Case Report J Vet Intern Med 2009;23:196–199
V i t a m i n D- D e p e n d e n t H e r e d i t a r y R i c k e t s Ty p e I i n a C a t V. Geisen, K. Weber, and K. Hartmann
5-month-old 1.8 kg (4 lb) female domestic short hair cat was examined for a 1-month history of generalized pain. A sibling of the cat in the same household was healthy and had a weight of 2.6 kg. Both cats had been adopted as strays 3 months before examination and were fed a commercial kitten food. The cat was examined by the referring veterinarian with generalized pain, a history of increasing reluctance to move, and intestinal constipation 3 days before initial presentation. The cat was treated with meloxicam, which only mildly improved its activity, and with lactulose and a sodium chloride enema to relieve constipation. The referring veterinarian noted reduced skeletal mineralization in a radiograph, and a serum biochemistry profile revealed hypocalcemia (total calcium 1.12 mmol/L; reference range 1.46–3.16 mmol/L), hyperphosphatemia (phosphate 2.70 mmol/L; reference range 0.97–2.36 mmol/L), high alkaline phosphatase (724 U/L; reference range 0–104 U/L) and creatine kinase (926 U/L; reference range 36–247 U/L) activity. Urea and creatinine were within the reference range. CBC revealed mild leukocytosis (13.0 G/L; reference range 6.0–11.0 G/L) with lymphocytosis (4.7 G/L; reference range 1.0–4.0 G/L) and eosinophilia (0.8 G/L; reference range 0.04–0.6 G/L). On examination, the cat appeared growth retarded in comparison with its littermate, was lethargic, and moved only little. Touching and manipulating the vertebral column and the tail elicited a pain response. Inspection of the oral cavity revealed healthy deciduous teeth, but no evidence of second dentition. Nutritional condition and appetite were good, but defecation appeared to be painful. Radiographs were repeated and verified skeletal demineralization and abnormally wide growth plates of the long bones (Fig 1). The ionized calcium was low 0.69 (reference range 1.20–1.35 mmol/L). Test results for feline leukemia virus antigen and antibodies to feline immunodeficiency virus were negative. Urinalysis (cystocentesis) revealed a specific gravity of 1.034, traces of protein, and pyuria. On urine culture, no bacterial growth was detected. On the day after initial examination, the cat developed seizures caused by hypocalcemia. The cat was administered calcium gluconate 10% (1 mL/kg) slowly IV.
A
From the Clinic of Small Animal Medicine and the Institute of Animal Physiology of the Ludwig Maximilians University, Munich, Germany. Corresponding author: Vera Geisen, Clinic of Small Animal Medicine and the Institute of Animal Physiology of the Ludwig Maximilians University, Munich, Germany; e-mail:
[email protected].
Submitted August 3, 2008; Revised September 3, 2008; Accepted September 3, 2008. Copyright r 2008 by the American College of Veterinary Internal Medicine 10.1111/j.1939-1676.2008.0220.x
This was continously montitored by ECG, and no arrhythmias were detected. The cat received a constant rate IV infusion of fentanyl (5 mg/kg/h). Because the cat had pyuria, amoxicillin/clavulanic acid was administered. Starting on Day 2, the cat received calcium gluconate (50 mg/kg PO q 24h). Ionized calcium concentrations were regularly rechecked but stayed low (0.69– 0.79 mmol/L; reference range 1.2–1.35 mmol/L) despite PO calcium administration. The cat had no further seizures anymore and the pain improved. Hypocalcemia, hyperphosphatemia, and the skeletal abnormalities were indicative of rickets, which can develop after prolonged feeding of a diet deficient in calcium or vitamin D. Because the cats cannot synthesize vitamin D in the skin, exposure to sunlight does not contribute to vitamin D supply.1 A board-certified nutritionist was consulted and evaluated the food for calcium, phosphorus, and vitamin D concentration and considered the commercial diet to be well balanced. Because the sibling of the patient received the same food and showed no signs, nutritional deficiency seemed highly unlikely. Parathyroid hormone, measured in stabilized serum, was high (1,091 pg/mL, reference range 3–24 pg/mL). Total thyroxine (T4) was measured in the serum and appeared to be within the reference range. The findings were compatible with severe secondary hyperparathyroidism caused by low–blood-calcium concentration. Because calcium and vitamin D intake were adequate and renal function did not appear to be compromised, calcium deficiency due to gastrointestinal malabsorption was suspected. Serum vitamin D metabolitesa were determined. 25Hydroxycholecalciferol was within the reference range (90 nmol/L; reference range 48–192 nmol/L), but the active metabolite 1,25-dihydroxycholecalciferol was lower (6 pg/mL; reference range 17–25 pg/mL). Normal concentrations of 25-hydroxycholecalciferol indicate adequate vitamin D supply, resorption, and functional hydroxylation in the liver, whereas low concentrations of 1,25dihydroxycholecalciferol are consistent with a defect of the last hydroxylation step. Therefore, treatment was started with 1,25-dihydroxycholecalciferolb (10 ng/kg PO q 24h), and calcium gluconate administration (50 mg/kg PO q 24h) was continued. The calcitriol capsules were dissolved in milk before application to obtain a correct dosing. The cat initially responded well to the treatment with increasing concentrations of ionized serum calcium, which were regularly rechecked every 5–7 days to avoid calcitriol overdosing and hypercalcemia. Because the calcium concentration started to decline again after 2 weeks, the dose of 1,25-dihydroxycholecalciferol was gradually adjusted to 25 ng/kg to keep ionized calcium slightly below the reference range. Beginning on day 63 the dose had to be gradually decreased to 10 ng/kg to avoid hypercalcemia (Table 1). Recheck radiographs were taken 4
Rickets Type I in a Cat
197
Fig 2. Repeat radiograph of the right humerus 4 month later. Courtesy of Prof Dr U. Matis, Clinic of Small Animal Surgery and Obstetrics, Munich. Fig 1. Skeletal demineralization and abnormally wide growth plates in the right humerus of the cat at 5 month of age. Courtesy of Prof Dr U. Matis, Clinic of Small Animal Surgery and Obstetrics, Munich.
months after starting treatment. Bone structure was still abnormal, but showed a marked improvement (Fig 2). Considering the case history, a genetic defect was suspected in this cat. In humans, several forms of hereditary rickets have been reported so far. In hypophosphatemic Table 1. Levels of ionized serum calcium and doses of 1,25-dihydroxycholecalciferol and calcium gluconate treatment at different time points after initiation of the treatment. Ionized Serum Calcium Current 1,25-Dihy- Current Calcium (reference range droxycholecalciferol Gluconate (mg/kg) Day 1.20–1.35 mmol/L) (ng/kg) Treatment Treatment 0 4 10 17 42 49 56 63 84 104 122
0.70 1.04 0.91 0.90 0.85 0.86 1.08 1.14 1.33 1.40 1.25
0 10 15 15 20 25 25 25 20 10 10
0 50 50 50 50 50 50 Discontinued — — —
rickets, the defect is primarily due to loss of phosphate at the level of the renal tubule, for which there was no evidence in the cat. Vitamin D-dependent rickets type I (VDDR I) is caused by a defect in the gene encoding the enzyme 25-hydroxyvitamin D-1-a hydroxylase (CYP27B1), whereas vitamin D-dependent rickets type II (VDDR II) is due to a defect in the vitamin D receptor gene. Both are autosomal recessive disorders. In vitamin D receptor-deficient patients, the serum concentrations of 1,25-dihydroxycholecalciferol are consistently high, whereas this cat had a low concentration of the active vitamin D metabolite. We therefore decided to analyze the genomic sequence of CYP27B1 in a control cat and this cat. The feline CYP27B1 gene (ENSEMBL Gene ID ENSFCAG00000014701) contains 9 exons and spans 4 kb. We chose 6 primer pairs (Table 2) to cover overlapping segments of CYP27B1 from the promoter region to the 3 0 untranslated region. Genomic DNA was extracted from blood with the DNeasy Blood & Tissue Kit.c Polymerase chain reaction (PCR) amplification of the 6 fragments was perfomed with 20 ng of genomic DNA in a mixture of HotStarTaq Master Mix,c a primer pair (0.5 pmol each), water and Q-solutionc with 30 cycles of 94, 60, and 72 1C/1 min. The amplification products showed no differences in length between the control cat and the patient. The PCR products were cleaned using the QIAquick PCR purification kit, and each one was sequenced from both sides in separate sequencing reactions using the adequate forward or reverse primer.d The
198
Geisen, Weber, and Hartmann
Table 2. Polymerase chain reaction (PCR) primer pairs for amplification of the feline CYP27B1 gene. PCR Product 1 2 3 4 5 6
Forward Primer
Reverse Primer
5 0 GAATTTCCCAGCCATCTTCCG 3 0 5 0 TGACCTAAAACACCACCCCCTTCC 3 0 5 0 TCCAGTGAGAACGGATGCCC 3 0 5 0 CCGGGGCAGGAAATGAGTAA 3 0 5 0 GGTTCTCCTCCCTGTTGG 3 0 5 0 TTTATGTTCCTTTCCCACCAGACG 3 0
5 0 CCCCCTCCCATACCTGACTCTG 3 0 5 0 GCTTAACTCGGCCCCAACTTCTA 3 0 5 0 TACCAAAACCTGCCCCTGCCT 3 0 5 0 AAGAGGGCAGAATATGAGGTAGTC 3 0 5 0 AGCGAGCTGGATGAAAAGAAT 3 0 5 0 CTTCCCCAGGCCACCCAACATT 3 0
Fig 3. Protein sequence alignment of the control cat and the patient. Position 75 shows a valine to methionine substitution. The normal protein has 508 amino acids, the sequence of the patient is altered from position 244 on, and a stop codon at position 275 truncates the protein.
sequences of the control cat and the affected cat were compared and revealed a G4A mutation in exon 2 and a single nucleotide (G) deletion in exon 4 in the patient. Both mutations could be detected in the forward and the reverse sequencing reaction, and were confirmed by sequencing a second independent PCR amplification product to exclude the possibility of Taq-polymerase amplification errors. Both mutations affect the CYP27B1 transcript and the translated amino acid sequence. The G4A mutation in exon 2 changes the amino acid sequence from valine to methionine on amino acid position 75 (Val75Met), whether this affects enzymatic activity is unknown. The deletion of one base pair in exon 4 (731delG) leads to a shift in the reading frame and changes the amino acid sequence starting from codon 244. A premature stop codon appears at position 275 leading to a severely truncated protein (Fig 3), which most likely will not have enzymatic activity. In human patients suffering from VDDR I, multiple mutations of CYP27B1 including amino acid substitutions and deletions leading to frame shift have been identified (OMIM registry ID No. 609506), and in vitro experiments confirmed their ability to inhibit enzymatic activity.2,3 A pig strain with all clinical signs and biochemical alterations of VDDR I exists,4 and the molecular basis of this disorder was determined by Chavez et al,5 who found 2 deletions in the porcine CYP27B1 gene. To the authors knowledge, VDDR I has not been reported so far in a cat. There are a few case reports of inherited disorders of vitamin D metabolism in dogs6 and cats,7–9 which have been classified as potential vitamin D receptor defects (VDDR II) based on clinical and biochemical findings, but without genetic analysis. In contrast to VDDR I, serum 1,25-dihydroxycholecalciferol is increased in these patients. The clinical findings of rickets, notably the failure of bone calcification, delayed dentition, and hyperparathyroidism in the patient presented in this report plus the unresponsiveness to vitamin D and oral calcium and the genetic analysis proved the diagnosis of VDDR I. Treatment with oral 1,25-dihydroxycholecalciferol improved the cat’s calcium homeostasis and bone
mineralization and probably has to be continued lifelong with frequent rechecks of serum calcium concentrations to avoid overdosing, especially when bone growth is completed.
Footnotes a
Vet-Med-Labor, Ludwigsburg, Germany Rocaltrol 0.25 mg-capsules, Roche, Vienna, Austria c Qiagen, Hilden, Germany d Seqlab Sequence Laboratories, Go¨ttingen, Germany b
Acknowledgment The authors thank Prof Dr U. Matis, Clinic of Small Animal Surgery and Obstetrics, Ludwig Maximilian University, Munich, for providing the radiographs.
References 1. How KL, Hazewinkel HA, Mol JA. Dietary vitamin D dependence of cats and dogs due to inadequate cutaneous synthesis of vitamin D. Gen Comp Endocrinol 1994;96:12–18. 2. Kitanaka S, Takeyama K, Murayama A, et al. Inactivating mutations in the 25-hydroxyvitamin D3 1alpha-hydroxylase gene in patients with pseudovitamin D-deficiency rickets. N Engl J Med 1998;338:653–661. 3. Yamamoto K, Uchida E, Urushino N, et al. Identification of the amino acid residue of CYP27B1 responsible for binding of 25hydroxyvitamin D3 whose mutation causes vitamin D-dependent rickets type 1. J Biol Chem 2005;280:30511–30516. 4. Winkler I, Schreiner F, Harmeyer J. Absence of renal 25hydroxycholecalciferol-1-hydroxylase activity in a pig strain with vitamin D-dependent rickets. Calcif Tissue Int 1986;38:87–94. 5. Chavez LS, Serda R, Choe S, et al. Molecular basis for pseudo vitamin D-deficiency rickets in the Hannover pig. J Nutr Biochem 2003;14:378–385.
Rickets Type I in a Cat 6. Johnson KA, Church DB, Barton RJ, et al. Vitamin Ddependent rickets in a Saint Bernard dog. J Small Anim Pract 1988;29:657–666. 7. Henik RA, Forrest LJ, Friedman AL. Rickets caused by excessive renal phosphate loss and apparent abnormal vitamin D metabolism in a cat. J Am Vet Med Assoc 1999;215:1644–1649, 1620–1641.
199
8. Schreiner CA, Nagode LA. Vitamin D-dependent rickets type 2 in a four-month-old cat. J Am Vet Med Assoc 2003;222:337–339, 315–336. 9. Godfrey DR, Anderson RM, Barber PJ, et al. Vitamin D-dependent rickets type II in a cat. J Small Anim Pract 2005;46:440– 444.
