mispriming is complicated. In this study, three set of the multiplex PCR namely two sets of Heptaplex PCR and a set of Hexaplex PCR derived from a careful selection and combination of primers were evaluated on a collection of 116 S. enterica
123
123
ATCC9150 (American Type Culture Collection) ATCC14028 (American Type Culture Collection)
S. Paratyphi A ATCC9150 S. Typhimurium ATCC14028
Ke 1 (C), Ke 2 (C), Ke 3 (C)
Kr 1 (M), Kr 2 (M), Kr 3 (M)
Ma 1 (S), Ma 2 (S), Ma 3 (S)
Mb 1 (S), Mb 2 (S), Mb 3 (S)
Mg 1 (C), Mg 2 (G), Mg 3 (G)
Pb 1 (S), Pb 2 (S), Pb 3 (S)
Ri 1 (S), Ri 2 (S), Ri 3 (S)
Sh 1 (P), Sh 2 (P), Sh 3 (P) Sw 1 (P), Sw 2 (P), Sw 3 (P)
Tl 1 (M), Tl 2 (M), Tl 3 (M)
Ta 1 (M), Ta 2 (M), Ta 3 (M)
Vi 1 (P), Vi 2 (P), Vi 3 (P)
Ag 1(M), Ag 2(S), Ag 3 (P)
We 1(S), We 2(S), We 3 (S)
Hi 1 (C), Hi 2 (C), Hi 3 (C)
S. Kentucky
S. Kralingen
S. Matopeni
S. Mbandaka
S. Mgulani
S. Paratyphi B
S. Richmond
S. Shipley S. Swarzengrund
S. Tallahassee
S. Tananarive
S. Virginia
S. Agona
S. Weltevreden
S. Haifa
S. Bareilly
S. Arizonae
S. Albany
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
? ?
Ba 3 (M)
?
Ar 3 (P)
Ba 1 (M), Ba 2(M)
?
Ar 1 (P), Ar 2 (P)
?
In 1 (G), In 2 (G), In 3 (G)
S. Infantis
?
?
Hv 1 (C), Hv 2 (C), Hv 3 (C)
S. Hvitingtoss
?
Al 2 (S)
Hf 1 (P), Hf 2 (P), Hf 3 (P)
S. Hartford
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
-
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
orgA
sopE
-
?
-
?
?
?
?
-
-
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? -
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
sifA
hilD
hilA
hilC
SPI 2
SPI 1
Virulence associated genes
Al 1 (G), Al 3 (P)
Hr 1(C), Hr 2(C), Hr 3(P)
S. Hadar
Heterogenous patterne
Am 1 (G), Am 2 (G), Am 3 (G)
S. Amager
Homogenous patternd
Isolates code and sourcesa
Salmonella serovars
Table 1 Distribution of virulence factors found among Salmonella enterica serovars by multiplex PCR
-
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
ssrB
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
ttrB
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
mgtC
SPI 3
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
misL
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
rhuM
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
rmbA
444 Antonie van Leeuwenhoek (2009) 96:441–457
S. Typhimurium
S. Stanley
S. Senftenberg
S. Saintpaul
? ?
Ty 3 (P)
?
St 3 (S)
Ty 1 (S), Ty 2 (P)
?
?
Se 3 (S)
St 1 (S), St 2 (S)
?
?
Sp 3 (P)
Se 1 (G), Se 2 (S)
?
?
Sd 3 (S)
Sp 1 (G), Sp 2 (M)
?
?
Sd 1 (S), Sd 2 (S)
Ne 3 (S)
S. Sada
?
Ne 1 (S), Ne 2 (S)
S. Newport
? ?
?
Mo 1 (C), Mo 2(C) Mo 3 (C)
?
It 1 (C)
It 2 (C), It 3 (C)
?
Ht 2 (P), Ht 3 (P)
? ?
Ht 1 (P)
En 3 (P)
? ?
En 1 (P), En 2 (P)
Em 3(S)
? ?
Bn 3 (S)
Em 1(S), Em 2(S)
?
Bn 1 (S), Bn 2 (S)
?
Bd 3 (P)
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
-
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
-
?
-
?
-
?
?
?
?
?
? -
-
?
-
?
-
?
-
?
-
?
?
?
?
?
?
?
?
-
?
-
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
-
?
?
?
?
?
?
?
?
?
-
?
? -
?
?
?
?
?
?
-
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
-
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
-
?
?
?
-
?
?
?
Bo 3 (S) ?
? ? ? ?
? ?
? ?
? ?
? ?
? ?
? -
? ?
? ?
? ?
? ?
Bo 1 (S) Bo 2 (S)
Bd 1 (P), Bd 2 (P)
rmbA
rhuM
misL
mgtC
ttrB
ssrB
sifA
sopE
orgA
hilD
hilC
hilA
SPI 3
SPI 2
Virulence associated genes SPI 1
Isolates code and sourcesa
S. Molade
S. Ituri
S. Haardt
S. Enteriditis
S. Emek
S. Brunei
S. Braenderup
S. Bovismorbiscans
Salmonella serovars
Table 1 continued
Antonie van Leeuwenhoek (2009) 96:441–457 445
123
123 Wa 1(M), Wa 2(M) Wa 3 (M)
Isolates code and sourcesa
ATCC9150 (American Type Culture Collection)
ATCC14028 (American Type Culture Collection)
S. Paratyphi A ATCC9150
S. Typhimurium ATCC14028
Am 1 (G), Am 2 (G), Am 3 (G)
Hr 1(C), Hr 2(C), Hr 3(P)
Hf 1 (P), Hf 2 (P), Hf 3 (P)
Hv 1 (C), Hv 2 (C), Hv 3 (C) In 1 (G), In 2 (G), In 3 (G)
Ke 1 (C), Ke 2 (C), Ke 3 (C)
Kr 1 (M), Kr 2 (M), Kr 3 (M)
Ma 1 (S), Ma 2 (S), Ma 3 (S)
Mb 1 (S), Mb 2 (S), Mb 3 (S)
Mg 1 (C), Mg 2 (G), Mg 3 (G)
Pb 1 (S), Pb 2 (S), Pb 3 (S)
Ri 1 (S), Ri 2 (S), Ri 3 (S)
Sh 1 (P), Sh 2 (P), Sh 3 (P)
Sw 1 (P), Sw 2 (P), Sw 3 (P)
Tl 1 (M), Tl 2 (M), Tl 3 (M)
Ta 1 (M), Ta 2 (M), Ta 3 (M)
Vi 1 (P), Vi 2 (P), Vi 3 (P)
S. Amager
S. Hadar
S. Hartford
S. Hvitingtoss S. Infantis
S. Kentucky
S. Kralingen
S. Matopeni
S. Mbandaka
S. Mgulani
S. Paratyphi B
S. Richmond
S. Shipley
S. Swarzengrund
S. Tallahassee
S. Tananarive
S. Virginia
Homogenous patternd
Isolates code and sources
Salmonella serovars
a
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
pipA
orfL
Spi4-F
SPI 5
SPI 4
Virulence associated genes
Percentage of the specific virulence associated gene among isolates used in this study (%)f
S. Wandsworth
Salmonella serovars
Table 1 continued
SPI 2
SPI 3
100
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
pipB
100
? ? 100
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
pipD
97
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
sopB
83
? 98
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
sopD
95
? -
? ?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
Quorum sensing gene sdiA
100 99
? ?
100
? ?
100
? ?
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100)
XX (100) XX (100)
XX (100)
XX (100)
XX (100)
XIXA (95)
XX (100)
Virulence patternb and relative virulence (%)c
100
? ?
hilA hilC hilD orgA sopE sifA ssrB ttrB mgtC misL rhuM rmbA
SPI 1
Virulence associated genes
446 Antonie van Leeuwenhoek (2009) 96:441–457
S. Newport
? ?
Ne 3 (S)
?
Ne 1 (S), Ne 2 (S)
Mo 3 (C)
?
?
It 2 (C), It 3 (C)
S. Ituri
Mo 1 (C), Mo 2(C)
? ?
Ht 2 (P), Ht 3 (P) It 1 (C)
S. Molade
?
?
Ht 1 (P)
?
En 1 (P), En 2 (P)
?
En 3 (P)
?
Em 3(S)
?
Bn 3 (S)
Em 1(S), Em 2(S)
?
?
Bn 1 (S), Bn 2 (S)
?
Bd 1 (P), Bd 2 (P)
?
Bo 3 (S)
Bd 3 (P)
?
Bo 2 (S)
S. Haardt
S. Enteriditis
S. Emek
S. Brunei
S. Braenderup
?
?
Ba 3 (M)
S. Bareilly
Bo 1 (S)
? ?
S. Bovismorbiscans
?
Ar 3 (P) Ba 1 (M), Ba 2(M)
?
Al 2 (S)
Ar 1 (P), Ar 2 (P)
?
S. Arizonae
S. Albany
?
?
?
?
?
?
?
?
? ?
?
?
?
-
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
-
? -
?
?
?
?
?
?
?
-
?
?
?
?
?
? ?
?
?
?
-
?
?
pipA
orfL
Spi4-F
SPI 5
SPI 4
Virulence associated genes
Al 1 (G), Al 3 (P)
Hi 1 (C), Hi 2 (C), Hi 3 (C)
S. Haifa
Heterogenous pattern
We 1(S), We 2(S), We 3 (S)
S. Weltevreden
e
Ag 1(M), Ag 2(S), Ag 3 (P)
Isolates code and sourcesa
S. Agona
Salmonella serovars
Table 1 continued
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
pipB
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
pipD
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
-
?
?
?
? ?
?
-
?
?
?
?
sopB
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
sopD
?
?
?
?
?
? ?
?
?
?
?
?
?
?
?
?
?
?
?
?
? ?
?
?
?
?
?
?
Quorum sensing gene sdiA
XIXD (95)
XX (100)
XVIIIG (90)
XX (100)
XVIIIH (90)
XIXA (95) XIXB (95)
XX (100)
XIXA (95)
XX (100)
XVIIJ (85)
XX (100)
XIXA (95)
XX (100)
XIXB (95)
XX (100)
XVIII (85)
XIXA (95)
XX (100)
XVIIIG (90)
XVIIIF (90) XX (100)
XX (100)
XX (100)XIXC (95)
XIXB (95)
XIXA (95)
XIXA (95)
Virulence patternb and relative virulence (%)c
Antonie van Leeuwenhoek (2009) 96:441–457 447
123
123 94
?
?
?
? ?
?
?
?
?
?
?
?
100
?
?
?
? ?
?
?
?
?
?
?
?
100
?
?
?
? ?
?
?
?
?
?
?
?
97
-
?
?
? ?
?
?
?
-
?
?
?
100
?
?
?
? ?
?
?
?
?
?
?
?
100
?
?
?
? ?
?
?
?
?
?
?
?
Heterogenous pattern: diversified pattern of virulence-associated gene among serovars (38) group
Homogenous pattern: uniform pattern of virulence-associated gene among serovars (38) group
Relative virulence (%): dividing the number of ‘?’ virulence genes with the total number of tested virulence genes (20) and then multiplying by 100
Virulence pattern: total number of ‘?’ virulence genes within individual isolate (XX = 20; XIX = 19; XVIII = 18; XVII = 17; XIV = 14)
Sources: C, Pegaga; G, Kangkong; M, Kesum; S, Selom; P, Poultry
99
?
?
?
? ?
?
?
?
?
?
?
?
XVIIK (85)
XX (100)
XIXD (95)
XIXA (95) XX (100)
XX (100)
XIXA (95)
XX (100)
XIVL (70)
XX (100)
XIXE (95)
XX (100)
Different virulence associated genes profile in the XIX-virulence pattern
Different virulence associated genes profile in the XIV-virulence pattern
Different virulence associated genes profile in the XVII-virulence pattern
Different virulence associated genes profile in the XVIII-virulence pattern
Total number of isolates according to sources: Pegaga (C): 18, Kangkong (G): 12, Kesum (M): 18, Selom (S): 36, Poultry (P): 30
L
I,J,K
F,G,H
A,B,C,D,E
Percentage of the specific virulence associated gene among isolates used in this study (%): dividing the number of isolate with ‘?’ result of the specific virulence associated genes with the total number of isolates (116) and then multiplying by 100
f
e
d
c
b
99
?
Wa 3 (M)
Percentage of the specific virulence associated gene among isolates used in this study (%)
a
f
?
?
Ty 3 (P)
S. Typhimurium Wa 1(M), Wa 2(M)
? ?
S. Wandsworth
?
St 3 (S) Ty 1 (S), Ty 2 (P)
?
St 1 (S), St 2 (S)
?
Se 3 (S)
-
Se 1 (G), Se 2 (S)
?
Sp 3 (P)
?
Sp 1 (G), Sp 2 (M)
?
Sd 3 (S)
Virulence patternb and relative SPI 4 SPI 5 Quorum virulence (%)c sensing gene orfL Spi4-F pipA pipB pipD sopB sopD sdiA Virulence associated genes
Sd 1 (S), Sd 2 (S)
Isolates code and sourcesa
S. Stanley
S. Senftenberg
S. Saintpaul
S. Sada
Salmonella serovars
Table 1 continued
448 Antonie van Leeuwenhoek (2009) 96:441–457
SPI5
rhuM orfL pipA pipB
57°C: 1 min
72°C: 1 min
72°C: 5 min
Heptaplex Set I
SPI5
sopE
94°C: 1 min
SPI4 SPI5 Quorum sensing gene
ssrB misL Spi4-F sopB sdiA
55°C: 1 min
72°C: 1 min
72°C: 3 min
SPI3
SPI2
SPI2
sifA
94°C: 1 min
SPI1
hilC
94°C: 5 min
SPI4
SPI3
SPI1
SPI1
hilA
94°C: 3 min
Pathogenicity island/function
Hexaplex
Virulence gene
PCR program (30 cycles)
Multiplex PCR set
274
1,170
711
620
310
455
510
305
406
340
202
665
66
Product size (bp)
GTAGGTAAACGAGGAGCAG
AATATCGCTTCGTACCAC/
GCAAACCATAAAAACTACACTCA
GATGTGATTAATGAAGAAATGCC/
CTGCCGTACCGACTAAAGC
GTATCATAACCGACACCATTGC/
CACGAATGGCTGGAACTCTC
GCCTGTGGATGCGTAACG/
ACAGAACTTGCTGACTACTGCTTTT
ATGAAATCATCATTAACGGCATTAT/
GTTGCCTTTTCTTGCGCTTTCCACCCATCT
TTTGCCGAACGCGCCCCCACACG/
CTCGCTCAAGGAAATCAAACC
CTTCAACAGCCGAACAAATTTC/
TAAGAAGAAGCAATGAAAGATGGTT/ GGTTATAAGTGAATCAGGCTGTTGT
CTTATCTCAGGCGCGGGTGG
CTCTTGGATGATTTTCTTCTTTA/
GCGCGTAACGTCAGAATCAA
GGAGTATCGATAAAGATGTT/
ATAATCACGGTTCCGCGTAG
GCCAGCTTATAGTGCCAAGC/
TCCAAAAACAGGAAACCACAC
TCAGTTGGAATTGCTGTGGA/
AGGCCAAAGGGCGCATA
GGTTCAATCCGAGAGTCTGCAT/
Oligonucleotide sequence 50 –30 (forward/reverse)
Table 2 Three set of optimized multiplex PCR and primers sequences used to detect the virulence genes of S. enterica isolates
0.1
0.3
0.2
0.2
0.6
0.2
0.2
0.1
0.06
0.2
0.2
0.3
0.2
Concentration (lM) of primer used in the multiplex PCR
Halatsi et al. (2006)
Soto et al. 2006
Courtney et al. (2006)
Courtney et al. (2006)
Lim et al. (2007)
Hughes et al. (2008)
Altier et al. (2000)
Lim et al. (2007)
Soto et al. 2006
Hughes et al. (2008)
This work
Hughes et al. (2008)
Bohez et al. (2006)
Reference
Antonie van Leeuwenhoek (2009) 96:441–457 449
123
123 SPI3 SPI5 SPI5
orgA ttrB mgtC rmbA sopD pipD
94°C: 1 min
58°C: 1 min
72°C: 1 min
72°C: 5 min
SPI3
SPI2
SPI1
SPI1
hilD
94°C: 3 min
Pathogenicity island/function
Heptaplex Set II
Virulence gene
PCR program (30 cycles)
Multiplex PCR set
Table 2 continued
405
310
454
655
608
540
509
Product size (bp)
CGGCGATTCATGACTTTGAT/ CGTTATCATTCGGATCGTAA
0.1
0.2
TCCGTATAGTTAAGCGTTCGTC CTTTAAGCTTCGGTAATCATCAAAA/ AAGCGTCCATCTTGATAGTAAACAG
0.1
0.2
0.1
0.1
0.1
Concentration (lM) of primer used in the multiplex PCR
AGCCTTCACAAATTGTCCATTG/
ATTTACTGGCCGCTATGCTGTTG
TGACTATCAATGCTCCAGTGAAT/
GTGGCGATGCGGCTATGG
ATGTGGACGGGAGTCAATATGG/
GTAAGGCCAGTAGCAAAATTG
GATAAGGCGAAATCGTCAAATG/
TGAGCCGAGCTAAGGATGATC
AGCAGGTTACCATCAAAAATCTTTATG/
Oligonucleotide sequence 50 –30 (forward/reverse)
Hughes et al. (2008)
Lim et al. (2007)
Courtney et al. (2006)
Soto et al. (2006)
Courtney et al. (2006)
Soto et al. (2006)
Altier et al. (2000)
Reference
450 Antonie van Leeuwenhoek (2009) 96:441–457
Antonie van Leeuwenhoek (2009) 96:441–457
isolates representing 38 serovars that were recovered from poultry meat and various indigenous vegetables in Malaysia. Thong et al. (2005) demonstrated that the preferential amplification of one target sequence over another (bias in template-to-product ratios) in multiplex PCR can be overcome by increasing the amount of primers for the weaker amplification while simultaneously decreasing the primer concentrations for the stronger amplification. Upon adjustment of the relative ratio of the primer sets (Table 2), precise and consistent amplification of all the virulence genes in the multiplex combination was achieved. The results of the optimized Hexaplex (Fig. 1a) and Heptaplex (Fig. 1b, c) PCR revealed high specificity with amplimers of the expected size and without any nonspecific bands from unspecific amplification. Furthermore, a the BLAST sequence alignment of the DNA sequencing results (First Base, Malaysia) confirmed the amplified PCR products of a quorum sensing gene and SPI genes which exhibited high similarity to their respective target gene sequences in NCBI GeneBank database (data not shown). The developed multiplex PCR sets were able to amplify the SPI genes with the expected bands in all the S. enterica isolates at the minimum concentration of 0.8 pg ll-1 genomic DNA (Fig. 2a–c). Thus, the multiplex PCR sets designed in this study allow the sensitive detection of S. enterica SPI genes. Generally, subspecies I of S. enterica are significant differences in virulence, host adaptation and host specificity, and have been categorized into three different groups: broad-host-range, host-adapted, host-restricted serovars (Baumler et al. 1998; Uzzau et al. 2000). Serovar Typhimurium and Enteritidis are broad-host-range subspecies that causes systemic disease in a wide range of animals. According to Marcus et al. (2000), SPI 1–5 are not present in all species of Salmonella and varying in host specificity. However, the virulence determinants that define host range and the degree of pathogenicity in a specific animal host are not fully understood (Heithoff et al. 2008). All isolates in this study possessed at least 70% of the virulence associated genes tested with various of banding patterns (Fig. 1a–c) generated by the multiplex PCR sets. In general, hilA, hilC, orgA, ttrB, misL, rhuM, rmbA, pipB, pipD, sopD and sdiA were found to be 100% prevalent in this study, followed by mgtC, orfL and Spi4-F (99%), sifA (98%), hilD and
451
sopB (97%), ssrB (95%), hilA and pipA (94%), and sopE (83%). The occurrences of these virulence genes are summarized in Table 1. Notably, all the isolates demonstrated positive results on the sdiA gene amplification. sdiA is a quorum sensing gene that encodes a signal receptor of the LuxR family to achieve intercellular signaling for intestinal survival or colonization (Halatsi et al. 2006; Walters and Sperandio 2006). Results of 100% prevalence for sdiA and hilA are consistent with the previous findings by Halatsi et al. (2006) and Pathmanathan et al. (2003) respectively, who reported that sdiA and hilA appeared to be conserved in S. enterica. SPIs are also known to be associated with adhesion, cell invasion, intracellular survival and chloride secretion. Recently, genes associated with the type III secretion systems in SPI 1 (hilA [100% prevalent], hilC [100%], hilD [97%], orgA [100%] and sopE [83%]) and SPI 2 (ssrB [95% prevalent] and sifA [98%]) have been shown to be involved in both systemic and gastrointestinal tract infections of mammalian hosts (Klein et al. 2000; Lee et al. 2000; Brumell et al. 2002; Hughes et al. 2008). In addition, the only gene in SPI 3 that has been identified with a virulence phenotype is mgtC (99% prevalent), a Salmonella-specific gene required for the adaptation to the low Mg2? and low pH environment found in the intracellular vacuolar environment that contribute to intramacrophage survival (Blanc-Potard et al. 1999; Fierer and Guiney 2001). The abundance of SPI 1, SPI 2 and SPI 3 genes in this study suggested roles in the virulence of S. enterica to humans. The DNA sequence of SPI 5 consists of six putative genes that are thought to be involved in the fluid accumulation and inflammation in ligated bovine ileal loops and normal virulence in systemic infections of mice (Fierer and Guiney 2001). Four of these genes were found to be prevalent in this study: sopB (97% prevalent), pipA (94%), pipB (100%) and pipD (100%). The possession of these 20 virulence factors suggested that the S. enterica poses the ability to cause systemic and enteric salmonellosis in humans. On the other hand, 47% of the S. enterica serovars investigated possessed heterogeneous virulence associated gene patterns in this study. According to Prager et al. (2003), differences in terms of virulence factor concentrations might be the explanation of heterogeneous events in their clinical outcomes. Thus, the same serovar might cause more or less pathogenicity due to each of the particular genes contributing to the
123
452
Fig. 1 Representative multiplex PCR results of each set on Salmonella enterica isolates; Lane 1 reference strain S. Paratyphi A (ATCC9150) as positive control; Lane 10 Non template negative control. a Hexaplex: sopE (665 bp), pipA (406 bp), orfL (340 bp), pipB (305 bp), rhuM (202 bp), and hilA (66 bp); Lane 2 S. Tallahassee (Tl 1); Lane 3 S. Hartford (Hf 1); Lane 4 S. Agona (Ag 3); Lane 5 S. Braenderup (Bd 3); Lane 6 S. Arizonae (Ar 2); Lane 7 S. Ituri (It 2); Lane 8 S. Saintpaul (Sp 3); Lane 9 S. Enteriditis (Ed3). b Heptaplex Set I: sopB (1,170 bp), spi4-F (711 bp), misL (620 bp), hilC (510 bp), sifA (455 bp), ssrB (310 bp), and sdiA (274 bp).
123
Antonie van Leeuwenhoek (2009) 96:441–457
Lane 2 S. Brunei (Bn 1); Lane 3 S. Albany (Al 1); Lane 4 S. Haardt (Ht 1); Lane 5 S. Bovismorbiscans (Bo 3); Lane 6 S. Newport (Ne 3); Lane 7 S. Saintpaul (Sp 3); Lane 8 S. Wandsworth (Wa 3); Lane 9 S. Emek (Em 3). c Heptaplex Set II: mgtC (655 bp), ttrB (608 bp), orgA (540 bp), hilD (509 bp), rmbA (454 bp), pipD (405 bp), and sopD (310 bp). Lane 2 S. Bareily (Ba 1); Lane 3 S. Hadar (Hr 1); Lane 4 S. Molade (Mo 1); Lane 5 S. Tananarive (Ta 1); Lane 6 S. Typhimurium (Ty 1); Lane 7 S. Infantis (In 1); Lane 8 S. Saintpaul (Sp 3); Lane 9 S. Bovismorbiscans (Bo 3). M 100 bp marker (Favorgen, Taiwan)
Antonie van Leeuwenhoek (2009) 96:441–457
453
Fig. 2 Sensitivity of multiplex PCR. a Hexaplex and b and c Heptaplex as in Fig. 1 Lane 1 Undiluted S. Paratyphi A, Lane 2–6 tenfold dilutions of a purified DNA template, starting from 80 ng ll-1; M 100 bp marker (Favorgen, Taiwan)
unique virulence properties. Observations from this study revealed that S. Saintpaul exhibited various virulotyping patterns within a serovar. The virulence-associated genes in profile XIXA (lacking of sopE) as shown in Table 1 is the most common profile shared within the isolates in the heterogeneous pattern category. The results from this study are in agreement with Streckel et al. (2004) and Hughes et al. (2008) who found a low prevalence of the sopE gene in S. enterica. SopE is encoded by a P2-like cryptic bacteriophage (SopEA) (Hardt et al. 1998). The sopE gene is carried by prophage which is present in the genome of serovar Typhimurium which
causes epidemics among cattle in Europe (Mirold et al. 1999). In addition, Zhang et al. (2002) also demonstrated that acquisition of sopE by phagemediated horizontal gene transfer increases the ability for host adaptation. Results from this study showed that 83% of the S. enterica strains tested possess the sopE gene that potentially contributes to zoonotic salmonellosis. The dendrogram shown in Fig. 3 indicated that at 95% similarity level the same virulence profiles could be distinguished into 6 clusters (A, B, C, D, E and F) and 7 single isolates with the D value of 0.462 tend to cluster together. Among the 6 clusters, cluster C with
123
454
Antonie van Leeuwenhoek (2009) 96:441–457
sdiA
sopB
pipD
sopD
pipB
orfL
pipA
rmbA
Spi4-F
mgtC
rhuM
misL
ttrB
ssrB
sifA
hilD
sopE
orgA
99
100
98
97
96
94
95
92
93
90
91
89
88
87
85
86
83
84
81
82
79
78
80
77
76
75
72
74
71
73
95%
hilA
SPI
hilC
Virulence Associated Genes
Percentage Similarity
Simple matching (> 50%MEAN)
Ne 3 (S) Ty 3 (P) Ba 3 (M) Mo 3 (C) Wa 3 (M)
A B
Em 3(S) Al 1 (G) Al 3 (P) Am 1 (G) Am 2 (G) Am 3 (G) Ar 1 (P) Ar 2 (P) ATCC9150 Ba 1 (M) Ba 2 (M) Bd 1 (P) Bd 2 (P) Bn 1 (S) Bn 2 (S) Bo 1 (S) Em 1(S) Em 2(S) En 1 (P) En 2 (P) Hf 1 (P) Hf 2 (P) Hf 3 (P) Hr 1(C) Hr 2(C) Hr 3(P) Ht 1 (P) Hv 1 (C) Hv 2 (C) Hv 3 (C) In 1 (G) In 2 (G) In 3 (G) Ke 1 (C) Ke 2 (C) Ke 3 (C) Kr 1 (M) Kr 2 (M) Kr 3 (M) Ma 1 (S) Ma 2 (S) Ma 3 (S) Mb 1 (S) Mb 2 (S)
C
Mb 3 (S) Mg 1 (C) Mg 2 (G) Mg 3 (G) Mo 1 (C) Mo 2 (C) Ne 1 (S) Ne 2 (S) Pb 1 (S) Pb 2 (S) Pb 3 (S) Ri 1 (S) Ri 2 (S) Ri 3 (S) Sd 1 (S) Sd 2 (S) Se 1 (G) Se 2 (S) Sh 1 (P) Sh 2 (P) Sh 3 (P) Sp 1 (G) Sp 2 (M) St 1 (S) St 2 (S) Sw 1 (P) Sw 2 (P) Sw 3 (P) Ta 1 (M) Ta 2 (M) Ta 3 (M) Tl 1 (M) Tl 2 (M) Tl 3 (M) Ty 1 (S) Ty 2 (P) Vi 1 (P) Vi 2 (P) Vi 3 (P) Wa 1 (M) Wa 2 (M) Ag 1 (M) Ag 2 (S) Ag 3 (P) ATCC14028 Bn 3 (S) Bo 2 (S) En 3 (P) Ht 2 (P) Ht 3 (P)
D
Se 3 (S) St 3 (S) We 1 (S) We 2 (S) We 3 (S) Al 2 (S) Sd 3 (S) It 2 (C)
E
It 3 (C) Bd 3 (P) Hi 1 (C) Hi 2 (C) Hi 3 (C) It 1 (C) Ar 3 (P) Bo 3 (S) Sp 3 (P)
‘+’ for virulence associated gene
‘-’ for virulence associated gene
Fig. 3 Dendrogram of SPI typing of 116 S. enterica isolates
123
F
Antonie van Leeuwenhoek (2009) 96:441–457
455
Table 3 SPI typing clustering profile for 116 S. enterica isolates Cluster No. of Isolates descriptiona isolates
Virulence profile
A
2
Ne 3(S), Ty 3 (P)
XIXD
B
2
Ba 3 (M), Mo 3 (C)
XVIIIF
C
84
Al 1 (G), Al 3 (P), Am 1 (G), Am 2 (G), Am 3 (G), Ar 1 (P), ATCC 9150, Ba 1 (M), Ba 2 (M), Bd 1 (P), XX Bd 2 (P), Bn 1 (S), Bn 2 (S), Bo 1 (S), Em 1 (S), Em 2 (S), En 1 (P), En 2 (P), Hf 1 (P), Hf 2 (P), Hf 3 (P), Hr 1 (C), Hr 2 (C), Hr 3 (P), Ht 1 (P), Hv 1 (C), Hv 2 (C), Hv 3 (C), In 1 (G), In 2 (G), In 3 (G), Ke 1 (C), Ke 2 (C), Ke 3 (C), Kr 1 (M), Kr 2 (M), Kr 3 (M), Ma 1 (S), Ma 2 (S), Ma 3 (S), Mb 1 (S), Mb 2 (S), Mb 3 (S), Mg 1 (C), Mg 2 (G), Mg 3 (G), Mo 1 (C), Mo 2 (C), Ne 1 (S), Ne 2 (S), Pb 1 (S), Pb 2 (S), Pb 3 (S), Ri 1 (S), Ri 2 (S), Ri 3 (S), Sd 1 (S), Sd 2 (S), Se 1 (G), Se 2 (S), Sh 1 (P), Sh 2 (P), Sh 3 (P), Sp 1 (G), Sp 2 (M), St 1 (S), St 2 (S), Sw 1 (P), Sw 2 (P), Sw 3 (P), Ta 1 (M), Ta 2 (M), Ta 3 (M), Tl 1 (M), Tl 2 (M), Tl 3 (M), Ty 1 (S), Ty 2 (P), Vi 1 (P), Vi 2 (P), Vi 3 (P), Wa 1 (M), Wa 2 (M), We 3 (S)
D
14
Ag 1 (M), Ag 2 (S), Ag 3 (P), ATCC 14028, Bn 3 (S), Bo 2 (S), En 3 (P), Ht 2 (P), Ht 3 (P), Se 3 (S), St 3 (S), We 1 (S), We 2 (S), We 3 (S)
XIXA
E
2
It 2 (C), It 3 (C)
XVIIIG
F
5
Bd 3 (P), Hi 1 (C), Hi 2 (C), Hi 3 (C), It 1 (C)
XIXB
a
Abbreviations according to the isolation code and sources as indicated in Table 1
84 isolates of S. enterica consist of 35 serovars formed the largest group which exhibited virulence profile XX virulence profile (Table 3). The remaining five clusters were D, F, A, B and E that derived from the virulence profile of XIXA, XIXB, XIXD, XVIIIF and XVIIIG. The origins of the majority of the S. enterica isolates characterized with full virulence (XX) patterns in this study suggested that the local indigenous vegetables and poultry meat could be the major reservoir for the foodborne illness in Malaysia, particularly salmonellosis. Generally, no specific trend observed in the association of virulence associated genes with the serovar in analyses of poultry meat and vegetables isolates. Negative amplification results of virulence associated genes might be due to either to simple point mutations or the absence of the gene. In conclusion, three sets of multiplex PCR system, two Heptaplex sets and one Hexaplex, targeting 20 virulence genes of S. enterica, were successfully developed. The assay is reproducible, sensitive, easily performed and enables a presumptive identification of selected virulence factors of the causal pathogen. This assay should helped to improve virulence-associated gene profiling in S. enterica and allow quick monitoring of emerging pathogenic Salmonella spp. Additionally, the assay can be add to the current available tools for the Salmonella surveillance study.
Acknowledgments The authors thank the Department of Chemistry, Malaysia for collaboration and providing the Salmonella isolates in this study. This study was supported by Fundamental Research Grant Scheme (04-01-07-098) provided from the Ministry of Higher Education, Malaysia.
References Ait Melloul A, Hassani L, Rafouk L (2001) Salmonella contamination of vegetables irrigated with untreated wastewater. J Microbiol Biotechnol 17:207–209 Altier C, Suyemoto M, Lawhon SD (2000) Regulation of Salmonella enterica serovar Typhimurium invasion gene by csrA. Infect Immun 68:6790–6797 Anon (2002) Risk profile on the microbiological contamination of fruits and vegetables eaten raw. Scientific Committee on Food. SCF/CS/FMH/SURF, Brussel AVRDC (2004) AVRDC report 2003. AVRDC publication number 04-599. AVRDC—The World Vegetable Center, Shanhua, pp 194 Baumler AJ, Tsolis RM, Ficht TA, Adams LG (1998) Evolution of host adaptation in Salmonella enterica. Infect Immun 66:4579–4587 Blanc-Potard AB, Solomon F, Kayser J, Groisman EA (1999) The SPI-3 pathogenicity island of Salmonella enterica. J Bacteriol 181:998–1004 Bohez L, Ducatelle R, Pasmans F, Botteldoorn N, Haesebrouck F, Immerseel FV (2006) Salmonella enterica serovar Enteritidis colonization of the chicken caecum requires the HilA regulatory protein. Vet Microbiol 116:202–210 Brumell JH, Goosney DL, Finlay BB (2002) SifA, a type III secreted effectors of Salmonella typhimurium, directs Salmonella-induced filament (Sif) formation along microtubules. Traffic 3:407–415
123
456 Center for Disease Control and Prevention (CDC) (2008) Investigation of outbreak of infections caused by Salmonella Saintpaul. Department of Health and Human Services. Available: URL: http://www.cdc.gov/salmonella/ saintpaul/ Courtney S, Mossoba ME, Hammack TS, Keys C, Al-Khaldi SF (2006) Using PCR amplification to increase the confidence level of Salmonella typhimurium DNA microarray chip hybridization. Mol Cell Probes 20:163–171 Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE (2000) Multiple PCR: optimization and application in diagnostic virology. Clin Microbiol Rev 13:559–570 Fierer J, Guiney DG (2001) Diverse virulence traits underlying different clinical outcomes of Salmonella infection. J Clin Invest 107:775–780 Food and Drug Administration (FDA) (2008) Salmonellosis outbreak in certain types of tomatoes. U.S. Department of Health and Human Services. Available: URL: http://www. fda.gov/oc/opacom/hottopics/tomatoes.html Halatsi K, Oikonomou I, Lambiri M, Mandilara G, Vatopoulos A, Kyriacou A (2006) PCR detection of Salmonella spp. using Primers targeting the quorum sensing gene sdiA. FEMS Microbiol Lett 259:201–207 Hardt W-D, Urlaub H, Galan JE (1998) A substrate of the centisome 63 type III protein secretion system of Salmonella typhimurium is encoded by a cryptic bacteriophage. PNAS 95:2574–2579 Heithoff DM, Shimp WR, Lau PW, Badie G, Enioutina EY, Daynes RA, Byrne BA, House JK, Mahan MJ (2008) Human Salmonella clinical isolates distinct from those of animal origin. Appl Environ Microbiol 74:1757–1766 Hensel M (2004) Evolution of pathogenicity islands of Salmonella enterica. Int J Med Microbiol 294:95–102 Hughes LA, Shopland S, Wigley P, Bradon H, Leatherbarrow AH, Williams NJ, Bennett M, Pinna ED, Lawson B, Cunningham AA, Chantrey J (2008) Characterisation of Salmonella enterica serotype Typhimurium isolates from wild birds in northern England from 2005–2006. BMC Vet Res 4:1–10 Hunter PR (1990) Reproducibility and indices of discriminatory power of microbial typing methods. J Clin Microbiol 28:1903–1905 Jegathesan M, Tee GH, Cheong YM (1993) The pattern of serotypes in Malaysia an aid to epidemiology. In: Travel health: proceedings of the world congress on tourist medicine and health, Singapore. Asia Pacific Travel Health Association, pp. 269–282 Jofre´ A, Martin B, Garriga M, Hugas M, Pla M, Rodrı´guez-La´zaro D, Aymerich T (2005) Simultaneously detection of Listeria monocytogenes and Salmonella by multiplex PCR in cooked ham. Int J Food Microbiol 22:109–115 Klein JR, Fahlen TF, Jones BD (2000) Transcriptional organization and function of invasion genes within Salmonella enterica serovar Typhimurium pathogenicity island 1, including the prgH, prgI, prgJ, prgK, orgA, orgB, and orgC genes. Infect Immun 68:3368–3376 Lee AK, Detweiler CS, Falkow S (2000) OmpR regulates the two-component system SsrA-SsrB in Salmonella pathogenicity island 2. J Bacteriol 182:771–781
123
Antonie van Leeuwenhoek (2009) 96:441–457 Lim S, Jung J, Kim D (2007) The effect of c radiation on the expression of the virulence genes of Salmonella typhimurium and Vibrio spp. Radiat Phys Chem 76:1763–1766 Lostroh CP, Lee CA (2001) The Salmonella pathogenicity island-1 type III secretion system. Microb Infect 3:1281– 1291 Marcus SL, Brumell JH, Pfeifer CG, Finlay BB (2000) Salmonella pathogenicity islands: big virulence in small packages. Microb Infect 2:145–156 Mastropeni P, Maskell D (2006) Salmonella infections: clinical, immunological and molecular aspects. Cambridge University Press, Cambridge, pp 89–90 Mirold S, Rabsch W, Rohde M, Stender S, Tschape H, Russmann H, Igwe E, Hardt WD (1999) Isolation of a temperate bacteriophage encoding the type III effector protein SopE from an epidemic Salmonella typhimurium strain. PNAS 96:9845–9850 Noorzaleha AS, Gulam R, Zaiton H, Abdul R, Siti HI, Nishibuchi M, Son R (2003) Incidence of Salmonella spp. in raw vegetables in Selangor, Malaysia. Food Control 14:475–479 Pathmanathan SG, Cardona-Castro N, Sa´nchez-Jime´nez MM, Correa-Ochoa MM, Puthucheary SD, Thong KL (2003) Simple and rapid detection of Salmonella strains by direct PCR amplification of the hilA gene. J Med Microbiol 52:773–776 Prager R, Rabsch W, Streckel W, Voigt W, Tietze E, Tscha¨pe H (2003) Molecular properties of Salmonella enterica serotype paratyphi B distinguish between its systemic and its enteric pathovars. J Clin Microbiol 41:4270–4278 Rusul G, Khair J, Son R, Cheah CT, Yassin RM (1996) Prevalence of Salmonella in broilers at retail outlets, processing plants and farms in Malaysia. Int J Food Microbiol 33:183–194 Sahilah AM, Son R, Rusul G, Samuel L, Hassan Z, Lum KY, Ahmad MA (2000) Molecular typing of Salmonella weltevreden and Salmonella chincol by pulse-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERICPCR). World J Microbiol Biotechnol 16:621–624 Salama NR, Falkow S (1999) Genomic clues for defining bacterial pathogenicity. Microb Infect 1:615–619 Shea JE, Hensel M, Gleeson C, Holden DW (1996) Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium. PNAS 93:2593–2597 Son R, Ansary A, Salmah I, Maznah A (1995) Survey of plasmids and resistance factors among veterinary isolates of Salmonella enteriditis in Malaysia. World J Microbiol Biotechnol 11:315–318 Soumet C, Ermel G, Rose N, Drouin P, Salvant G, Colin P (1999) Identification by a multiplex PCR-based assay of Salmonella Typhimurium and Salmonella Enteriditis strains from environmental swabs of poultry houses. Lett Appl Microbiol 29:1–6 Streckel W, Wolff A-C, Prager R, Tietze E, Tscha¨pe H (2004) Expression profiles of effector protein SopB, SopD1, SopE1, and AvrA differ with systemic, enteric, and epidemic strains of Salmonella enterica. Mol Nutr Food Res 48:496–503
Antonie van Leeuwenhoek (2009) 96:441–457 Thong KL, Goh YL, Noorzaleha S, Yasin R, Koh YT, Lim VKE, Rusul G (2002) Genetic diversity of clinical and environmental strains of Salmonella enterica serotype Weltevreden isolated in Malaysia. J Clin Microbiol 40:2498–2503 Thong KL, Hoe SLL, Puthucheary S, Yasin RM (2005) Detection of virulence genes in Malaysian Shigella species by multiplex PCR assay. BMC Infect Dis 5:1–7 Trafny EA, Kozlowska K, Szpakowska M (2006) A novel multiplex PCR assay for the detection of Salmonella enterica serovar Enteriditis in human faeces. Lett Appl Microbiol 43:673–679 Uzzau S, Brown DJ, Wallis T, Rubino S, Leori G, Bernard S, Casadesus J, Platt DJ, Olsen JE (2000) Host adapted serotypes of Salmonella enterica. Epidemiol Infect 125:229–255
457 Walters M, Sperandio V (2006) Quorum sensing in Escherichia coli and Salmonella. Int J Med Microbiol 296:125–131 Yee CF, Ayob MK (1994) Isolation and identification of Salmonella spp. from some local food products. Trop Biomed 11:53–60 Yoke-Kqueen C, Noorzaleha AS, Learn-Han L, Son R, Sabrina S, Jiun-Horng S (2008) Comparison of PCR fingerprinting techniques for the discrimination of Salmonella enterica subsp. enterica serovar Weltevreden isolated from indigenous vegetables in Malaysia. World J Microbiol Biotechnol 24:327–335 Zhang S, Santos RL, Tsolis RM, Stencer S, Hardt WD, Ba¨umler AJ, Adams LG (2002) SipA, SopA, SopB, SopD, and SopE2 act in concert to induce diarrhea in calves infected with Salmonella enterica serovar Typhimurium. FEMS Microbiol Lett 70:3843–3855
123
