Volume 17 - Number 12 December 2013

Atlas of Genetics and Cytogenetics in Oncology and Haematology INIST-CNRS

OPEN ACCESS JOURNAL

Volume 17 - Number 12 December 2013

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.


OPEN ACCESS JOURNAL

Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director, and Alain Bernheim the Chairman of the on-line version (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org © ATLAS - ISSN 1768-3262

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS.


OPEN ACCESS JOURNAL

Editor Jean-Loup Huret (Poitiers, France)

Editorial Board Sreeparna Banerjee Alessandro Beghini Anne von Bergh Judith Bovée Vasantha Brito-Babapulle Charles Buys Anne Marie Capodano Fei Chen Antonio Cuneo Paola Dal Cin Brigitte Debuire François Desangles Enric Domingo-Villanueva Ayse Erson Richard Gatti Ad Geurts van Kessel Oskar Haas Anne Hagemeijer Nyla Heerema Jim Heighway Sakari Knuutila Lidia Larizza Lisa Lee-Jones Edmond Ma Roderick McLeod Cristina Mecucci Yasmin Mehraein Fredrik Mertens Konstantin Miller Felix Mitelman Hossain Mossafa Stefan Nagel Florence Pedeutour Elizabeth Petty Susana Raimondi Mariano Rocchi Alain Sarasin Albert Schinzel Clelia Storlazzi Sabine Strehl Nancy Uhrhammer Dan Van Dyke Roberta Vanni Franck Viguié José Luis Vizmanos Thomas Wan

(Ankara, Turkey) (Milan, Italy) (Rotterdam, The Netherlands) (Leiden, The Netherlands) (London, UK) (Groningen, The Netherlands) (Marseille, France) (Morgantown, West Virginia) (Ferrara, Italy) (Boston, Massachussetts) (Villejuif, France) (Paris, France) (London, UK) (Ankara, Turkey) (Los Angeles, California) (Nijmegen, The Netherlands) (Vienna, Austria) (Leuven, Belgium) (Colombus, Ohio) (Liverpool, UK) (Helsinki, Finland) (Milano, Italy) (Newcastle, UK) (Hong Kong, China) (Braunschweig, Germany) (Perugia, Italy) (Homburg, Germany) (Lund, Sweden) (Hannover, Germany) (Lund, Sweden) (Cergy Pontoise, France) (Braunschweig, Germany) (Nice, France) (Ann Harbor, Michigan) (Memphis, Tennesse) (Bari, Italy) (Villejuif, France) (Schwerzenbach, Switzerland) (Bari, Italy) (Vienna, Austria) (Clermont Ferrand, France) (Rochester, Minnesota) (Montserrato, Italy) (Paris, France) (Pamplona, Spain) (Hong Kong, China)

Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12)

Solid Tumours Section Genes Section Genes / Leukaemia Sections Solid Tumours Section Leukaemia Section Deep Insights Section Solid Tumours Section Genes / Deep Insights Sections Leukaemia Section Genes / Solid Tumours Section Deep Insights Section Leukaemia / Solid Tumours Sections Solid Tumours Section Solid Tumours Section Cancer-Prone Diseases / Deep Insights Sections Cancer-Prone Diseases Section Genes / Leukaemia Sections Deep Insights Section Leukaemia Section Genes / Deep Insights Sections Deep Insights Section Solid Tumours Section Solid Tumours Section Leukaemia Section Deep Insights / Education Sections Genes / Leukaemia Sections Cancer-Prone Diseases Section Solid Tumours Section Education Section Deep Insights Section Leukaemia Section Deep Insights / Education Sections Genes / Solid Tumours Sections Deep Insights Section Genes / Leukaemia Section Genes Section Cancer-Prone Diseases Section Education Section Genes Section Genes / Leukaemia Sections Genes / Cancer-Prone Diseases Sections Education Section Solid Tumours Section Leukaemia Section Leukaemia Section Genes / Leukaemia Sections


OPEN ACCESS JOURNAL

Volume 17, Number 12, December 2013

Table of contents Gene Section CTCF (CCCTC-binding factor (zinc finger protein)) Jacques Piette

802

FBLN5 (fibulin 5) Miao Wang, Rolf A Brekken

811

FUBP1 (far upstream element (FUSE) binding protein 1) Katharina Gerlach, Martin Zörnig

816

MIR106B (microRNA 106b) Cansaran Saygili, Ayse Elif Erson-Bensan

821

MIR23A (microRNA 23a) Yibin Feng, Hoey Chan, Ning Wang, Meifen Zhu, Fan Cheung, Ming Hong

825

MST1 (macrophage stimulating 1 (hepatocyte growth factor-like)) Makiko Kawaguchi, Hiroaki Kataoka

828

PIWIL1 (piwi-like RNA-mediated gene silencing 1) Shozo Honda, Yohei Kirino

833

SET (SET nuclear oncogene) Rebeca Manso-Alonso

837

TRPM8 (transient receptor potential cation channel, subfamily M, member 8) María Llanos Valero, Luis A Pardo

841

Leukaemia Section 1q translocations (unbalanced) in myeloid malignancies Adriana Zamecnikova, Soad Al Bahar

845

Deep Insight Section Common fragile sites and genomic instability Yuri Pekarsky, Alessandra Drusco, Eugenio Gaudio, Carlo M Croce, Nicola Zanesi

849

Inflammatory programming and immune modulation in cancer by IDO Courtney Smith, George C Prendergast

856

Case Report Section der(1;18)(q10;q10) in a patient with AML following essential thrombocythemia Adriana Zamecnikova, Soad Al Bahar, Ramesh Pandita

863

t(2;11)(q31;p15) in therapy related myeloid neoplasm: case report and review of literature Amarpreet Bhalla, Anwar N Mohamed

866


Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL


INIST-CNRS

CTCF (CCCTC-binding factor (zinc finger protein))

Piette J

Figure 2. Schematic representation of the CTCF protein. Protein sequences encoded by exons are boxed. 11 ring fingers are indicated by green boxes as also putative AT-hooks by blue boxes (Ensembl). The interaction domain with the SA2 subunit of cohesin is underlined in red (Xiao et al., 2011). Phosphorylated residues are in black (PhosphoSitePlus), those sensitive to rapamycin are indicated by R (Chen et al., 2009) and those phosphorylated by CKII by CKII (El-Kady and Klenova, 2005; Klenova et al., 2001), sumoylated residues are in red (Kitchen and Schoenherr, 2010; MacPherson et al., 2009), acetylated residue is indicated by Ac (Choudhary et al., 2009). The domain containing poly(ADPribosyl)ation sites (PAR) is boxed in red (Farrar et al., 2010), the NTP-binding site in blue and the NLS in purple. Residues mutated in tumors are indicated (see further), BT = breast tumor, PT = prostate tumor and WT = Wilms tumor.

and in BT (Docquier et al., 2009) (for sites and role see Farrar et al., 2010; Yu et al., 2004; Guastafierro et al., 2013). CTCF is a downstream target protein of growth factor-induced pathways and is regulated by EGF and insulin through activation of ERK and AKT signaling cascades (Gao et al., 2007). It was recently shown to be regulated by NF-kB (Lu et al., 2010).

Transcription Ubiquitously highly expressed gene (GeneCards), 12 exons, 11 introns with at least 5 differentially spliced transcripts (Ensembl).

Pseudogene No.

Localisation

Protein

CTCF is localized in the nucleoplasm of proliferating cells with exclusion from the nucleolus. It was detected at the centrosomes and midbody during mitosis (Zhang et al., 2004). It is associated with the nuclear matrix (Dunn et al., 2003; Yusufzai and Felsenfeld, 2004) and the Lamina (Guelen et al., 2008; Ottaviani et al., 2009). Nucleolar translocation after growth arrest is accompanied by inhibition of nucleolar transcription (Torrano et al., 2006). Cytoplasmic expression was described in sporadic breast tumors (Rakha et al., 2004).

Description CTCF was originally described as a c-myc activator (Klenova et al., 1993). It is a 727 aa protein with a MW of 82.8 kD, a charge of 8.5 and an iso electric point of 6.95 (Ensembl). The central domain with 11 zinc fingers of the C2H2 type is highly conserved.

Expression CTCF is an abundant and ubiquitously expressed protein, yet absent in primary spermatocytes (Loukinov et al., 2002). It is downregulated during differentiation of human myeloid leukemia cells (Delgado et al., 1999; Torrano et al., 2005). Post-traductional modifications include acetylation (Choudhary et al., 2009), sumoylation (Kitchen and Schoenherr, 2010; MacPherson et al., 2009), which is regulated by hypoxic stress (Wang et al., 2012a), phosphorylation, in particular ser604-612 by CKII (El-Kady and Klenova, 2005; Klenova et al., 2001), and poly(ADPribo)sylation (see figure 2). The latter modification is lost or decreased in proliferating cells


Function CTCF is an essential protein, since KO mice die before ED 9.5 (Heath et al., 2008) (reviewed in Filippova, 2008; Phillips and Corces, 2009). It interacts with numerous ubiquitous and cell-type specific genomic sites (Chen et al., 2008; Bao et al., 2008; Barski et al., 2007; Kim et al., 2007; Chen et al., 2012). The 11 Zn fingers would provide flexibility in DNA recognition (Filippova et al., 1996), the central 4 bind to a consensus DNA sequence (Filippova et al., 1998;

803


Piette J

driven by retrotransposon expansion (Schmidt et al., 2012).

Renda et al., 2007). Multiple interacting proteins were described including RNA polymerase II (Chernukhin et al., 2007), cohesin (Parelho et al., 2008; Rubio et al., 2008; Wendt et al., 2008; Xiao et al., 2011), Suz12 (Li et al., 2008), CHD8 (Ishihara et al., 2006), YY1 (Donohoe et al., 2007), nucleophosmin (Yusufzai et al., 2004), Kaiso (Defossez et al., 2005) and Sin3A (Lutz et al., 2000). XPG endonuclease promotes DNA breaks and DNA demethylation at promoters allowing the recruitment of CTCF and gene looping, which is further stabilized by XPF (Le May et al., 2012). By mediating intra and interchromosomal contacts through its interaction with cohesin, CTCF plays a central role in organization of topological domains inside the nucleus. Cell-type specific binding sites lead to specific interactomes and transcriptional programs (Hou et al., 2010; Handoko et al., 2011; Dixon et al., 2012; Botta et al., 2010; reviewed by Merkenschlager and Odom, 2013). The plasticity in binding sites occupancy is linked to DNA methylation (Wang et al., 2012b) and could depend also on CTCF interaction with other factors (see concept of modular insulators in Weth et al., 2010). One thoroughly studied factor is the thyroid receptor (Awad et al., 1999; Lutz et al., 2003). Its peculiar chromosomal environment could explain the multiple (not necessarily exclusive) functions that were described for CTCF, including chromatin barrier (Cuddapah et al., 2009; Witcher and Emerson, 2009), promoter insulation from enhancer (Bell et al., 1999) or silencer (Hou et al., 2008), transcriptional activation (Gombert and Krumm, 2009) (for instance of the tumour suppressor genes INK4A/ARF (Rodriguez et al., 2010) and p53 (Soto-Reyes and Recillas-Targa, 2010)), repression (for instance hTERT (Renaud et al., 2005)), nucleosome positioning (Fu et al., 2008b), protection from DNA methylation (Mukhopadhyay et al., 2004; Schoenherr et al., 2003; Guastafierro et al., 2008), preservation of triplet-repeat stability (Cho et al., 2005; Filippova et al., 2001; Libby et al., 2008), imprinting (Fedoriw et al., 2004; Fitzpatrick et al., 2007), X chromosome inactivation (Chao et al., 2002), chromosome "kissing" (Ling et al., 2006), transvection (Liu et al., 2008), death signaling (Docquier et al., 2005; Gomes and Espinosa, 2010; Li and Lu, 2007), replication timing (Bergstrom et al., 2007), mitotic bookmarking (Burke et al., 2005), MHC class II gene expression (Majumder et al., 2008), V(D)J recombination (Guo et al., 2011; reviewed by Chaumeil and Skok, 2012), miRNA expression (Saito and Saito, 2012), telomere end protection (Deng et al., 2012), neuronal diversity (Monahan et al., 2012), myogenesis (Delgado-Olguin et al., 2011), splicing (Shukla et al., 2011) and angiogenesis (Tang et al., 2011). Considering the central role of CTCF in transcriptional regulation, it is likely to play a role in adaptive evolution in Drosophila (Ni et al., 2012), and in the evolutionary succes of bilateria (Heger et al., 2012). Remodeling of CTCF binding sites and the accompanying interactome during evolution could be


Homology 49 orthologues were described including D. melanogaster (Smith et al., 2009) and C. elegans proteins (Moon et al., 2005), 3 paralogues: CTCFL or BORIS, originating from a gene duplication in reptiles (Hore et al., 2008; Loukinov et al., 2002), and possibly ZFP64 (Mack et al., 1997) and the Histone H4 transcription factor HINF-P (van Wijnen et al., 1991).

Mutations Note SNP at AA 630 /K /E 90 /D /G 447 fR (NCBI).

Germinal Non-coding mutations only.

Somatic Mutations are rare and include point mutations of Znfingers in breast (BT) (Aulmann et al., 2003), prostate (PT) and Wilms tumor (WT) (Filippova et al., 2002; Tiffen et al., 2013), insertion in BT (Aulmann et al., 2003) (see figure 2), and indels in AML (Dolnik et al., 2012).

Implicated in Various cancers Note There is evidence for a tumor-suppressor role of CTCF (reviewed in Fiorentino and Giordano, 2012). LOH of CTCF was described in many cancers together with potential tumor suppressor genes (TSG), including ECad, since it is part of a larger deletion (Cancer Chromosomes; Sanger institute). In addition to WT (Yeh et al., 2002; Mummert et al., 2005), BT (Rakha et al., 2004), PT (Filippova et al., 1998), LOH was found in laryngeal squamous cell carcinoma (Grbesa et al., 2008), however, there is no evidence that CTCF is the TSG at 16q22.1 (Rakha et al., 2005), except possibly in lobular carcinoma in situ of the breast (Green et al., 2009). CTCF was also described to be overexpressed in BT (Docquier et al., 2005). An indirect role of CTCF in tumor progression is mainly suggested by mutation or aberrant methylation of its bindings sites (reviewed by Recillas-Targa et al., 2006). Interestingly, a causal link between LOH of CTCF and hypermethylation was proposed by Mummert et al. in 2005, although no real correlation was found by Yeh et al. in 2002. Methylation of CTCF sites was first described in the IGF2 imprinting control region in WT (Cui et al., 2001). Aberrant methylation of this region was also found in PT (Fu et al., 2008a; Paradowska et al., 2009), HNSCC (De Castro Valente Esteves et al., 2006; Esteves et al., 2005), colorectal cancer (Nakagawa et al., 2001), osteosarcoma (Ulaner et al., 2003), ovarian carcinoma (Dammann et al., 2010) and laryngeal

804


Piette J

squamous cell carcinoma (Grbesa et al., 2008). Hypomethylation was described in bladder cancer (Takai et al., 2001). YY1 binds with CTCF to a hypomethylated form of the macrosatellite DXZ4 on the inactive X chromosome in some male carcinomas (Moseley et al., 2012). Microdeletions were described in Beckwith-Wiedemann syndrome and WT (Prawitt et al., 2005; Sparago et al., 2007; Beygo et al., 2013). Other methylated CTCF targets were found in the genes AWT1 or WT1-AS in WT (Hancock et al., 2007), Bcl6 in B cell lymphomas (Lai et al., 2010), the miR125b locus in breast cancer (Soto-Reyes et al., 2012), p53, pRb (De La Rosa-Velazquez et al., 2007; Davalos-Salas et al., 2011), ARF (Tam et al., 2003; Rodriguez et al., 2010), INK4B, BRCA1 (Butcher et al., 2004; Butcher and Rodenhiser, 2007; Xu et al., 2010) and Rasgrf1 (Yoon et al., 2005). CTCF and its paralogue BORIS regulate pRb in lung cancer (Fiorentino et al., 2011), and CTCF could regulate the response to oestrogen in breast cancer (Zhang et al., 2010). We describe below the rare cases of point mutations affecting the CTCF protein.

Acute myeloid leukemia (AML) Note (Dolnik et al., 2012). Cytogenetics indels.

References van Wijnen AJ, Ramsey-Ewing AL, Bortell R et al.. Transcriptional element H4-site II of cell cycle regulated human H4 histone genes is a multipartite protein/DNA interaction site for factors HiNF-D, HiNF-M, and HiNF-P: involvement of phosphorylation. J Cell Biochem. 1991 Jun;46(2):174-89 Klenova EM, Nicolas RH, Paterson HF, Carne AF, Heath CM, Goodwin GH, Neiman PE, Lobanenkov VV. CTCF, a conserved nuclear factor required for optimal transcriptional activity of the chicken c-myc gene, is an 11-Zn-finger protein differentially expressed in multiple forms. Mol Cell Biol. 1993 Dec;13(12):7612-24 Filippova GN, Fagerlie S, Klenova EM, Myers C, Dehner Y, Goodwin G, Neiman PE, Collins SJ, Lobanenkov VV. An exceptionally conserved transcriptional repressor, CTCF, employs different combinations of zinc fingers to bind diverged promoter sequences of avian and mammalian c-myc oncogenes. Mol Cell Biol. 1996 Jun;16(6):2802-13

Invasive ductal breast carcinoma, grade 2

Mack HG, Beck F, Bowtell DD. A search for a mammalian homologue of the Drosophila photoreceptor development gene glass yields Zfp64, a zinc finger encoding gene which maps to the distal end of mouse chromosome 2. Gene. 1997 Jan 31;185(1):11-7

Note G2 grade tumor, no protein detected (Aulmann et al., 2003). Cytogenetics 14 bp insertion at AA D91, see figure 2.

Filippova GN, Lindblom A, Meincke LJ, Klenova EM, Neiman PE, Collins SJ, Doggett NA, Lobanenkov VV. A widely expressed transcription factor with multiple DNA sequence specificity, CTCF, is localized at chromosome segment 16q22.1 within one of the smallest regions of overlap for common deletions in breast and prostate cancers. Genes Chromosomes Cancer. 1998 May;22(1):26-36

Invasive ductal breast carcinoma, grade 3

Awad TA, Bigler J, Ulmer JE, Hu YJ, Moore JM, Lutz M, Neiman PE, Collins SJ, Renkawitz R, Lobanenkov VV, Filippova GN. Negative transcriptional regulation mediated by thyroid hormone response element 144 requires binding of the multivalent factor CTCF to a novel target DNA sequence. J Biol Chem. 1999 Sep 17;274(38):27092-8

Note G3 grade tumor (Aulmann et al., 2003). Cytogenetics LOH and Q72H, figure 2.

Breast cancer

Bell AC, West AG, Felsenfeld G. The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell. 1999 Aug 6;98(3):387-96

Note Zinc finger mutation (Filippova et al., 2002). Cytogenetics LOH and K343E, figure 2.

Delgado MD, Chernukhin IV, Bigas A, Klenova EM, León J. Differential expression and phosphorylation of CTCF, a c-myc transcriptional regulator, during differentiation of human myeloid cells. FEBS Lett. 1999 Feb 5;444(1):5-10

Prostate cancer

Lutz M, Burke LJ, Barreto G, Goeman F, Greb H, Arnold R, Schultheiss H, Brehm A, Kouzarides T, Lobanenkov V, Renkawitz R. Transcriptional repression by the insulator protein CTCF involves histone deacetylases. Nucleic Acids Res. 2000 Apr 15;28(8):1707-13

Note Zinc finger mutation (Filippova et al., 2002). Cytogenetics LOH and H344E, figure 2.

Cui H, Niemitz EL, Ravenel JD, Onyango P, Brandenburg SA, Lobanenkov VV, Feinberg AP. Loss of imprinting of insulin-like growth factor-II in Wilms' tumor commonly involves altered methylation but not mutations of CTCF or its binding site. Cancer Res. 2001 Jul 1;61(13):4947-50

Wilms tumor Note Zinc finger mutation (Filippova et al., 2002). Cytogenetics LOH and R339W or R448Q, figure 2.


Filippova GN, Thienes CP, Penn BH, Cho DH, Hu YJ, Moore JM, Klesert TR, Lobanenkov VV, Tapscott SJ. CTCF-binding sites flank CTG/CAG repeats and form a methylation-sensitive insulator at the DM1 locus. Nat Genet. 2001 Aug;28(4):335-43

805


Piette J

Klenova EM, Chernukhin IV, El-Kady A, Lee RE, Pugacheva EM, Loukinov DI, Goodwin GH, Delgado D, Filippova GN, León J, Morse HC 3rd, Neiman PE, Lobanenkov VV. Functional phosphorylation sites in the C-terminal region of the multivalent multifunctional transcriptional factor CTCF. Mol Cell Biol. 2001 Mar;21(6):2221-34

unmethylated region of the BRCA1 promoter. Int J Cancer. 2004 Sep 20;111(5):669-78

Nakagawa H, Chadwick RB, Peltomaki P, Plass C, Nakamura Y, de La Chapelle A. Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer. Proc Natl Acad Sci U S A. 2001 Jan 16;98(2):591-6

Mukhopadhyay R, Yu W, Whitehead J, Xu J, Lezcano M, Pack S, Kanduri C, Kanduri M, Ginjala V, Vostrov A, Quitschke W, Chernukhin I, Klenova E, Lobanenkov V, Ohlsson R. The binding sites for the chromatin insulator protein CTCF map to DNA methylation-free domains genome-wide. Genome Res. 2004 Aug;14(8):1594-602

Fedoriw AM, Stein P, Svoboda P, Schultz RM, Bartolomei MS. Transgenic RNAi reveals essential function for CTCF in H19 gene imprinting. Science. 2004 Jan 9;303(5655):238-40

Takai D, Gonzales FA, Tsai YC, Thayer MJ, Jones PA. Large scale mapping of methylcytosines in CTCF-binding sites in the human H19 promoter and aberrant hypomethylation in human bladder cancer. Hum Mol Genet. 2001 Nov 1;10(23):2619-26

Rakha EA, Pinder SE, Paish CE, Ellis IO. Expression of the transcription factor CTCF in invasive breast cancer: a candidate gene located at 16q22.1. Br J Cancer. 2004 Oct 18;91(8):1591-6

Chao W, Huynh KD, Spencer RJ, Davidow LS, Lee JT. CTCF, a candidate trans-acting factor for X-inactivation choice. Science. 2002 Jan 11;295(5553):345-7

Yu W, Ginjala V, Pant V, Chernukhin I, Whitehead J, Docquier F, Farrar D, Tavoosidana G, Mukhopadhyay R, Kanduri C, Oshimura M, Feinberg AP, Lobanenkov V, Klenova E, Ohlsson R. Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat Genet. 2004 Oct;36(10):1105-10

Filippova GN, Qi CF, Ulmer JE, Moore JM, Ward MD, Hu YJ, Loukinov DI, Pugacheva EM, Klenova EM, Grundy PE, Feinberg AP, Cleton-Jansen AM, Moerland EW, Cornelisse CJ, Suzuki H, Komiya A, Lindblom A, Dorion-Bonnet F, Neiman PE, Morse HC 3rd, Collins SJ, Lobanenkov VV. Tumor-associated zinc finger mutations in the CTCF transcription factor selectively alter tts DNA-binding specificity. Cancer Res. 2002 Jan 1;62(1):48-52

Yusufzai TM, Felsenfeld G. The 5'-HS4 chicken beta-globin insulator is a CTCF-dependent nuclear matrix-associated element. Proc Natl Acad Sci U S A. 2004 Jun 8;101(23):8620-4 Yusufzai TM, Tagami H, Nakatani Y, Felsenfeld G. CTCF tethers an insulator to subnuclear sites, suggesting shared insulator mechanisms across species. Mol Cell. 2004 Jan 30;13(2):291-8

Loukinov DI, Pugacheva E, Vatolin S, Pack SD, Moon H, Chernukhin I, Mannan P, Larsson E, Kanduri C, Vostrov AA, Cui H, Niemitz EL, Rasko JE, Docquier FM, Kistler M, Breen JJ, Zhuang Z, Quitschke WW, Renkawitz R, Klenova EM, Feinberg AP, Ohlsson R, Morse HC 3rd, Lobanenkov VV. BORIS, a novel male germ-line-specific protein associated with epigenetic reprogramming events, shares the same 11-zincfinger domain with CTCF, the insulator protein involved in reading imprinting marks in the soma. Proc Natl Acad Sci U S A. 2002 May 14;99(10):6806-11

Zhang R, Burke LJ, Rasko JE, Lobanenkov V, Renkawitz R. Dynamic association of the mammalian insulator protein CTCF with centrosomes and the midbody. Exp Cell Res. 2004 Mar 10;294(1):86-93 Zhou XL, Werelius B, Lindblom A. A screen for germline mutations in the gene encoding CCCTC-binding factor (CTCF) in familial non-BRCA1/BRCA2 breast cancer. Breast Cancer Res. 2004;6(3):R187-90

Yeh A, Wei M, Golub SB, Yamashiro DJ, Murty VV, Tycko B. Chromosome arm 16q in Wilms tumors: unbalanced chromosomal translocations, loss of heterozygosity, and assessment of the CTCF gene. Genes Chromosomes Cancer. 2002 Oct;35(2):156-63

Burke LJ, Zhang R, Bartkuhn M, Tiwari VK, Tavoosidana G, Kurukuti S, Weth C, Leers J, Galjart N, Ohlsson R, Renkawitz R. CTCF binding and higher order chromatin structure of the H19 locus are maintained in mitotic chromatin. EMBO J. 2005 Sep 21;24(18):3291-300

Aulmann S, Bläker H, Penzel R, Rieker RJ, Otto HF, Sinn HP. CTCF gene mutations in invasive ductal breast cancer. Breast Cancer Res Treat. 2003 Aug;80(3):347-52

Cho DH, Thienes CP, Mahoney SE, Analau E, Filippova GN, Tapscott SJ. Antisense transcription and heterochromatin at the DM1 CTG repeats are constrained by CTCF. Mol Cell. 2005 Nov 11;20(3):483-9

Dunn KL, Zhao H, Davie JR. The insulator binding protein CTCF associates with the nuclear matrix. Exp Cell Res. 2003 Aug 1;288(1):218-23

Defossez PA, Kelly KF, Filion GJ, Pérez-Torrado R, Magdinier F, Menoni H, Nordgaard CL, Daniel JM, Gilson E. The human enhancer blocker CTC-binding factor interacts with the transcription factor Kaiso. J Biol Chem. 2005 Dec 30;280(52):43017-23

Lutz M, Burke LJ, LeFevre P, Myers FA, Thorne AW, CraneRobinson C, Bonifer C, Filippova GN, Lobanenkov V, Renkawitz R. Thyroid hormone-regulated enhancer blocking: cooperation of CTCF and thyroid hormone receptor. EMBO J. 2003 Apr 1;22(7):1579-87

Docquier F, Farrar D, D'Arcy V, Chernukhin I, Robinson AF, Loukinov D, Vatolin S, Pack S, Mackay A, Harris RA, Dorricott H, O'Hare MJ, Lobanenkov V, Klenova E. Heightened expression of CTCF in breast cancer cells is associated with resistance to apoptosis. Cancer Res. 2005 Jun 15;65(12):5112-22

Schoenherr CJ, Levorse JM, Tilghman SM. CTCF maintains differential methylation at the Igf2/H19 locus. Nat Genet. 2003 Jan;33(1):66-9 Tam AS, Devereux TR et al.. Perturbations of the Ink4a/Arf gene locus in aflatoxin B1-induced mouse lung tumors. Carcinogenesis. 2003 Jan;24(1):121-32

El-Kady A, Klenova E. Regulation of the transcription factor, CTCF, by phosphorylation with protein kinase CK2. FEBS Lett. 2005 Feb 28;579(6):1424-34

Ulaner GA, Vu TH, Li T, Hu JF, Yao XM, Yang Y, Gorlick R, Meyers P, Healey J, Ladanyi M, Hoffman AR. Loss of imprinting of IGF2 and H19 in osteosarcoma is accompanied by reciprocal methylation changes of a CTCF-binding site. Hum Mol Genet. 2003 Mar 1;12(5):535-49

Esteves LI, Javaroni AC, Nishimoto IN, Magrin J, Squire JA, Kowalski LP, Rainho CA, Rogatto SR. DNA methylation in the CTCF-binding site I and the expression pattern of the H19 gene: does positive expression predict poor prognosis in early stage head and neck carcinomas? Mol Carcinog. 2005 Oct;44(2):102-10

Butcher DT, Mancini-DiNardo DN, Archer TK, Rodenhiser DI. DNA binding sites for putative methylation boundaries in the


806


Piette J

Moon H, Filippova G, Loukinov D, Pugacheva E, Chen Q, Smith ST, Munhall A, Grewe B, Bartkuhn M, Arnold R, Burke LJ, Renkawitz-Pohl R, Ohlsson R, Zhou J, Renkawitz R, Lobanenkov V. CTCF is conserved from Drosophila to humans and confers enhancer blocking of the Fab-8 insulator. EMBO Rep. 2005 Feb;6(2):165-70

methylations in the 18;129(4):823-37

Mummert SK, Lobanenkov VA, Feinberg AP. Association of chromosome arm 16q loss with loss of imprinting of insulin-like growth factor-II in Wilms tumor. Genes Chromosomes Cancer. 2005 Jun;43(2):155-61

Butcher DT, Rodenhiser DI. Epigenetic inactivation of BRCA1 is associated with aberrant expression of CTCF and DNA methyltransferase (DNMT3B) in some sporadic breast tumours. Eur J Cancer. 2007 Jan;43(1):210-9

Prawitt D, Enklaar T, Gärtner-Rupprecht B, Spangenberg C, Oswald M, Lausch E, Schmidtke P, Reutzel D, Fees S, Lucito R, Korzon M, Brozek I, Limon J, Housman DE, Pelletier J, Zabel B. Microdeletion of target sites for insulator protein CTCF in a chromosome 11p15 imprinting center in BeckwithWiedemann syndrome and Wilms' tumor. Proc Natl Acad Sci U S A. 2005 Mar 15;102(11):4085-90

Chernukhin I, Shamsuddin S, Kang SY, Bergström R, Kwon YW, Yu W, Whitehead J, Mukhopadhyay R, Docquier F, Farrar D, Morrison I, Vigneron M, Wu SY, Chiang CM, Loukinov D, Lobanenkov V, Ohlsson R, Klenova E. CTCF interacts with and recruits the largest subunit of RNA polymerase II to CTCF target sites genome-wide. Mol Cell Biol. 2007 Mar;27(5):163148

Rakha EA, Armour JA, Pinder SE, Paish CE, Ellis IO. Highresolution analysis of 16q22.1 in breast carcinoma using DNA amplifiable probes (multiplex amplifiable probe hybridization technique) and immunohistochemistry. Int J Cancer. 2005 May 1;114(5):720-9

De La Rosa-Velázquez IA, Rincón-Arano H, Benítez-Bribiesca L, Recillas-Targa F. Epigenetic regulation of the human retinoblastoma tumor suppressor gene promoter by CTCF. Cancer Res. 2007 Mar 15;67(6):2577-85

human genome.

Cell.

2007

May

Bergström R, Whitehead J, Kurukuti S, Ohlsson R. CTCF regulates asynchronous replication of the imprinted H19/Igf2 domain. Cell Cycle. 2007 Feb 15;6(4):450-4

Donohoe ME, Zhang LF, Xu N, Shi Y, Lee JT. Identification of a Ctcf cofactor, Yy1, for the X chromosome binary switch. Mol Cell. 2007 Jan 12;25(1):43-56

Renaud S, Loukinov D, Bosman FT, Lobanenkov V, Benhattar J. CTCF binds the proximal exonic region of hTERT and inhibits its transcription. Nucleic Acids Res. 2005;33(21):685060

Fitzpatrick GV, Pugacheva EM, Shin JY, Abdullaev Z, Yang Y, Khatod K, Lobanenkov VV, Higgins MJ. Allele-specific binding of CTCF to the multipartite imprinting control region KvDMR1. Mol Cell Biol. 2007 Apr;27(7):2636-47

Torrano V, Chernukhin I, Docquier F, D'Arcy V, León J, Klenova E, Delgado MD. CTCF regulates growth and erythroid differentiation of human myeloid leukemia cells. J Biol Chem. 2005 Jul 29;280(30):28152-61

Gao J, Li T, Lu L. Functional role of CCCTC binding factor in insulin-stimulated cell proliferation. Cell Prolif. 2007 Dec;40(6):795-808

Yoon B, Herman H, Hu B, Park YJ, Lindroth A, Bell A, West AG, Chang Y, Stablewski A, Piel JC, Loukinov DI, Lobanenkov VV, Soloway PD. Rasgrf1 imprinting is regulated by a CTCFdependent methylation-sensitive enhancer blocker. Mol Cell Biol. 2005 Dec;25(24):11184-90

Hancock AL, Brown KW, Moorwood K, Moon H, Holmgren C, Mardikar SH, Dallosso AR, Klenova E, Loukinov D, Ohlsson R, Lobanenkov VV, Malik K. A CTCF-binding silencer regulates the imprinted genes AWT1 and WT1-AS and exhibits sequential epigenetic defects during Wilms' tumourigenesis. Hum Mol Genet. 2007 Feb 1;16(3):343-54

De Castro Valente Esteves LI, De Karla Cervigne N, Do Carmo Javaroni A, Magrin J, Kowalski LP, Rainho CA, Rogatto SR. H19-DMR allele-specific methylation analysis reveals epigenetic heterogeneity of CTCF binding site 6 but not of site 5 in head-and-neck carcinomas: a pilot case-control analysis. Int J Mol Med. 2006 Feb;17(2):397-404

Kim TH, Abdullaev ZK, Smith AD, Ching KA, Loukinov DI, Green RD, Zhang MQ, Lobanenkov VV, Ren B. Analysis of the vertebrate insulator protein CTCF-binding sites in the human genome. Cell. 2007 Mar 23;128(6):1231-45

Ishihara K, Oshimura M, Nakao M. CTCF-dependent chromatin insulator is linked to epigenetic remodeling. Mol Cell. 2006 Sep 1;23(5):733-42

Li T, Lu L. Functional role of CCCTC binding factor (CTCF) in stress-induced apoptosis. Exp Cell Res. 2007 Aug 15;313(14):3057-65

Ling JQ, Li T, Hu JF, Vu TH, Chen HL, Qiu XW, Cherry AM, Hoffman AR. CTCF mediates interchromosomal colocalization between Igf2/H19 and Wsb1/Nf1. Science. 2006 Apr 14;312(5771):269-72

Renda M, Baglivo I, Burgess-Beusse B, Esposito S, Fattorusso R, Felsenfeld G, Pedone PV. Critical DNA binding interactions of the insulator protein CTCF: a small number of zinc fingers mediate strong binding, and a single finger-DNA interaction controls binding at imprinted loci. J Biol Chem. 2007 Nov 16;282(46):33336-45

Recillas-Targa F, De La Rosa-Velázquez IA, Soto-Reyes E, Benítez-Bribiesca L. Epigenetic boundaries of tumour suppressor gene promoters: the CTCF connection and its role in carcinogenesis. J Cell Mol Med. 2006 Jul-Sep;10(3):554-68

Sparago A, Russo S, Cerrato F, Ferraiuolo S, Castorina P, Selicorni A, Schwienbacher C, Negrini M, Ferrero GB, Silengo MC, Anichini C, Larizza L, Riccio A. Mechanisms causing imprinting defects in familial Beckwith-Wiedemann syndrome with Wilms' tumour. Hum Mol Genet. 2007 Feb 1;16(3):254-64

Splinter E, Heath H, Kooren J, Palstra RJ, Klous P, Grosveld F, Galjart N, de Laat W. CTCF mediates long-range chromatin looping and local histone modification in the beta-globin locus. Genes Dev. 2006 Sep 1;20(17):2349-54

Bao L, Zhou M, Cui Y. CTCFBSDB: a CTCF-binding site database for characterization of vertebrate genomic insulators. Nucleic Acids Res. 2008 Jan;36(Database issue):D83-7

Torrano V, Navascués J, Docquier F, Zhang R, Burke LJ, Chernukhin I, Farrar D, León J, Berciano MT, Renkawitz R, Klenova E, Lafarga M, Delgado MD. Targeting of CTCF to the nucleolus inhibits nucleolar transcription through a poly(ADPribosyl)ation-dependent mechanism. J Cell Sci. 2006 May 1;119(Pt 9):1746-59

Chen X, Xu H, Yuan P, Fang F, Huss M, Vega VB, Wong E, Orlov YL, Zhang W, Jiang J, Loh YH, Yeo HC, Yeo ZX, Narang V, Govindarajan KR, Leong B, Shahab A, Ruan Y, Bourque G, Sung WK, Clarke ND, Wei CL, Ng HH. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell. 2008 Jun 13;133(6):1106-17

Barski A, Cuddapah S, Cui K, Roh TY, Schones DE, Wang Z, Wei G, Chepelev I, Zhao K. High-resolution profiling of histone


807


Piette J

Filippova GN. Genetics and epigenetics of the multifunctional protein CTCF. Curr Top Dev Biol. 2008;80:337-60

physically links cohesin to chromatin. Proc Natl Acad Sci U S A. 2008 Jun 17;105(24):8309-14

Fu VX, Dobosy JR, Desotelle JA, Almassi N, Ewald JA, Srinivasan R, Berres M, Svaren J, Weindruch R, Jarrard DF. Aging and cancer-related loss of insulin-like growth factor 2 imprinting in the mouse and human prostate. Cancer Res. 2008a Aug 15;68(16):6797-802

Wendt KS, Yoshida K, Itoh T, Bando M, Koch B, Schirghuber E, Tsutsumi S, Nagae G, Ishihara K, Mishiro T, Yahata K, Imamoto F, Aburatani H, Nakao M, Imamoto N, Maeshima K, Shirahige K, Peters JM. Cohesin mediates transcriptional insulation by CCCTC-binding factor. Nature. 2008 Feb 14;451(7180):796-801

Fu Y, Sinha M, Peterson CL, Weng Z. The insulator binding protein CTCF positions 20 nucleosomes around its binding sites across the human genome. PLoS Genet. 2008b Jul 25;4(7):e1000138

Chen RQ, Yang QK, Lu BW, Yi W, Cantin G, Chen YL, Fearns C, Yates JR 3rd, Lee JD. CDC25B mediates rapamycininduced oncogenic responses in cancer cells. Cancer Res. 2009 Mar 15;69(6):2663-8

Grbesa I, Marinkovic M, Ivkic M, Kruslin B, Novak-Kujundzic R, Pegan B, Bogdanovic O, Bedekovic V, Gall-Troselj K. Loss of imprinting of IGF2 and H19, loss of heterozygosity of IGF2R and CTCF, and Helicobacter pylori infection in laryngeal squamous cell carcinoma. J Mol Med (Berl). 2008 Sep;86(9):1057-66

Choudhary C, Kumar C, Gnad F, Nielsen ML, Rehman M, Walther TC, Olsen JV, Mann M. Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science. 2009 Aug 14;325(5942):834-40 Cuddapah S, Jothi R, Schones DE, Roh TY, Cui K, Zhao K. Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains. Genome Res. 2009 Jan;19(1):24-32

Guastafierro T, Cecchinelli B, Zampieri M, Reale A, Riggio G, Sthandier O, Zupi G, Calabrese L, Caiafa P. CCCTC-binding factor activates PARP-1 affecting DNA methylation machinery. J Biol Chem. 2008 Aug 8;283(32):21873-80

Docquier F, Kita GX, Farrar D, Jat P, O'Hare M, Chernukhin I, Gretton S, Mandal A, Alldridge L, Klenova E. Decreased poly(ADP-ribosyl)ation of CTCF, a transcription factor, is associated with breast cancer phenotype and cell proliferation. Clin Cancer Res. 2009 Sep 15;15(18):5762-71

Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Talhout W, Eussen BH, de Klein A, Wessels L, de Laat W, van Steensel B. Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature. 2008 Jun 12;453(7197):948-51

Gombert WM, Krumm A. Targeted deletion of multiple CTCFbinding elements in the human C-MYC gene reveals a requirement for CTCF in C-MYC expression. PLoS One. 2009 Jul 1;4(7):e6109

Heath H, Ribeiro de Almeida C, Sleutels F, Dingjan G, van de Nobelen S, Jonkers I, Ling KW, Gribnau J, Renkawitz R, Grosveld F, Hendriks RW, Galjart N. CTCF regulates cell cycle progression of alphabeta T cells in the thymus. EMBO J. 2008 Nov 5;27(21):2839-50

Green AR, Krivinskas S, Young P, Rakha EA, Paish EC, Powe DG, Ellis IO. Loss of expression of chromosome 16q genes DPEP1 and CTCF in lobular carcinoma in situ of the breast. Breast Cancer Res Treat. 2009 Jan;113(1):59-66

Hore TA, Deakin JE, Marshall Graves JA. The evolution of epigenetic regulators CTCF and BORIS/CTCFL in amniotes. PLoS Genet. 2008 Aug 29;4(8):e1000169

MacPherson MJ, Beatty LG, Zhou W, Du M, Sadowski PD. The CTCF insulator protein is posttranslationally modified by SUMO. Mol Cell Biol. 2009 Feb;29(3):714-25

Hou C, Zhao H, Tanimoto K, Dean A. CTCF-dependent enhancer-blocking by alternative chromatin loop formation. Proc Natl Acad Sci U S A. 2008 Dec 23;105(51):20398-403

Ottaviani A, Schluth-Bolard C, Rival-Gervier S, Boussouar A, Rondier D, Foerster AM, Morere J, Bauwens S, Gazzo S, Callet-Bauchu E, Gilson E, Magdinier F. Identification of a perinuclear positioning element in human subtelomeres that requires A-type lamins and CTCF. EMBO J. 2009 Aug 19;28(16):2428-36

Li T, Hu JF, Qiu X, Ling J, Chen H, Wang S, Hou A, Vu TH, Hoffman AR. CTCF regulates allelic expression of Igf2 by orchestrating a promoter-polycomb repressive complex 2 intrachromosomal loop. Mol Cell Biol. 2008 Oct;28(20):6473-82 Libby RT, Hagerman KA, Pineda VV, Lau R, Cho DH, Baccam SL, Axford MM, Cleary JD, Moore JM, Sopher BL, Tapscott SJ, Filippova GN, Pearson CE, La Spada AR. CTCF cis-regulates trinucleotide repeat instability in an epigenetic manner: a novel basis for mutational hot spot determination. PLoS Genet. 2008 Nov;4(11):e1000257

Paradowska A, Fenic I, Konrad L, Sturm K, Wagenlehner F, Weidner W, Steger K. Aberrant epigenetic modifications in the CTCF binding domain of the IGF2/H19 gene in prostate cancer compared with benign prostate hyperplasia. Int J Oncol. 2009 Jul;35(1):87-96

Liu H, Huang J, Wang J, Jiang S, Bailey AS, Goldman DC, Welcker M, Bedell V, Slovak ML, Clurman B, Thayer M, Fleming WH, Epner E. Transvection mediated by the translocated cyclin D1 locus in mantle cell lymphoma. J Exp Med. 2008 Aug 4;205(8):1843-58

Phillips JE, Corces VG. CTCF: master weaver of the genome. Cell. 2009 Jun 26;137(7):1194-211 Smith ST, Wickramasinghe P, Olson A, Loukinov D, Lin L, Deng J, Xiong Y, Rux J, Sachidanandam R, Sun H, Lobanenkov V, Zhou J. Genome wide ChIP-chip analyses reveal important roles for CTCF in Drosophila genome organization. Dev Biol. 2009 Apr 15;328(2):518-28

Majumder P, Gomez JA, Chadwick BP, Boss JM. The insulator factor CTCF controls MHC class II gene expression and is required for the formation of long-distance chromatin interactions. J Exp Med. 2008 Apr 14;205(4):785-98

Witcher M, Emerson BM. Epigenetic silencing of the p16(INK4a) tumor suppressor is associated with loss of CTCF binding and a chromatin boundary. Mol Cell. 2009 May 15;34(3):271-84

Parelho V, Hadjur S, Spivakov M, Leleu M, Sauer S, Gregson HC, Jarmuz A, Canzonetta C, Webster Z, Nesterova T, Cobb BS, Yokomori K, Dillon N, Aragon L, Fisher AG, Merkenschlager M. Cohesins functionally associate with CTCF on mammalian chromosome arms. Cell. 2008 Feb 8;132(3):422-33

Botta M, Haider S, Leung IX, Lio P, Mozziconacci J. Intra- and inter-chromosomal interactions correlate with CTCF binding genome wide. Mol Syst Biol. 2010 Nov 2;6:426 Dammann RH, Kirsch S, Schagdarsurengin U, Dansranjavin T, Gradhand E, Schmitt WD, Hauptmann S. Frequent aberrant

Rubio ED, Reiss DJ, Welcsh PL, Disteche CM, Filippova GN, Baliga NS, Aebersold R, Ranish JA, Krumm A. CTCF


808


Piette J

methylation of the imprinted IGF2/H19 locus and LINE1 hypomethylation in ovarian carcinoma. Int J Oncol. 2010 Jan;36(1):171-9

Handoko L, Xu H, Li G, Ngan CY, Chew E, Schnapp M, Lee CW, Ye C, Ping JL, Mulawadi F, Wong E, Sheng J, Zhang Y, Poh T, Chan CS, Kunarso G, Shahab A, Bourque G, CacheuxRataboul V, Sung WK, Ruan Y, Wei CL. CTCF-mediated functional chromatin interactome in pluripotent cells. Nat Genet. 2011 Jun 19;43(7):630-8

Farrar D, Rai S, Chernukhin I, Jagodic M, Ito Y, Yammine S, Ohlsson R, Murrell A, Klenova E. Mutational analysis of the poly(ADP-ribosyl)ation sites of the transcription factor CTCF provides an insight into the mechanism of its regulation by poly(ADP-ribosyl)ation. Mol Cell Biol. 2010 Mar;30(5):1199-216

Shukla S, Kavak E, Gregory M, Imashimizu M, Shutinoski B, Kashlev M, Oberdoerffer P, Sandberg R, Oberdoerffer S. CTCF-promoted RNA polymerase II pausing links DNA methylation to splicing. Nature. 2011 Nov 3;479(7371):74-9

Gomes NP, Espinosa JM. Gene-specific repression of the p53 target gene PUMA via intragenic CTCF-Cohesin binding. Genes Dev. 2010 May 15;24(10):1022-34

Tang M, Chen B, Lin T, Li Z, Pardo C, Pampo C, Chen J, Lien CL, Wu L, Ai L, Wang H, Yao K, Oh SP, Seto E, Smith LE, Siemann DW, Kladde MP, Cepko CL, Lu J. Restraint of angiogenesis by zinc finger transcription factor CTCFdependent chromatin insulation. Proc Natl Acad Sci U S A. 2011 Sep 13;108(37):15231-6

Hou C, Dale R, Dean A. Cell type specificity of chromatin organization mediated by CTCF and cohesin. Proc Natl Acad Sci U S A. 2010 Feb 23;107(8):3651-6 Kitchen NS, Schoenherr CJ. Sumoylation modulates a domain in CTCF that activates transcription and decondenses chromatin. J Cell Biochem. 2010 Oct 15;111(3):665-75

Xiao T, Wallace J, Felsenfeld G. Specific sites in the C terminus of CTCF interact with the SA2 subunit of the cohesin complex and are required for cohesin-dependent insulation activity. Mol Cell Biol. 2011 Jun;31(11):2174-83

Lai AY, Fatemi M, Dhasarathy A, Malone C, Sobol SE, Geigerman C, Jaye DL, Mav D, Shah R, Li L, Wade PA. DNA methylation prevents CTCF-mediated silencing of the oncogene BCL6 in B cell lymphomas. J Exp Med. 2010 Aug 30;207(9):1939-50

Chaumeil J, Skok JA. The role of CTCF in regulating V(D)J recombination. Curr Opin Immunol. 2012 Apr;24(2):153-9 Chen H, Tian Y, Shu W, Bo X, Wang S. Comprehensive identification and annotation of cell type-specific and ubiquitous CTCF-binding sites in the human genome. PLoS One. 2012;7(7):e41374

Lu L, Wang L, Li T, Wang J. NF-kappaB subtypes regulate CCCTC binding factor affecting corneal epithelial cell fate. J Biol Chem. 2010 Mar 26;285(13):9373-82 Rodriguez C, Borgel J, Court F, Cathala G, Forné T, Piette J. CTCF is a DNA methylation-sensitive positive regulator of the INK/ARF locus. Biochem Biophys Res Commun. 2010 Feb 5;392(2):129-34

Deng Z, Wang Z, Stong N, Plasschaert R, Moczan A, Chen HS, Hu S, Wikramasinghe P, Davuluri RV, Bartolomei MS, Riethman H, Lieberman PM. A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection. EMBO J. 2012 Nov 5;31(21):4165-78

Soto-Reyes E, Recillas-Targa F. Epigenetic regulation of the human p53 gene promoter by the CTCF transcription factor in transformed cell lines. Oncogene. 2010 Apr 15;29(15):2217-27

Dixon JR, Selvaraj S, Yue F, Kim A, Li Y, Shen Y, Hu M, Liu JS, Ren B. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 2012 Apr 11;485(7398):376-80

Weth O, Weth C, Bartkuhn M, Leers J, Uhle F, Renkawitz R. Modular insulators: genome wide search for composite CTCF/thyroid hormone receptor binding sites. PLoS One. 2010 Apr 9;5(4):e10119

Dolnik A, Engelmann JC, Scharfenberger-Schmeer M, Mauch J, Kelkenberg-Schade S, Haldemann B, Fries T, Krönke J, Kühn MW, Paschka P, Kayser S, Wolf S, Gaidzik VI, Schlenk RF, Rücker FG, Döhner H, Lottaz C, Döhner K, Bullinger L. Commonly altered genomic regions in acute myeloid leukemia are enriched for somatic mutations involved in chromatin remodeling and splicing. Blood. 2012 Nov 1;120(18):e83-92

Xu J, Huo D, Chen Y, Nwachukwu C, Collins C, Rowell J, Slamon DJ, Olopade OI. CpG island methylation affects accessibility of the proximal BRCA1 promoter to transcription factors. Breast Cancer Res Treat. 2010 Apr;120(3):593-601 Zhang Y, Liang J, Li Y, Xuan C, Wang F, Wang D, Shi L, Zhang D, Shang Y. CCCTC-binding factor acts upstream of FOXA1 and demarcates the genomic response to estrogen. J Biol Chem. 2010 Sep 10;285(37):28604-13

Fiorentino FP, Giordano A. The tumor suppressor role of CTCF. J Cell Physiol. 2012 Feb;227(2):479-92 Heger P, Marin B, Bartkuhn M, Schierenberg E, Wiehe T. The chromatin insulator CTCF and the emergence of metazoan diversity. Proc Natl Acad Sci U S A. 2012 Oct 23;109(43):17507-12

Dávalos-Salas M, Furlan-Magaril M, González-Buendía E, Valdes-Quezada C, Ayala-Ortega E, Recillas-Targa F. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter. BMC Cancer. 2011 Jun 10;11:232

Le May N, Fradin D, Iltis I, Bougnères P, Egly JM. XPG and XPF endonucleases trigger chromatin looping and DNA demethylation for accurate expression of activated genes. Mol Cell. 2012 Aug 24;47(4):622-32

Delgado-Olguín P, Brand-Arzamendi K, Scott IC, Jungblut B, Stainier DY, Bruneau BG, Recillas-Targa F. CTCF promotes muscle differentiation by modulating the activity of myogenic regulatory factors. J Biol Chem. 2011 Apr 8;286(14):12483-94

Monahan K, Rudnick ND, Kehayova PD, Pauli F, Newberry KM, Myers RM, Maniatis T. Role of CCCTC binding factor (CTCF) and cohesin in the generation of single-cell diversity of protocadherin-α gene expression. Proc Natl Acad Sci U S A. 2012 Jun 5;109(23):9125-30

Fiorentino FP, Macaluso M, Miranda F, Montanari M, Russo A, Bagella L, Giordano A. CTCF and BORIS regulate Rb2/p130 gene transcription: a novel mechanism and a new paradigm for understanding the biology of lung cancer. Mol Cancer Res. 2011 Feb;9(2):225-33

Moseley SC, Rizkallah R, Tremblay DC, Anderson BR, Hurt MM, Chadwick BP. YY1 associates with the macrosatellite DXZ4 on the inactive X chromosome and binds with CTCF to a hypomethylated form in some male carcinomas. Nucleic Acids Res. 2012 Feb;40(4):1596-608

Guo C, Yoon HS, Franklin A, Jain S, Ebert A, Cheng HL, Hansen E, Despo O, Bossen C, Vettermann C, Bates JG, Richards N, Myers D, Patel H, Gallagher M, Schlissel MS, Murre C, Busslinger M, Giallourakis CC, Alt FW. CTCF-binding elements mediate control of V(D)J recombination. Nature. 2011 Sep 11;477(7365):424-30


809


Piette J

Ni X, Zhang YE, Nègre N, Chen S, Long M, White KP. Adaptive evolution and the birth of CTCF binding sites in the Drosophila genome. PLoS Biol. 2012;10(11):e1001420

B, Buiting K, Riccio A. The molecular function and clinical phenotype of partial deletions of the IGF2/H19 imprinting control region depends on the spatial arrangement of the remaining CTCF-binding sites. Hum Mol Genet. 2013 Feb 1;22(3):544-57

Saito Y, Saito H. Role of CTCF in the regulation of microRNA expression. Front Genet. 2012;3:186

Guastafierro T, Catizone A, Calabrese R, Zampieri M, Martella O, Bacalini MG, Reale A, Di Girolamo M, Miccheli M, Farrar D, Klenova E, Ciccarone F, Caiafa P. ADP-ribose polymer depletion leads to nuclear Ctcf re-localization and chromatin rearrangement(1). Biochem J. 2013 Feb 1;449(3):623-30

Schmidt D, Schwalie PC, Wilson MD, Ballester B, Gonçalves A, Kutter C, Brown GD, Marshall A, Flicek P, Odom DT. Waves of retrotransposon expansion remodel genome organization and CTCF binding in multiple mammalian lineages. Cell. 2012 Jan 20;148(1-2):335-48

Merkenschlager M, Odom DT. CTCF and cohesin: linking gene regulatory elements with their targets. Cell. 2013 Mar 14;152(6):1285-97

Soto-Reyes E, González-Barrios R, Cisneros-Soberanis F, Herrera-Goepfert R, Pérez V, Cantú D, Prada D, Castro C, Recillas-Targa F, Herrera LA. Disruption of CTCF at the miR125b1 locus in gynecological cancers. BMC Cancer. 2012 Jan 25;12:40

Tiffen JC, Bailey CG, Marshall AD, Metierre C, Feng Y, Wang Q, Watson SL, Holst J, Rasko JE. The cancer-testis antigen BORIS phenocopies the tumor suppressor CTCF in normal and neoplastic cells. Int J Cancer. 2013 Oct 1;133(7):1603-13

Wang J, Wang Y, Lu L. De-SUMOylation of CCCTC binding factor (CTCF) in hypoxic stress-induced human corneal epithelial cells. J Biol Chem. 2012a Apr 6;287(15):12469-79

Ziebarth JD, Bhattacharya A, Cui Y. CTCFBSDB 2.0: a database for CTCF-binding sites and genome organization. Nucleic Acids Res. 2013 Jan;41(Database issue):D188-94

Wang H, Maurano MT, Qu H, Varley KE, Gertz J, Pauli F, Lee K, Canfield T, Weaver M, Sandstrom R, Thurman RE, Kaul R, Myers RM, Stamatoyannopoulos JA. Widespread plasticity in CTCF occupancy linked to DNA methylation. Genome Res. 2012b Sep;22(9):1680-8

This article should be referenced as such: Piette J. CTCF (CCCTC-binding factor (zinc finger protein)). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):802-810.

Beygo J, Citro V, Sparago A, De Crescenzo A, Cerrato F, Heitmann M, Rademacher K, Guala A, Enklaar T, Anichini C, Cirillo Silengo M, Graf N, Prawitt D, Cubellis MV, Horsthemke


810


OPEN ACCESS JOURNAL

Gene Section Review

FBLN5 (fibulin 5) Miao Wang, Rolf A Brekken Hamon Center for Therapeutic Oncology Research, University of Texas Southwestern Medical Center, 6000 Harry Hines Blvd, Dallas, TX 75390-8593, USA (MW, RAB) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/FBLN5ID46779ch14q32.html DOI: 10.4267/2042/51868 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

muscle cells. The expression of Fibulin-5 is downregulated in adult tissue but reactivated upon injury and various disease conditions (Yanagisawa et al., 2009). Fibulin-5 is essential for elastic fiber organization as shown by generation of Fibulin-5 knockout (Fbln5-/-) mice (Nakamura et al., 2002; Yanagisawa et al., 2002) and biochemical analysis (Hirai et al., 2007; Zheng et al., 2007). However, a mouse model with point mutation (D to E) (Fbln5RGE/RGE) in the RGD domain has exhibited intact elastic fibers (Budatha et al., 2011), indicating that Fibulin-5-Integrin interaction is not required for elastic fiber assembly. Fibulin-5 has also been implicated in various pathological conditions including cancer, cutis laxa and age-related macular degeneration.

Identity Other names: ADCL2, ARCL1A, ARMD3, DANCE, EVEC, FIBL-5, UP50 HGNC (Hugo): FBLN5 Location: 14q32.12 Note Fibulin-5 is a matricellular glycoprotein, belonging to fibulin family which has 7 members (Yanagisawa et al., 2009). Compared with other fibulins, it has a unique arginine-glycine-aspartic acid (RGD) domain in the Nterminal region that mediates binding to integrins (Nakamura et al., 1999). Fibulin-5 is produced and secreted by endothelial cells, fibroblasts and vascular smooth

The protein sequence of human Fibulin-5 (source database: UniProt).


811

FBLN5 (fibulin 5)

Wang M, Brekken RA

Schematic drawing of Fibulin-5 protein. It contains an evolutionally conserved RGD sequence in the first CB-EGF-like (Calcium Binding-Epidermal Growth Factor-like) motif and a fibulin module in the C-terminus of the protein.

Localisation

DNA/RNA

Matricellular, secreted, extracellular matrix.

Description

Function

According to Ensembl Genome Browser, human Fbln5 gene locates on Chromosome 14q between region 92335756 and 92414331. This gene has 9 splicing variants transcriptionally. The only one with known protein function has 11 exons and 1347 nucleotides.

Fibulin-5 is essential for the assembly of elastic fibers. Biochemical analysis shows that Fibulin-5 preferentially binds to monomeric tropoelastin through N- and C-terminal elastin-binding regions (Zheng et al., 2007). Fbln5-/- mice exhibit severe elastic fibre disorganization throughout the whole body (Nakamura et al., 2002; Yanagisawa et al., 2002). Further studies have shown that Fibulin-5 regulates elastic fiber formation by increasing the efficacy of tropoelastin self-aggregation and cross-linking through direct binding to tropoelastin and lysyl oxidase like Loxl1, Loxl2 and Loxl4 (Yanagisawa et al., 2009). In addition, Fibulin-5 binds cell surface α4β1 and α5β1 integrins, but does not support receptor activation (Lomas et al., 2007). Additionally, Fibulin-5 competes with fibronectin for integrin binding. This competition serves to reduce fibronectin-mediated integrin-induced reactive oxygen species (ROS) generation (Schluterman et al., 2010).

Protein Description Fibulin-5 is a secreted protein belonging to the fibulin family. It contains 448 amino acids with an approximate 66-Kda molecular weight. It is mainly produced and secreted by endothelial cells, smooth muscle cells and fibroblasts (Yanagisawa et al., 2009). It has six calcium-binding epidermal growth factor (cb EGF)-like domains, the first one of which contains a RGD motif responsible for cell surface integrin binding.

Expression

Mutations

The expression of Fibulin-5 is most prominent in embryonic vasculature and neural crest cells and downregulated in most adult organs (Nakamura et al., 1999). Fibulin-5 mRNA is detected mainly in heart, ovary and colon of adult human tissue (Nakamura et al., 1999). However, Fibulin-5 expression can be reactivated upon tissue injury. It is reported that the expression of Fibulin-5 is elevated in human umbilical vein endothelial cells (HUVEC) by hypoxia in a HIF1αdependent mechanism (Guadall et al., 2011). Transforming growth factors β (TGF-β) can also increase the expression of Fibulin-5 in human lung fibroblasts (Kuang et al., 2006).


See table below.

Implicated in Bladder cancer Note The expression of Fibulin-5 is downregulated in human bladder carcinoma samples (Hu et al., 2011). Increased proliferation and invasiveness were observed in a bladder cancer cell line with overexpression of Fibulin5 (Hu et al., 2011).

812

FBLN5 (fibulin 5)

Wang M, Brekken RA

Breast cancer

Ovarian cancer

Note The role of Fibulin-5 in breast cancer is still controversial. Oncomine database shows the reduction of Fibulin-5 mRNA in breast carcinomas, however, induction of Fibulin-5 expression is detected in breast cancer patient tissue by immunostaining (Lee et al., 2008). In addition, overexpression of Fibulin-5 can enhance tumor growth in an orthotopic mouse model of breast cancer (Lee et al., 2008). Meanwhile, overexpression of Fibulin-5 in breast cancer cells can reduce metastasis to liver and lung (Moller et al., 2011). The discrepancy between these studies could be due to cell line and mouse model differences. Fibulin-5 is also reported to participate in epithelial-mesenchymaltransition (EMT) in breast cancer cell lines in a MMPdependent manner (Lee et al., 2008). However, the mechanism of Fibulin-5 regulation of MMP is unclear. For example, Fibulin-5 has been shown to inhibit and activate MMP9 activity, (Budatha et al., 2011; Lee et al., 2008; Moller et al., 2011).

Note The expression level of Fibulin-5 correlates inversely with the severity of disease (Wang et al., 2010). Expression of Fibulin-5 is also remarkably decreased in metastatic sites.

Pancreatic cancer Note Fibulin-5 is required for aggressive tumor growth and angiogenesis in a mouse model of pancreatic cancer (Schluterman et al., 2010). Tumor weight and blood vessel density in Fbln5-/- or Fbln5RGE/RGE mice are significantly reduced compared with wildtype mice in subcutaneous and orthotopic models. Increased level of ROS, DNA damage and apoptotic endothelial cells were detected in tumors grown in Fibulin-5 deficient mice. In vitro analysis identified that Fibulin-5 reduces ROS production in a fibronectin and integrin β1-dependent manner (Schluterman et al., 2010).

Lung cancer

Age-related macular degeneration (AMD)

Note Fibulin-5 expression is silenced in multiple lung cancer cell lines and human lung cancer samples by hypermethylation of the promoter region (Yue et al., 2009). Overexpression of Fibulin-5 reduces lung cancer invasion and metastasis through suppression of the MMP-7 expression and ERK phosphorylation (Yue et al., 2009).


Note DNA sequencing revealed 10 distinct heterozygous missense mutations in Fbln5 in 1-2% of AMD patients (Auer-Grumbach et al., 2011; Lotery et al., 2006; Stone et al., 2004). The underlying biochemical basis of two missense mutations, I169T and G267S was further studied by

813

FBLN5 (fibulin 5)

Wang M, Brekken RA

nuclear magnetic resonance (NMR) and chromophoric calcium chelation experiments. The results show that G267S substitution leads to protein misfolding and inhibition of secretion, but not the I169T substitution (Schneider et al., 2010). Disease Age-related macular degeneration (AMD) is an eye disease affecting the macula and is the main reason for irreversible version loss in elderly people (Lotery et al., 2006).

for elder women characterized by loss of pelvic floor support leading to protrusion of pelvic organs like uterus, bladder and vagina.

Thoracic aortic aneurysmal disease (TAD) Note The expression of aortic Fibulin-5 is significantly decreased in patients with TAD. The low level of Fibulin-5 strongly correlates with disorganization of elastic fibers, which may contribute to aorta abnormality (Wang et al., 2005). Disease Thoracic aortic aneurysmal disease (TAD) is an aortic disorder characterized by loss of elastin in the wall of aorta (Wang et al., 2005).

Charcot-Marie-Tooth disease (CMT) Note Missense mutations of Fbln5 were detected in CMT neuropathy patients (Auer-Grumbach et al., 2011). Disease Charcot-Marie-Tooth disease (CMT) is an autosomal dominantly inherited disorder of peripheral nervous system (Auer-Grumbach et al., 2011). It is characterized by lifelong disabilities because of muscle weakness and loss of touch sensation (Auer-Grumbach et al., 2011).

References Nakamura T, Ruiz-Lozano P, Lindner V, Yabe D, Taniwaki M, Furukawa Y, Kobuke K, Tashiro K, Lu Z, Andon NL, Schaub R, Matsumori A, Sasayama S, Chien KR, Honjo T. DANCE, a novel secreted RGD protein expressed in developing, atherosclerotic, and balloon-injured arteries. J Biol Chem. 1999 Aug 6;274(32):22476-83

Cutis laxa Note Mutations in Fbln5 have been identified in hereditary and acquired forms of cutis laxa. Three homozygous mutations (C217R, S227P and R284X) in Fbln5 have been reported in autosomal recessive cutis laxa patients (Claus et al., 2008; Elahi et al., 2006; Loeys et al., 2002). In addition, a heterozygous in-frame tandem duplication of Fbln5 exon 5-8 has been discovered in a sporadic cutis laxa patient (Markova et al., 2003). Mutational analysis also shows that a cutis laxa patient has a heterozygous missense mutation (G202R) in Fbln5 and compound heterozygous mutation in elastin alleles (A55V and G773D) (Hu et al., 2006b). These findings further support that Fibulin-5 is essential for the formation and maturation of the tropoelastin self-aggregation process, which is required for elastic fiber assembly (Hu et al., 2006a). Disease Cutis laxa is a connective tissue disorder characterized by loose and redundant skin and multiple internal organ abnormalities due to fragmentation and paucity of elastic fibers.

Loeys B, Van Maldergem L, Mortier G, Coucke P, Gerniers S, Naeyaert JM, De Paepe A. Homozygosity for a missense mutation in fibulin-5 (FBLN5) results in a severe form of cutis laxa. Hum Mol Genet. 2002 Sep 1;11(18):2113-8 Nakamura T, Lozano PR, Ikeda Y, Iwanaga Y, Hinek A, Minamisawa S, Cheng CF, Kobuke K, Dalton N, Takada Y, Tashiro K, Ross Jr J, Honjo T, Chien KR. Fibulin-5/DANCE is essential for elastogenesis in vivo. Nature. 2002 Jan 10;415(6868):171-5 Yanagisawa H, Davis EC, Starcher BC, Ouchi T, Yanagisawa M, Richardson JA, Olson EN. Fibulin-5 is an elastin-binding protein essential for elastic fibre development in vivo. Nature. 2002 Jan 10;415(6868):168-71 Markova D, Zou Y, Ringpfeil F, Sasaki T, Kostka G, Timpl R, Uitto J, Chu ML. Genetic heterogeneity of cutis laxa: a heterozygous tandem duplication within the fibulin-5 (FBLN5) gene. Am J Hum Genet. 2003 Apr;72(4):998-1004 Stone EM, Braun TA, Russell SR, Kuehn MH, Lotery AJ, Moore PA, Eastman CG, Casavant TL, Sheffield VC. Missense variations in the fibulin 5 gene and age-related macular degeneration. N Engl J Med. 2004 Jul 22;351(4):346-53 Wang X, LeMaire SA, Chen L, Carter SA, Shen YH, Gan Y, Bartsch H, Wilks JA, Utama B, Ou H, Thompson RW, Coselli JS, Wang XL. Decreased expression of fibulin-5 correlates with reduced elastin in thoracic aortic dissection. Surgery. 2005 Aug;138(2):352-9

Pelvic organ prolapse (POP) Note Lower level expression of Fibulin-5 was identified in patients with POP (Soderberg et al., 2009; Takacs et al., 2009). It is reported that Fibulin-5 can prevent the development of POP by regulating elastic fiber homeostasis and inactivating MMP-9 in the vaginal wall (Budatha et al., 2011). Disease Pelvic organ prolapse (POP) is a common disease


Elahi E, Kalhor R, Banihosseini SS, Torabi N, Pour-Jafari H, Houshmand M, Amini SS, Ramezani A, Loeys B. Homozygous missense mutation in fibulin-5 in an Iranian autosomal recessive cutis laxa pedigree and associated haplotype. J Invest Dermatol. 2006 Jul;126(7):1506-9 Hu Q, Loeys BL, Coucke PJ, De Paepe A, Mecham RP, Choi J, Davis EC, Urban Z. Fibulin-5 mutations: mechanisms of impaired elastic fiber formation in recessive cutis laxa. Hum Mol Genet. 2006a Dec 1;15(23):3379-86 Hu Q, Reymond JL, Pinel N, Zabot MT, Urban Z. Inflammatory destruction of elastic fibers in acquired cutis laxa is associated

814

FBLN5 (fibulin 5)

Wang M, Brekken RA

with missense alleles in the elastin and fibulin-5 genes. J Invest Dermatol. 2006b Feb;126(2):283-90

inhibiting matrix metalloproteinase-7 expression. Cancer Res. 2009 Aug 1;69(15):6339-46

Kuang PP, Joyce-Brady M, Zhang XH, Jean JC, Goldstein RH. Fibulin-5 gene expression in human lung fibroblasts is regulated by TGF-beta and phosphatidylinositol 3-kinase activity. Am J Physiol Cell Physiol. 2006 Dec;291(6):C1412-21

Schluterman MK, Chapman SL, Korpanty G, Ozumi K, Fukai T, Yanagisawa H, Brekken RA. Loss of fibulin-5 binding to beta1 integrins inhibits tumor growth by increasing the level of ROS. Dis Model Mech. 2010 May-Jun;3(5-6):333-42

Lotery AJ, Baas D, Ridley C, Jones RP, Klaver CC, Stone E, Nakamura T, Luff A, Griffiths H, Wang T, Bergen AA, Trump D. Reduced secretion of fibulin 5 in age-related macular degeneration and cutis laxa. Hum Mutat. 2006 Jun;27(6):56874

Schneider R, Jensen SA, Whiteman P, McCullagh JS, Redfield C, Handford PA. Biophysical characterisation of fibulin-5 proteins associated with disease. J Mol Biol. 2010 Aug 27;401(4):605-17 Wang Q, Li XG, Zhang Y, Cao LQ, Deng ZH, Chen Y. [Expression of EVEC in ovarian carcinoma and its biological significance]. Zhonghua Zhong Liu Za Zhi. 2010 Sep;32(9):676-80

Hirai M, Ohbayashi T, Horiguchi M, Okawa K, Hagiwara A, Chien KR, Kita T, Nakamura T. Fibulin-5/DANCE has an elastogenic organizer activity that is abrogated by proteolytic cleavage in vivo. J Cell Biol. 2007 Mar 26;176(7):1061-71

Auer-Grumbach M, Weger M, Fink-Puches R, Papić L, Fröhlich E, Auer-Grumbach P, El Shabrawi-Caelen L, Schabhüttl M, Windpassinger C, Senderek J, Budka H, Trajanoski S, Janecke AR, Haas A, Metze D, Pieber TR, Guelly C. Fibulin-5 mutations link inherited neuropathies, age-related macular degeneration and hyperelastic skin. Brain. 2011 Jun;134(Pt 6):1839-52

Lomas AC, Mellody KT, Freeman LJ, Bax DV, Shuttleworth CA, Kielty CM. Fibulin-5 binds human smooth-muscle cells through alpha5beta1 and alpha4beta1 integrins, but does not support receptor activation. Biochem J. 2007 Aug 1;405(3):417-28 Zheng Q, Davis EC, Richardson JA, Starcher BC, Li T, Gerard RD, Yanagisawa H. Molecular analysis of fibulin-5 function during de novo synthesis of elastic fibers. Mol Cell Biol. 2007 Feb;27(3):1083-95

Budatha M, Roshanravan S, Zheng Q, Weislander C, Chapman SL, Davis EC, Starcher B, Word RA, Yanagisawa H. Extracellular matrix proteases contribute to progression of pelvic organ prolapse in mice and humans. J Clin Invest. 2011 May;121(5):2048-59

Claus S, Fischer J, Mégarbané H, Mégarbané A, Jobard F, Debret R, Peyrol S, Saker S, Devillers M, Sommer P, Damour O. A p.C217R mutation in fibulin-5 from cutis laxa patients is associated with incomplete extracellular matrix formation in a skin equivalent model. J Invest Dermatol. 2008 Jun;128(6):1442-50

Guadall A, Orriols M, Rodríguez-Calvo R, Calvayrac O, Crespo J, Aledo R, Martínez-González J, Rodríguez C. Fibulin-5 is upregulated by hypoxia in endothelial cells through a hypoxiainducible factor-1 (HIF-1α)-dependent mechanism. J Biol Chem. 2011 Mar 4;286(9):7093-103

Lee YH, Albig AR, Regner M, Schiemann BJ, Schiemann WP. Fibulin-5 initiates epithelial-mesenchymal transition (EMT) and enhances EMT induced by TGF-beta in mammary epithelial cells via a MMP-dependent mechanism. Carcinogenesis. 2008 Dec;29(12):2243-51

Hu Z, Ai Q, Xu H, Ma X, Li HZ, Shi TP, Wang C, Gong DJ, Zhang X. Fibulin-5 is down-regulated in urothelial carcinoma of bladder and inhibits growth and invasion of human bladder cancer cell line 5637. Urol Oncol. 2011 Jul-Aug;29(4):430-5

Söderberg MW, Byström B, Kalamajski S, Malmström A, Ekman-Ordeberg G. Gene expressions of small leucine-rich repeat proteoglycans and fibulin-5 are decreased in pelvic organ prolapse. Mol Hum Reprod. 2009 Apr;15(4):251-7

Møller HD, Ralfkjær U, Cremers N, Frankel M, Pedersen RT, Klingelhöfer J, Yanagisawa H, Grigorian M, Guldberg P, Sleeman J, Lukanidin E, Ambartsumian N. Role of fibulin-5 in metastatic organ colonization. Mol Cancer Res. 2011 May;9(5):553-63

Takacs P, Nassiri M, Viciana A, Candiotti K, Fornoni A, Medina CA. Fibulin-5 expression is decreased in women with anterior vaginal wall prolapse. Int Urogynecol J Pelvic Floor Dysfunct. 2009 Feb;20(2):207-11

This article should be referenced as such: Wang M, Brekken RA. FBLN5 (fibulin 5). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):811-815.

Yue W, Sun Q, Landreneau R, Wu C, Siegfried JM, Yu J, Zhang L. Fibulin-5 suppresses lung cancer invasion by


815


OPEN ACCESS JOURNAL

Gene Section Review

FUBP1 (far upstream element (FUSE) binding protein 1) Katharina Gerlach, Martin Zörnig Institute for Biomedical Research Georg-Speyer-Haus, Paul-Ehrlich-Strasse 42-44, 60596 Frankfurt, Germany (KG, MZ) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/FUBP1ID50675ch1p31.html DOI: 10.4267/2042/51869 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

NCBI (NM_003902.3) are identical. Transcripts NM_003902.3 and ENST00000370768 are also included in the human CCDS set (CCDS683) and encode a 644 aa long protein.

Identity Other names: FBP, FUBP HGNC (Hugo): FUBP1 Location: 1p31.1

Pseudogene

DNA/RNA

None known.

Description

Protein

The human FUBP1 gene is located on the reverse strand of chromosome 1 (bases 78413591 to 78444777; according to NCBI Refseq Gene Database (gene ID: 8880, RefSeq ID: NM_003902.3), genome assembly GRCh37 from February 2009) of the human genome and is comprised of 31187 bp. FUBP1 is composed of 20 protein-coding exons ranging between approx. 40 bp and 170 bp in length and 19 introns which vary greatly in size (approx. 100 bp - 8800 bp). It has a short (approx. 90 bp) 5' untranslated region (UTR) and a long 3' UTR (approx. 860 bp). According to the Ensembl genome browser database 14 transcript variants of human FUBP1 have been reported (ENSG00000162613). One of them is composed of 21 exons (ENST00000436586).

Description Human FUBP1 is composed of 644 amino acids, has a calculated molecular mass of 67,5 kDa and consists of three different protein domains. The N-terminal domain (amino acids 1 to 106) is able to repress transcriptional activation mediated by the C-terminal transactivation domain. The central domain (amino acids 107 to 447) contains four conserved KH motifs (K homology motif, first identified in the human heterogeneous nuclear ribonucleoprotein K protein (hnRNP K) (Siomi et al., 1993)) which facilitate the binding of FUBP1 to a single stranded DNA element (FUSE element, Braddock et al., 2002). A flexible glycine/proline-rich linker (amino acids 448 - 511) connects the central domain with the C-terminal transactivation domain (amino acids 448 - 644). This region contains three tyrosine-rich motifs which are required to activate transcription (Duncan et al., 1996; Duncan et al., 1994). Nuclear trafficking of FUBP1 is mediated by three nuclear localization signals (NLS): a classical NLS in the N-terminal domain and two non-canonical signals in the third KH motif and the third tyrosine-rich motifs (He et al., 2000b).

Transcription According to NCBI the human FUBP1 gene encodes a 2884 bp mRNA transcript, the coding sequence (CDS) located from base pairs 90 to 2024 (NM_003902.3). The CDS from the Ensembl genome browser database (ENST00000370768, transcript length 2378 bp) and


816

FUBP1 (far upstream element (FUSE) binding protein 1)

Gerlach K, Zörnig M

Figure 1. FUBP1 is composed of an N-terminal domain, a central DNA-binding domain containing four KH (K homology) motifs and a Cterminal domain (with three tyrosine-rich motifs). A flexible linker domain connects the central and the C-terminal domain. The numbers above the diagram indicate the amino acid positions of the domains. Sites of the nuclear localization signals (NLS) are indicated. Adapted from Duncan et al., 1996.

results implicate additional functions of FUBP1 in the regulation of neuronal differentiation, viral replication, cell growth and cell cycle progression. Transcriptional regulation of the c-myc promoter by the FUBP family Because of the unconventional binding properties of FUBP1 (single stranded DNA (ssDNA) instead of double stranded DNA (dsDNA) as for most other regular transcription factors), its mechanism in the regulation of c-myc transcription has been extensively studied. In the absence of serum, the c-myc locus is transcriptionally inactive. In this state, the FUSE element upstream of the promoter is in a double stranded conformation and masked by a nucleosome. Upon addition of serum, chromatin remodelling occurs, which results in the exposure of the FUSE element (Brooks and Hurley, 2009). Basal transcription of cmyc is initiated and leads to torsional stress and negative supercoiling of the DNA. Under sufficient supercoiling, the DNA of the AT-rich FUSE element melts and enables binding of FUBP3, which later is replaced by FUBP1 (Chung et al., 2006; Kouzine et al., 2008; Kouzine et al., 2004; Michelotti et al., 1996). Upon recruitment, FUBP1 interacts with the general transcription factor TFIIH and enhances its helicase activity, thereby facilitating promoter escape of the polymerase complex which enhances transcription of c-myc (Bazar et al., 1995; Liu et al., 2001). Therefore, c-myc transcription reaches a maximum approx. two hours after serum addition. Shortly after reaching the maximal transcription rate, FBP interacting repressor (FIR) binds to the FUSE element and FUBP1, forming a stable tripartite FUSEFUBP1-FIR complex. This complex reverts the activated transcription back to a basal level, due to FIRmediated inhibition of the 3' to 5' helicase activity of TFIIH (Brooks and Hurley, 2009; Hsiao et al., 2010; Liu et al., 2000). Shorty after formation of the tripartite complex, FUBP1 is ejected while FIR remains bound to the FUSE element.

Expression Widely expressed (Su et al., 2004).

Localisation Nucleus (He et al., 2000b).

Function FUBP1 is a transcriptional regulator and fulfills an important function in the precise control of c-myc transcription (mechanism described below). The c-Myc protein is a transcription factor which regulates the transcription of many different target genes that play a role in proliferation, cell cycle progression, differentiation, apoptosis and cell metabolism. Consequently, FUBP1 is also involved in the regulation of proliferation and differentiation, as confirmed by different experimental approaches. Knockdown of FUBP1 or expression of a dominant-negative FUBP1 (DNA-binding domain lacking effector activity) led to proliferation arrest in U2OS and Saos-2 osteosarcoma cells due to reduced c-myc expression (He et al., 2000a). Upon induction of differentiation in leukemia cells (HL-60 and U937), binding activity of FUBP1 to the c-myc promoter is lost. This indicates an important role of FUBP1 in maintaining c-myc transcription to prevent its downregulation and differentiation (Avigan et al., 1990). As the KH motifs were first found to be involved in RNA-binding, it is not surprising that FUBP1 also interacts with specific RNAs. It was shown that FUBP1 interacts with the 3' UTR of GAP-43 mRNA (encoding a membrane phosphoprotein that is important for the development and plasticity of neuronal cells), hepatitis C virus RNA, nucleophosmin mRNA (a nucleolar oncoprotein involved in several cellular processes) and the 5' UTR of the p27 mRNA (a cyclin dependent kinase inhibitor), regulating their stabilities and translation (Irwin et al., 1997; Olanich et al., 2011; Zhang et al., 2008; Zheng and Miskimins, 2011). Although the regulatory mechanisms behind these interactions are still not fully characterized, these


817



was shown that FUBP1 coordinates the expression of the microtubule-destabilizing proteins stathmin and SCLIP eventually leading to increased motility of NSCLC (Singer et al., 2009). Elevated expression of FUBP1 was also reported for renal cell and prostate carcinomas (Weber et al., 2008). The oncogenic role of FUBP1 in hepatocellular carcinoma is discussed in the following note. In contrast to the above described oncogenic role of FUBP1 in the majority of cancer entities it seems to function as a tumor suppressor in oligodendrogliomas, astrocytomas and oligoastrocytomas. In these cancer entities the FUBP1 locus is frequently mutated leading to inactivation of the protein (Bettegowda et al., 2011; Sahm et al., 2012; Jiao et al., 2012; Idbaih et al., 2012).

This mechanism results in a sharp peak of c-myc expression upon serum addition (or other c-mycinducing signals) and ensures the precise control of cmyc expression, which is important in normal cell homeostasis (Kelly and Siebenlist, 1986).

Homology Two FUBP1 homologs, termed FUBP2/KHSRP and FUBP3, were also identified in the human genome. The three FUBP family members share the same protein architecture (three distinct domains). The central DNAbinding domain containing four KH motifs is the most conserved domain with 81,5% (FUBP2) and 80,9% (FUBP3) amino acids sequence homology to FUBP1 (Davis-Smyth et al., 1996). Although these proteins are highly conserved in their DNA-binding domains, divergences in their N- and C-termini lead to important functional differences. The C-terminal transactivation domain of FUBP3 is by far the strongest of the FBP family members. Furthermore, variations in its N-terminal domain seem to prevent an interaction with the FBP interacting repressor (FIR) (Chung et al., 2006). As described in the previous paragraph these characteristics are important for the transcriptional regulation of the cmyc gene. The transactivation domain of FUBP1 shows an intermediate strength whereas the one of FUBP2 displays the weakest activation capability. In contrast to FUBP3, FUBP1 and FUBP2 are able to interact with FIR (Chung et al., 2006). The weak transactivation domain already implicates that FUBP2 might not function as an important activator of transcription. In fact, FUBP2 (also named K homology splicing regulatory protein (KHSRP)) was shown to function as an mRNA binding protein, playing a role in mRNA splicing, trafficking, stabilization and degradation (Gherzi et al., 2004; Min et al., 1997).

Hepatocellular carcinoma Note FUBP1 is highly overexpressed in hepatocellular carcinoma. In HCC cells, knockdown of FUBP1 using stable shRNA (short hairpin RNA) expression resulted in increased apoptosis levels and decreased proliferation. In mouse xenograft experiments using these FUBP1-deficient HCC cells, tumor formation was impaired. Analysis of mRNA expression levels using quantitative real-time PCR revealed that c-myc expression was not influenced by knockdown of FUBP1, whereas several other so far unidentified target genes showed an altered expression pattern. The proapoptotic genes Bik, Noxa, TRAIL and TNF-α showed a reduced expression in the absence of FUBP1, whereas gene-expression of the cell cycle inhibitors p21 and p15 was increased. Cyclin D2 expression was also reduced in FUBP1 knockdown cells. Furthermore, p21 was identified as a direct FUBP1-target gene (Rabenhorst et al., 2009). A decrease in tumor cell viability and proliferation was observed after siRNA mediated knockdown of FUBP1 in HCC cells. mRNA expression analysis revealed that FUBP1 induces the expression of the pro-tumorigenic microtubule-destabilizing protein stathmin (Malz et al., 2009). Elevated stathmin expression has been linked to vascular invasion, increased tumor size and intrahepatic metastasis in HCC (Yuan et al., 2006). Knockdown of FUBP2 resulted in elevated FUBP1 expression, indicating that FUBP family members are coodinately regulated. Based on these findings Malz et al. (2009) proposed that FUBP1 and FUBP2 support the migration and proliferation of human liver cancer cells. Because of its regulatory effects on apoptosis, cell cycle progression and migration, FUBP1 fulfills an oncogenic potential, which seems to be of importance in hepatocellular carcinoma. A model of the oncogenic function of FUBP1 in HCC proposed by Rabenhorst et al. (2009) is shown in figure 2.

Mutations Somatic Numerous reports about somatic mutations leading to the inactivation of FUBP1 in human oligodendrogliomas, oligoastrocytomas and astrocytomas (Bettegowda et al., 2011; Sahm et al., 2012; Jiao et al., 2012; Idbaih et al., 2012).

Implicated in Various cancers Note FUBP1 is a potential oncogene that is overexpressed in different cancer entities. Its expression is strongly increased in NSCLC cells compared to non-tumorous lung tissues. Furthermore it


818



Figure 2. Model of the oncogenic FUBP1 function in hepatocellular carcinoma. Increased levels of FUBP1 in HCC lead to decreased expression of the pro-apoptotic genes of Bik, Noxa, TRAIL and TNF-α. As a consequence, both, the intrinsic and extrinsic apoptosis pathway are inhibited. Moreover, FUBP1 decreases the gene expression of the cell cycle inhibitors p21 and p15, which leads to cell cycle acceleration. Taken from Rabenhorst et al., 2009.

References

with activated chromatin of the human c-myc gene in vivo. Mol Cell Biol. 1996 Jun;16(6):2656-69

Kelly K, Siebenlist U. The regulation and expression of c-myc in normal and malignant cells. Annu Rev Immunol. 1986;4:31738

Irwin N, Baekelandt V, Goritchenko L, Benowitz LI. Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Nucleic Acids Res. 1997 Mar 15;25(6):1281-8

Avigan MI, Strober B, Levens D. A far upstream element stimulates c-myc expression in undifferentiated leukemia cells. J Biol Chem. 1990 Oct 25;265(30):18538-45

Min H, Turck CW, Nikolic JM, Black DL. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev. 1997 Apr 15;11(8):1023-36

Siomi H, Matunis MJ, Michael WM, Dreyfuss G. The premRNA binding K protein contains a novel evolutionarily conserved motif. Nucleic Acids Res. 1993 Mar 11;21(5):1193-8

He L, Liu J, Collins I, Sanford S, O'Connell B, Benham CJ, Levens D. Loss of FBP function arrests cellular proliferation and extinguishes c-myc expression. EMBO J. 2000a Mar 1;19(5):1034-44

Duncan R, Bazar L, Michelotti G, Tomonaga T, Krutzsch H, Avigan M, Levens D. A sequence-specific, single-strand binding protein activates the far upstream element of c-myc and defines a new DNA-binding motif. Genes Dev. 1994 Feb 15;8(4):465-80

He L, Weber A, Levens D. Nuclear targeting determinants of the far upstream element binding protein, a c-myc transcription factor. Nucleic Acids Res. 2000b Nov 15;28(22):4558-65

Bazar L, Meighen D, Harris V, Duncan R, Levens D, Avigan M. Targeted melting and binding of a DNA regulatory element by a transactivator of c-myc. J Biol Chem. 1995 Apr 7;270(14):8241-8

Liu J, He L, Collins I, Ge H, Libutti D, Li J, Egly JM, Levens D. The FBP interacting repressor targets TFIIH to inhibit activated transcription. Mol Cell. 2000 Feb;5(2):331-41 Liu J, Akoulitchev S, Weber A, Ge H, Chuikov S, Libutti D, Wang XW, Conaway JW, Harris CC, Conaway RC, Reinberg D, Levens D. Defective interplay of activators and repressors with TFIH in xeroderma pigmentosum. Cell. 2001 Feb 9;104(3):353-63

Davis-Smyth T, Duncan RC, Zheng T, Michelotti G, Levens D. The far upstream element-binding proteins comprise an ancient family of single-strand DNA-binding transactivators. J Biol Chem. 1996 Dec 6;271(49):31679-87 Duncan R, Collins I, Tomonaga T, Zhang T, Levens D. A unique transactivation sequence motif is found in the carboxylterminal domain of the single-strand-binding protein FBP. Mol Cell Biol. 1996 May;16(5):2274-82

Braddock DT, Louis JM, Baber JL, Levens D, Clore GM. Structure and dynamics of KH domains from FBP bound to single-stranded DNA. Nature. 2002 Feb 28;415(6875):1051-6 Gherzi R, Lee KY, Briata P, Wegmüller D, Moroni C, Karin M, Chen CY. A KH domain RNA binding protein, KSRP, promotes

Michelotti GA, Michelotti EF, Pullner A, Duncan RC, Eick D, Levens D. Multiple single-stranded cis elements are associated


819



ARE-directed mRNA turnover by recruiting the degradation machinery. Mol Cell. 2004 Jun 4;14(5):571-83

increases motility in non-small cell lung cancer. Cancer Res. 2009 Mar 15;69(6):2234-43

Kouzine F, Liu J, Sanford S, Chung HJ, Levens D. The dynamic response of upstream DNA to transcription-generated torsional stress. Nat Struct Mol Biol. 2004 Nov;11(11):1092100

Hsiao HH, Nath A, Lin CY, Folta-Stogniew EJ, Rhoades E, Braddock DT. Quantitative characterization of the interactions among c-myc transcriptional regulators FUSE, FBP, and FIR. Biochemistry. 2010 Jun 8;49(22):4620-34

Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, Cooke MP, Walker JR, Hogenesch JB. A gene atlas of the mouse and human protein-encoding transcriptomes. Proc Natl Acad Sci U S A. 2004 Apr 20;101(16):6062-7

Bettegowda C, Agrawal N, Jiao Y, Sausen M, Wood LD, Hruban RH, Rodriguez FJ, Cahill DP, McLendon R, Riggins G, Velculescu VE, Oba-Shinjo SM, Marie SK, Vogelstein B, Bigner D, Yan H, Papadopoulos N, Kinzler KW. Mutations in CIC and FUBP1 contribute to human oligodendroglioma. Science. 2011 Sep 9;333(6048):1453-5

Chung HJ, Liu J, Dundr M, Nie Z, Sanford S, Levens D. FBPs are calibrated molecular tools to adjust gene expression. Mol Cell Biol. 2006 Sep;26(17):6584-97

Olanich ME, Moss BL, Piwnica-Worms D, Townsend RR, Weber JD. Identification of FUSE-binding protein 1 as a regulatory mRNA-binding protein that represses nucleophosmin translation. Oncogene. 2011 Jan 6;30(1):77-86

Yuan RH, Jeng YM, Chen HL, Lai PL, Pan HW, Hsieh FJ, Lin CY, Lee PH, Hsu HC. Stathmin overexpression cooperates with p53 mutation and osteopontin overexpression, and is associated with tumour progression, early recurrence, and poor prognosis in hepatocellular carcinoma. J Pathol. 2006 Aug;209(4):549-58

Zheng Y, Miskimins WK. Far upstream element binding protein 1 activates translation of p27Kip1 mRNA through its internal ribosomal entry site. Int J Biochem Cell Biol. 2011 Nov;43(11):1641-8

Kouzine F, Sanford S, Elisha-Feil Z, Levens D. The functional response of upstream DNA to dynamic supercoiling in vivo. Nat Struct Mol Biol. 2008 Feb;15(2):146-54

Idbaih A, Ducray F, Dehais C, Courdy C, Carpentier C, de Bernard S, Uro-Coste E, Mokhtari K, Jouvet A, Honnorat J, Chinot O, Ramirez C, Beauchesne P, Benouaich-Amiel A, Godard J, Eimer S, Parker F, Lechapt-Zalcman E, Colin P, Loussouarn D, Faillot T, Dam-Hieu P, Elouadhani-Hamdi S, Bauchet L, Langlois O, Le Guerinel C, Fontaine D, Vauleon E, Menei P, Fotso MJ, Desenclos C, Verrelle P, Ghiringhelli F, Noel G, Labrousse F, Carpentier A, Dhermain F, Delattre JY, Figarella-Branger D. SNP array analysis reveals novel genomic abnormalities including copy neutral loss of heterozygosity in anaplastic oligodendrogliomas. PLoS One. 2012;7(10):e45950

Weber A, Kristiansen I, Johannsen M, Oelrich B, Scholmann K, Gunia S, May M, Meyer HA, Behnke S, Moch H, Kristiansen G. The FUSE binding proteins FBP1 and FBP3 are potential cmyc regulators in renal, but not in prostate and bladder cancer. BMC Cancer. 2008 Dec 16;8:369 Zhang Z, Harris D, Pandey VN. The FUSE binding protein is a cellular factor required for efficient replication of hepatitis C virus. J Virol. 2008 Jun;82(12):5761-73

Jiao Y, Killela PJ, Reitman ZJ, Rasheed AB, Heaphy CM, de Wilde RF, Rodriguez FJ, Rosemberg S, Oba-Shinjo SM, Nagahashi Marie SK, Bettegowda C, Agrawal N, Lipp E, Pirozzi C, Lopez G, He Y, Friedman H, Friedman AH, Riggins GJ, Holdhoff M, Burger P, McLendon R, Bigner DD, Vogelstein B, Meeker AK, Kinzler KW, Papadopoulos N, Diaz LA, Yan H. Frequent ATRX, CIC, FUBP1 and IDH1 mutations refine the classification of malignant gliomas. Oncotarget. 2012 Jul;3(7):709-22

Brooks TA, Hurley LH. The role of supercoiling in transcriptional control of MYC and its importance in molecular therapeutics. Nat Rev Cancer. 2009 Dec;9(12):849-61 Malz M, Weber A, Singer S, Riehmer V, Bissinger M, Riener MO, Longerich T, Soll C, Vogel A, Angel P, Schirmacher P, Breuhahn K. Overexpression of far upstream element binding proteins: a mechanism regulating proliferation and migration in liver cancer cells. Hepatology. 2009 Oct;50(4):1130-9 Rabenhorst U, Beinoraviciute-Kellner R, Brezniceanu ML, Joos S, Devens F, Lichter P, Rieker RJ, Trojan J, Chung HJ, Levens DL, Zörnig M. Overexpression of the far upstream element binding protein 1 in hepatocellular carcinoma is required for tumor growth. Hepatology. 2009 Oct;50(4):1121-9

Sahm F, Koelsche C, Meyer J, Pusch S, Lindenberg K, Mueller W, Herold-Mende C, von Deimling A, Hartmann C. CIC and FUBP1 mutations in oligodendrogliomas, oligoastrocytomas and astrocytomas. Acta Neuropathol. 2012 Jun;123(6):853-60 This article should be referenced as such:

Singer S, Malz M, Herpel E, Warth A, Bissinger M, Keith M, Muley T, Meister M, Hoffmann H, Penzel R, Gdynia G, Ehemann V, Schnabel PA, Kuner R, Huber P, Schirmacher P, Breuhahn K. Coordinated expression of stathmin family members by far upstream sequence element-binding protein-1


Gerlach K, Zörnig M. FUBP1 (far upstream element (FUSE) binding protein 1). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):816-820.

820


OPEN ACCESS JOURNAL

Gene Section Review

MIR106B (microRNA 106b) Cansaran Saygili, Ayse Elif Erson-Bensan Department of Biological Sciences, Middle East Technical University, Ankara, Turkey (CS, AEEB) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR106BID51084ch7q22.html DOI: 10.4267/2042/51870 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

106b-25. All members of the cluster (miR-25, miR-93, miR-106b) reside in the 13th intron of MCM7 gene.

Other names: MIRN106B HGNC (Hugo): MIR106B Location: 7q22.1 Local order: miR-106b resides in the 13th intron of MCM7 (minichromosome maintenance complex component 7) gene. Genes flanking MCM7 are: - ZNF3 (7q22.1): zinc finger protein 3 - COPS6 (7q22.1): COP9 signalosome subunit 6 MCM7 (7q21.3-7q22.1): minichromosome maintenance complex component 7 -- MIR106B (7q22.1): microRNA 106b -- MIR93 (7q22.1): microRNA 93 -- MIR25 (7q22.1): microRNA 25 - AP4M1 (7q22.1): adaptor-related protein complex4, mu 1 subunit - TAF6 (7q22.1): TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor.

Transcription Pre-miRNA Length: 82 bp. Sequence: 5' CCUGCCGGGGCUAAAGUGCUGACAGUGCAGA UAGUGGUCCUCUCCGUGCUACCGCACUGUGG GUACUUGCUGCUCCAGCAGG 3' Mature miRNA Length: 21 bp Sequence: 12- 5' UAAAGUGCUGACAGUGCAGAU 3'- 32 (between 12th and 32nd nucleotides of the precursor miRNA).

Pseudogene No pseudogene was reported.

Protein

DNA/RNA

Note miRNAs are not translated into aminoacids.

Description miR-106b is a member of microRNA cluster, miR-

Figure 1. Genes flanking MCM7 gene on 7q22.1. → stands for positive strand, ← stands for negative strand.


821

MIR106B (microRNA 106b)

Saygili C, Erson-Bensan AE

Figure 2. A. Genomic localization of miR-106b-25 members on chromosomal band 7q22.1. B. Stem loop structure of miR-106b.

RT-PCR and 3 plasma microRNAs miR-106b, miR20a, and miR-221 were found to be significantly increased. Hence, these microRNAs were suggested as potential bio-markers for early detection of gastric cancer (Cai et al., 2013).

Mutations Note No mutations have been reported so far. However, a single nucleotide polymorphism (SNP), rs999885, was reported in the promoter region of miR-106b host gene (MCM7). A to G base change of rs999885 was suggested to have a protective role for chronic Hepatitis B virus (HBV) infection in AG/GG genotypes; however the same polymorphism was also linked to higher risk of hepatocellular carcinoma (HCC) in HBV carriers (Liu et al., 2012). Furthermore, expression level of miR-106b-25 cluster was found to be significantly higher in AG/GG individuals than in AA carriers in non-tumor liver tissues (Liu et al., 2012).

Esophageal adenocarcinoma Note 5 esophageal cultured cells, 68 esophageal tissues (24 Barrett's esophagus, 22 esophageal adenocarcinoma and 22 normal epithelia) were analyzed by microarray to have a profile of differentially expressed miRNAs and miR-106b-25 cluster was shown to be upregulated in esophageal carcinoma (Kan et al., 2009).

Prostate cancer

Implicated in

Note In a microarray study conducted with 60 prostate tumors and 16 non-tumor prostate tissues, tumor samples were found to have higher levels of miR-106b25 cluster compared to non-tumor tissues (Ambs et al., 2008). Tumorigenic effects of miR-106b in prostate cancer was suggested to be exerted by targeting PTEN (phosphate and tensin homolog) - a tumor suppressor gene. PTEN inhibits the PI3K-Akt pathway which is a signal transduction pathway taking role in cell survival, proliferation, motility and angiogenesis (Poliseno et al., 2010).

Various cancers Note Deregulated expression of miR-106b has been implicated in various tumor types. In connection, miR106b is thought to play an important role in cell cycle progression by targeting CDKN1A (p21) and E2F1 which in turns increase the proliferation rate of cells.

Gastric cancer Note In a microarray study of 20 gastric primary tumors, miR-106b was shown to be upregulated together with miR-25 and miR-93 (other members of miR-106b-25 cluster) (Petrocca et al., 2008). Moreover, in a study conducted with 60 gastric cancer patients and 60 matched controls, plasma expression level of 15 selected microRNAs were measured by quantitative


Hepatocellular carcinoma Note 56 pairs of hepatocellular carcinoma (HCC) samples and corresponding non-tumor liver samples were

822



G1/S transition, was shown as a direct target of miR106b in laryngeal carcinoma.

analyzed and significant up-regulation of miR-106b was observed in tumor samples. Moreover in this study, decrease in the proliferation of two hepatoma-derived cell lines was shown after inhibiting miR-106b by an anti-miR-106b oligo. BCL2L11 (Bim) was identified as target of miR-106b and correlation between BCL2L11 (Bim) (pro-apoptotic gene) and miR-106b was shown in hepatocellular carcinoma. Bim expression was higher in tumors that have down regulated expression of miR-106b (Li et al., 2009). The same upregulated pattern of miR-106b was shown in the study of Shen et al. (2013), in which HCC cell lines and tissues were analyzed by quantitative RT-PCR in terms of miR106b expression. It was depicted that miR-106b upregulation affected G1/S transition by upregulating cyclin D1 and downregulating adenomatous polyposis coli (APC) - an important tumor suppressor gene. APC was shown as a direct target of miR-106b in this study.

Glioma Note miR-106b levels were assessed in 71 glioma samples and overexpression was observed in the majority of samples by in situ hybridization (ISH) and real-time PCR. Moreover, expression of miR-106b was found to be positively correlated with the tumor grade. After the transfection of antisense oligonucleotides for miR-106b in three human glioma cell lines, a decrease in the proliferation of these cells was observed. RBL2 (retinoblastoma like-2) was also shown to be target of miR-106b and miR-106b promoted cell cycle progression by negatively regulating RBL2 (Zhang et al., 2013).

Alzheimer's disease (AD)

Hepatocellular carcinoma (HCC) and hepatitis B virus (HBV) infection Note A genetic variant (SNP A>G) in the promoter region of miR-106b-25 cluster suggested to provide a protective effect against HBV chronic infection. However, the polymorphism was also predicted to cause increased risk for HCC by increasing expression of miR-106b-25 cluster (Liu et al., 2012).

Note miR-106b levels were shown to be reduced in sporadic AD patients. Important role of TGFβ pathway has been implicated in AD pathogenesis (Tesseur et al., 2006; Caraci et al., 2011) and direct regulation of TGFβ receptor 2 (TGFBR2) by miR-106b was revealed. Hence, potential role of miR-106b in AD pathogenesis via affecting TGFβ pathway was suggested (Wang et al., 2010).

Breast cancer

Induced pluripotent stem cells (iPSC)

Note In a study conducted with 204 lymph node negative breast cancers, high expression of miR-106b was shown to be correlated with high proliferation and estrogen receptor positivity (Jonsdottir et al., 2012). The role of miR-106b-25 cluster in breast cancer was depicted with study of Smith and his colleagues. The relation between miR-106b-25, TGFβ and homeobox protein SIX1 (Six1) was studied. It was shown that miR-106b-25 cluster can target Smad-7 - a TGFβ inhibitor - and activate TGFβ pathway as a downstream effect of SIX1 overexpression. Hence, miR-106b-25 cluster overcomes TGFβ mediated growth suppression and also promote TGFβ pathway signaling in favor of tumorigenesis (Smith et al., 2012). Loss of membranous E-cadherin is known as one of the hallmarks for epithelial-to-mesenchymal transition (EMT). miR-106b-25 cluster overexpressing breast cancer cells had decreased membrane bound Ecadherin, which was in agreement with EMT (Smith et al., 2012).

Note In iPSC, miR-106b-25 cluster is induced in early reprogramming phases and inhibition of this cluster reduces the reprogramming efficiency. miR-93 and miR-106b target TGFBR2 and CDKN1A (p21) which have already been linked to iPSC induction (Li et al., 2011).

References Tesseur I, Zou K, Esposito L, Bard F, Berber E, Can JV, Lin AH, Crews L, Tremblay P, Mathews P, Mucke L, Masliah E, Wyss-Coray T. Deficiency in neuronal TGF-beta signaling promotes neurodegeneration and Alzheimer's pathology. J Clin Invest. 2006 Nov;116(11):3060-9 Ambs S, Prueitt RL, Yi M, Hudson RS, Howe TM, Petrocca F, Wallace TA, Liu CG, Volinia S, Calin GA, Yfantis HG, Stephens RM, Croce CM. Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Res. 2008 Aug 1;68(15):6162-70 Petrocca F, Visone R, Onelli MR, Shah MH, Nicoloso MS, de Martino I, Iliopoulos D, Pilozzi E, Liu CG, Negrini M, Cavazzini L, Volinia S, Alder H, Ruco LP, Baldassarre G, Croce CM, Vecchione A. E2F1-regulated microRNAs impair TGFbetadependent cell-cycle arrest and apoptosis in gastric cancer. Cancer Cell. 2008 Mar;13(3):272-86

Laryngeal carcinoma Note Inhibition of miR-106b by antisense oligonucleotides showed a decrease in proliferation of two laryngeal carcinoma cell lines and this inhibition resulted in G0/G1 arrest (Cai et al., 2011). Retinoblastoma protein (Rb), which is a tumor suppressor and has a role in


Kan T, Sato F, Ito T, Matsumura N, David S, Cheng Y, Agarwal R, Paun BC, Jin Z, Olaru AV, Selaru FM, Hamilton JP, Yang J, Abraham JM, Mori Y, Meltzer SJ. The miR-106b-25 polycistron, activated by genomic amplification, functions as an oncogene by suppressing p21 and Bim. Gastroenterology. 2009 May;136(5):1689-700

823



Li Y, Tan W, Neo TW, Aung MO, Wasser S, Lim SG, Tan TM. Role of the miR-106b-25 microRNA cluster in hepatocellular carcinoma. Cancer Sci. 2009 Jul;100(7):1234-42

patterns for nine miRNAs in 204 lymph-node negative breast cancers. PLoS One. 2012;7(11):e48692 Liu Y, Zhang Y, Wen J, Liu L, Zhai X, Liu J, Pan S, Chen J, Shen H, Hu Z. A genetic variant in the promoter region of miR106b-25 cluster and risk of HBV infection and hepatocellular carcinoma. PLoS One. 2012;7(2):e32230

Poliseno L, Salmena L, Riccardi L, Fornari A, Song MS, Hobbs RM, Sportoletti P, Varmeh S, Egia A, Fedele G, Rameh L, Loda M, Pandolfi PP. Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010 Apr 13;3(117):ra29

Smith AL, Iwanaga R, Drasin DJ, Micalizzi DS, Vartuli RL, Tan AC, Ford HL. The miR-106b-25 cluster targets Smad7, activates TGF-β signaling, and induces EMT and tumor initiating cell characteristics downstream of Six1 in human breast cancer. Oncogene. 2012 Dec 13;31(50):5162-71

Wang H, Liu J, Zong Y, Xu Y, Deng W, Zhu H, Liu Y, Ma C, Huang L, Zhang L, Qin C. miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF-β type II receptor. Brain Res. 2010 Oct 21;1357:166-74

Cai H, Yuan Y, Hao YF, Guo TK, Wei X, Zhang YM. Plasma microRNAs serve as novel potential biomarkers for early detection of gastric cancer. Med Oncol. 2013 Mar;30(1):452

Cai K, Wang Y, Bao X. MiR-106b promotes cell proliferation via targeting RB in laryngeal carcinoma. J Exp Clin Cancer Res. 2011 Aug 8;30:73

Shen G, Jia H, Tai Q, Li Y, Chen D. miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma. Carcinogenesis. 2013 Jan;34(1):211-9

Caraci F, Battaglia G, Bruno V, Bosco P, Carbonaro V, Giuffrida ML, Drago F, Sortino MA, Nicoletti F, Copani A. TGFβ1 pathway as a new target for neuroprotection in Alzheimer's disease. CNS Neurosci Ther. 2011 Aug;17(4):237-49

Zhang A, Hao J, Wang K, Huang Q, Yu K et al.. Downregulation of miR-106b suppresses the growth of human glioma cells. J Neurooncol. 2013 Apr;112(2):179-89

Li Z, Yang CS, Nakashima K, Rana TM. Small RNA-mediated regulation of iPS cell generation. EMBO J. 2011 Mar 2;30(5):823-34

This article should be referenced as such: Saygili C, Erson-Bensan AE. MIR106B (microRNA 106b). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):821-824.

Jonsdottir K, Janssen SR, Da Rosa FC, Gudlaugsson E, Skaland I, Baak JP, Janssen EA. Validation of expression


824


OPEN ACCESS JOURNAL

Gene Section Short Communication

MIR23A (microRNA 23a) Yibin Feng, Hoey Chan, Ning Wang, Meifen Zhu, Fan Cheung, Ming Hong School of Chinese Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong, RP of China (YF, HC, NW, MZ, FC, MH) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR23AID52055ch19p13.html DOI: 10.4267/2042/51871 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

In human, the miR-23a has two mature miRNAs: hsamir-23a-5p and hsa-mir-23a-3p. The hsa-mir-23a-5p, also described as hsa-mir-23a*, locates from 13947444 to 13947465 (22 bps) while hsa-mir-23a-3p, shortly named as hsa-mir-23a, ranges from 13947409 to 13947429 (21 bps). Sequences: hsa-mir-23a-5p: gggguuccuggggaugggauuu hsa-mir-23a-3p: aucacauugccagggauuucc The miR-23a forms cluster with miR-27a and miR-242, namely miR-23a~27a~24-2 cluster and encode primary miRNAs transcript (pri-miRNAs). The promoter of this cluster has lack of several promoter elements: TATA box, initiator element, downstream core promoter element, TFIIB recognition element, downstream core element and multiple start site downstream elements (Smale and Kadonaga, 2003).

Identity Other names: MIRN23A, hsa-mir-23a, miRNA23A HGNC (Hugo): MIR23A Location: 19p13.13

DNA/RNA Description miRNA23A is a non-coding RNA (ncRNAs). This gene is located at chromosome 19 at location p13.13. It ranges from 13947401 to 13947473 on reverse strand.

Transcription This gene has one transcript and one coding exon. And its transcript length is 73 bps. This transcript does not have a protein product.

Figure 1: The microRNA 23a gene location (from 13947401 bps to 13947473 bps) was redrawn from Chhabra et al., 2010.


825

MIR23A (microRNA 23a)

Feng Y, et al.

Figure 2: The gene structure of miR-23a~27a~24-2 at chromosome 9q22 was redrawn from Chhabra et al., 2010.

Angiogenesis

Mutations

Note Suppression of angiogenesis in vitro and postnatal retinal vascular development in vivo was reported in response to the reduced expression of miR-23. Loss of miR-23 gene has hindered laser-induced choroidal neovascularization in mouse model. These functions were postulated to be caused by the inhibition of Sprouty2 and Sema6A, which negatively regulate MAPK and VEGFR2 factors (Zhou et al., 2011). Poliseno et al. (2006) has stated the presence of receptors of angiogenic factors in human umbilical vein endothelial cells (HUVECs) as target of miR-23a.

Note N/A

Implicated in Hepatocellular carcinoma Note In the study by Huang et al. (2008), up-regulation of the cluster hindered TGF-β induced apoptotic cell death and supported cell growth in hepatocellular carcinoma. Activation of miR-23a by STAT-interleukin 6 negatively regulated PGC-1a and glucose-6phosphatase catalytic subunit (G6PC), leading to decreased glucose production that favours hepatocellular carcinoma (Wang et al., 2012). Coptidis Rhizoma (CR, huanglian in Chinese) and its active compound, berberine has been shown to elicit anticancer properties in different cell lines and animal models (Wang et al., 2010; Feng et al., 2011). Zhu et al. (2011) has reported up-regulation of miR-23a after treatment with CR in hepatocellular carcinoma (HCC) cell lines, suggesting miR-23a can be one of the targets and biomarker alter for CR treatment in HCC cell lines and implying the potential application of CR on treatment of HCC.

Neural differentiation Note A study by Kawasaki and Taira (2003) has demonstrated the regulation of Hes-1 gene by miR-23, thereby supporting the neuronal differentiation of NT-2 cells at post-transcriptional level. The reduced expression of miR-23 is associated with accumulation of Hes1 gene, a basic helix loop helix differentiation suppressor, resulting in blockage of retinoic acid induced neuronal differentiation.

Muscular atrophy / Cardiac hypertrophy Note The miR-23a inhibited translation of muscle-specific ubiquitin ligases, MAFbx/atrogin-1 and muscle RINGfinger 1 (MuRF1), thus promoting protection against skeletal muscle atrophy (Wada et al., 2011). In the report by Lin et al. (2008), nuclear factor of activated T cells (NFATc3) is proposed to regulate cardiac hypertrophy by transcriptionally activate miR23a. Muscle RING-finger 1 (MuRF1) is the target of miR-23a where hypertrophic signal is conveyed by miR-23a through suppressing the translation of MURF1.

Acute promyelocytic leukemia Note Saumet et al. (2009) has observed PML-RARA oncogene dependent characteristic of miR-23a cluster and significant repression of miR-23a by PML-RARA. The association of retinoic acid receptor alpha (RARA) gene with promyelocytic leukemia (PML) protein in chromosomal translocation process favoured the protein expression in acute promyelocytic leukemia (APL).

Development of primary hematopoietic cells

Other cancers Note Increased expression of miR-23a has been reported to promote cancer growth in bladder cancer, gastric adenocarcinoma and colorectal cancer (Mi et al., 2007; Gottardo et al., 2007; Zhu et al., 2010; Jahid et al., 2012).


Note Inhibition of B lymphopoiesis both in vitro and in vivo by miR-23a cluster expressing hematopoietic progenitor was reported by Kong et al. (2010). The cluster was recognised as the downstream target of

826

MIR23A (microRNA 23a)

Feng Y, et al.

Chhabra R, Dubey R, Saini N. Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases. Mol Cancer. 2010 Sep 3;9:232

transcription factor PU.1. PU.1 has four conserved binding sites for promoter of miR-23a cluster. It showed that the cluster promoted myelopoiesis, while blocked the development of B lymphoid cells.

Kong KY, Owens KS, Rogers JH, Mullenix J, Velu CS, Grimes HL, Dahl R. MIR-23A microRNA cluster inhibits B-cell development. Exp Hematol. 2010 Aug;38(8):629-640.e1

References Kawasaki H, Taira K. Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells. Nature. 2003 Jun 19;423(6942):838-42

Wang N, Feng Y, Lau EP, Tsang C, Ching Y, Man K, Tong Y, Nagamatsu T, Su W, Tsao S. F-actin reorganization and inactivation of rho signaling pathway involved in the inhibitory effect of Coptidis Rhizoma on hepatoma cell migration. Integr Cancer Ther. 2010 Dec;9(4):354-64

Smale ST, Kadonaga JT. The RNA polymerase II core promoter. Annu Rev Biochem. 2003;72:449-79

Zhu LH, Liu T, Tang H, Tian RQ, Su C, Liu M, Li X. MicroRNA23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor. FEBS J. 2010 Sep;277(18):3726-34

Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G. MicroRNAs modulate the angiogenic properties of HUVECs. Blood. 2006 Nov 1;108(9):3068-71

Feng Y, Wang N, Zhu M, Feng Y, Li H, Tsao S. Recent progress on anticancer candidates in patents of herbal medicinal products. Recent Pat Food Nutr Agric. 2011 Jan;3(1):30-48

Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Sevignani C, Byrne D, Negrini M, Pagano F, Gomella LG, Croce CM, Baffa R. Micro-RNA profiling in kidney and bladder cancers. Urol Oncol. 2007 Sep-Oct;25(5):387-92

Wada S, Kato Y, Okutsu M, Miyaki S, Suzuki K, Yan Z, Schiaffino S, Asahara H, Ushida T, Akimoto T. Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy. J Biol Chem. 2011 Nov 4;286(44):38456-65

Mi S, Lu J, Sun M, Li Z, Zhang H, Neilly MB, Wang Y, Qian Z, Jin J, Zhang Y, Bohlander SK, Le Beau MM, Larson RA, Golub TR, Rowley JD, Chen J. MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19971-6

Zhou Q, Gallagher R, Ufret-Vincenty R, Li X, Olson EN, Wang S. Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23~27~24 clusters. Proc Natl Acad Sci U S A. 2011 May 17;108(20):8287-92

Huang S, He X, Ding J, Liang L, Zhao Y, Zhang Z, Yao X, Pan Z, Zhang P, Li J, Wan D, Gu J. Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta-induced tumor-suppressive activities in human hepatocellular carcinoma cells. Int J Cancer. 2008 Aug 15;123(4):972-8

Zhu M, Wang N, Tsao SW, Yuen MF, Feng Y, Wan TS, Man K, Feng Y. Up-regulation of microRNAs, miR21 and miR23a in human liver cancer cells treated with Coptidis rhizoma aqueous extract. Exp Ther Med. 2011 Jan;2(1):27-32

Chhabra R, Adlakha YK, Hariharan M, Scaria V, Saini N. Upregulation of miR-23a-27a-24-2 cluster induces caspasedependent and -independent apoptosis in human embryonic kidney cells. PLoS One. 2009 Jun 9;4(6):e5848

Jahid S, Sun J, Edwards RA, Dizon D, Panarelli NC, Milsom JW, Sikandar SS, Gümüs ZH, Lipkin SM. miR-23a promotes the transition from indolent to invasive colorectal cancer. Cancer Discov. 2012 Jun;2(6):540-53

Gao P, Tchernyshyov I, Chang TC, Lee YS, Kita K, Ochi T, Zeller KI, De Marzo AM, Van Eyk JE, Mendell JT, Dang CV. cMyc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. Nature. 2009 Apr 9;458(7239):762-5

Rathore MG, Saumet A, Rossi JF, de Bettignies C, Tempé D, Lecellier CH, Villalba M. The NF-κB member p65 controls glutamine metabolism through miR-23a. Int J Biochem Cell Biol. 2012 Sep;44(9):1448-56

Lin Z, Murtaza I, Wang K, Jiao J, Gao J, Li PF. miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy. Proc Natl Acad Sci U S A. 2009 Jul 21;106(29):12103-8

Wang B, Hsu SH, Frankel W, Ghoshal K, Jacob ST. Stat3mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by downregulating glucose-6-phosphatase and peroxisome proliferatoractivated receptor gamma, coactivator 1 alpha. Hepatology. 2012 Jul;56(1):186-97

Saumet A, Vetter G, Bouttier M, Portales-Casamar E, Wasserman WW, Maurin T, Mari B, Barbry P, Vallar L, Friederich E, Arar K, Cassinat B, Chomienne C, Lecellier CH. Transcriptional repression of microRNA genes by PML-RARA increases expression of key cancer proteins in acute promyelocytic leukemia. Blood. 2009 Jan 8;113(2):412-21

This article should be referenced as such: Feng Y, Chan H, Wang N, Zhu M, Cheung F, Hong M. MIR23A (microRNA 23a). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):825-827.

Tang J, Feng Y, Tsao S, Wang N, Curtain R, Wang Y. Berberine and Coptidis rhizoma as novel antineoplastic agents: a review of traditional use and biomedical investigations. J Ethnopharmacol. 2009 Oct 29;126(1):5-17


827


OPEN ACCESS JOURNAL

Gene Section Review

MST1 (macrophage stimulating 1 (hepatocyte growth factor-like)) Makiko Kawaguchi, Hiroaki Kataoka Section of Oncopathology and Regenerative Biology, Department of Pathology, Faculty of Medicine, University of Miyazaki, Japan (MK, HK) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/MST1ID44411ch3p21.html DOI: 10.4267/2042/51872 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

serum protein that activates murine resident peritoneal macrophages (Skeel et al., 1991). The specific receptor for MSP is recepteur d'origine nantais (RON) tyrosine kinase, a member of the MET proto-oncogene family (Wang et al., 2002).

Identity Other names: D3F15S2, DNF15S2, HGFL, MSP, NF15S2 HGNC (Hugo): MST1 Location: 3p21.31

Description The human MSP has the highest amino acid sequence similarity (45%) to human hepatocyte growth factor (HGF), hence its name "hepatocyte growth factor-like protein (HGFL)". MSP is a glycoprotein belonging to a plasminogen-related growth factor family. It is secreted as a single-chain precursor protein (pro-MSP), which has no biological activity (Wang et al., 2002). Pro-MSP becomes active after cleavage at the Arg483-Val484 bond by specific trypsin-like serine proteases such as hepatocyte growth factor activator (HGFA), ST14 (matriptase), hepsin (transmembrane protease, serine 1; TMPRSS1), TMPRSS11D (Human airway trypsin-like protease; HAT), clotting factor XIIa, clotting factor XIa, and serum kallikrein (Wang et al., 2002; Kawaguchi et al., 2009; Bhatt et al., 2007; Ganesan et al., 2011; Orikawa et al., 2012).

DNA/RNA Description Total length: 4817 bp; mRNA product length: 2348 bp.

Transcription The human MST1 gene structure consists of 18 exons and 17 introns spanning 4817 bp. One transcript of 2348 bps mRNA encode for 711 amino acid.

Pseudogene There are no known pseudogenes.

Protein Note MSP was originally identified by E.J. Leonard as a

Structure of the human MST1 gene.


828

MST1 (macrophage stimulating 1 (hepatocyte growth factor-like))

Kawaguchi M, Kataoka H

Schematic representations of the domain structures of pro-MSP and mature MSP proteins. After proteolytic cleavage at the Arg483Val484 bond, pro-MSP is converted to mature MSP and acquires its biological activity. Mature MSP is composed of α-chain (53 kDa) and β-chain (30 kDa) linked by a disulfide bond. The α-chain contains PAN/APPLE-like domain, followed by four kringle domains, and the βchain has a serine protease (peptidase S1)-like domain. SP, signal peptide; PAN, PAN/APPLE-like domain; K1-K4, Kringle domain1-4.

Among them, HGFA is a physiological serum activator of MSP at site of tissue injury, and ST14/matriptase likely has significant roles in activation of MSP/RON signaling on the cell surface as a cellular activator. In respiratory epithelial cells, TMPRSS11D/HAT serves as an efficient activator of MSP. In addition, hepsin may have a role in cancer cells. After cleavage of pro-MSP, MSP β-chain binds to its specific receptor tyrosine kinase RON, which results in autophosphorylation within its kinase catalytic domain, leading to the initiation of multiple signaling pathways including Ras/mitogen-activated protein kinase, phosphatidylinositol 3-kinase, c-Jun amino terminal kinase, β-catenin and nuclear factor-kappaB (NF-κB) (Wang et al., 2002; Kretschmann et al., 2010).

serine proteases such as ST14/matriptase, hepsin and TMPRSS11D/HAT.

Function MSP was originally identified as a serum protein that activates resident macrophages, such as induction of shape change and motility, enhanced chemotaxis in response to complement factor C5a (Wang et al., 2002). However, its biological effects are not restricted to macrophages. MSP promotes proliferation and migration of various epithelial cells and microglia (Kretschmann et al., 2010; Suzuki et al., 2008), increases ciliary motility of nasal epithelial cells (Sakamoto et al., 1997), stimulates the bone resorbing activity of osteoclasts (Kurihara et al., 1996), and stimulates sperm motility (Ohshiro et al., 1996). To date, many studies have suggested that MSP/RON signaling pathway plays roles in various pathophysiological conditions such as inflammation, wound healing, and cancer. Gene knockout studies revealed that MSP is not essential for embryogenesis, fertility (Bezerra et al., 1998). Inflammation During inflammation, MSP exerts a dual function, both stimulatory and inhibitory, on macrophages. Stimulatory functions include its ability to induce macrophage spreading, migration, phagocytosis and the production of cytokines. However, MSP inhibits lipopolysaccharide-induced production of inflammatory mediators, such as inducible NO synthase, cyclooxygenase-2, and prostaglandin E2. These suppressive effects are mediated by RON-

Expression MSP transcripts are present in the liver and, to a lesser amount, in adrenal glands, lungs, kidney, placenta and pancreas (Yoshimura et al., 1993; Ganesan et al., 2011).

Localisation MSP is synthesized and secreted mainly by hepatocytes as a biologically inactive single-chain precursor form and circulate as a plasma protein. The concentration of pro-MSP in the plasma is about 2-5 nM (Wang et al., 2002). Pro-MSP is activated by trypsin-like serum serine proteases such as HGFA, clotting factor XIIa, clotting factor XIa, serum kallikrein. On the cell surface, this activation can be processed by membrane-anchored


829



transduced signals that block LPS-induced activation of NF-κB pathways (Wang et al., 2002; Kretschmann et al., 2010). Wound healing MSP/RON signaling is involved at various steps of wound healing process. MSP promotes keratinocyte migration in mouse wound models and in wound healing assays in vitro. In experimental excisional wounds in rats, expression levels of MSP and RON within the wound were highest between 7 and 21 days. In a lung injury model, the function of MSP/RON appears to be necessary to suppress NF-κB activation and RON deficient mice exhibited increased lung injury and significantly decreased survival times (Kretschmann et al., 2010). However, MSP deficient mice do not show any defects in a skin wound healing model, suggesting that functional redundancies exist in the wound healing process (Bezerra et al., 1998). In a gentamicin(GM)-induced nephropathy model, MSP attenuates GM-induced inflammation and apoptosis by inhibition of the MAPKs/NF-κB signaling pathways (Lee et al., 2013).

secretion of immunosuppressive cytokines as well as growth and angiogenic factors that promote the tumor progression. (Kretschmann et al., 2010).

Lung cancer Note MSP promoted liver metastasis of small cell lung cancer cells in a mouse model. Moreover, immunohistochemical analyses of liver metastases revealed that microvessel density and tumor-associated macrophages are significantly increased in lesions produced by MSP transfected cells (Sato et al., 2013).

Breast cancer Note In the MMTV-PyMT mouse breast cancer model, MSP promoted tumor growth and increased metastatic frequency. The most prominent effect of MSP expression in tumors was osteolytic metastasis to bone (Welm et al., 2007). Immunohistochemical analysis revealed that the proportion of malignant tumors (invasive ductal carcinoma) positive for MSP expression was significantly higher than that of benign tumor (Ren et al., 2012). However, there was no relationship between MSP expression and histopathological grade of the carcinoma cells. Prognosis Breast cancer patients whose tumor overexpressed MSP/ST14/RON had significantly shorter metastasisfree survival and overall survival compared with patients whose tumors did not overexpress MSP/ST14/RON genes. Furthermore, overexpression of MSP/ST14/RON increased incidence of bone, lung, liver and brain metastases (Welm et al., 2007).

Homology The human MSP has 45% amino acid sequence identity to hepatocyte growth factor, 43% to plasminogen and 36% to prothrombin, and 79% identity with murine and rat orthologue.

Mutations Note Non-synonymous SNP (rs3197999, R689C) in the human MST-1 gene has been linked to inflammatory bowel disease (IBD) (Goyette et al., 2008; Latiano et al., 2010). This R689C variant impairs MSP function by reducing its affinity to RON. Recent study suggests that the rs3197999 variant in MST1 gene is also associated with primary sclerosing cholangitis (PSC) and extrahepatic cholangiocarcinoma (Melum et al., 2011; Srivastava et al., 2012; Krawczyk et al., 2013).

Pancreatic cancer Note MSP-induced activation of RON leads to enhanced L3.6pl pancreatic cancer cell migration and invasion. RON activation also induced morphological spindleshape change and altered expression of E-cadherin (Camp et al., 2007). MSP strongly induced phosphorylation and nuclear translocation of ribosomal S6 kinases (RSK)-2, a downstream signaling protein of the Ras-Erk1/2 pathway. RSK-2 expressing L3.6pl pancreatic cancer cell shows EMT-like phenotypic changes after MSP stimulation (Ma et al., 2011).

Implicated in Cancer Note Activation of RON by MSP can initiate signaling through many pathways implicated in tumor progression and metastasis. MSP activating serine proteases, such as HGFA, ST14/matriptase and hepsin are upregulated in various cancers. In addition, RON is overexpressed in many types of epithelial cancer. When MSP was activated at sites of tumors it would not only lead to activation of RON on tumor-associated macrophages, but also on the tumor cells, where RON has been shown to induce proliferation, survival, cell migration, epithelial-mesenchymal transition (EMT), invasion and metastasis. Furthermore, MSP/RON regulates M2 macrophage polarization leading to


Merkel cell carcinoma Note Tissue samples from 14 cases of Merkel cell carcinoma were used for immunohistochemical analysis. Nine cases out of 14 were positive for MSP and 9 cases out of 14 cases were positive for RON. Normal Merkel

830



protein pathway promotes metastasis in a mouse model for breast cancer and predicts poor prognosis in humans. Proc Natl Acad Sci U S A. 2007 May 1;104(18):7570-5

cells were negative for MSP and RON, suggesting MSP/RON signaling could play a role in tumorigenesis of MCC (Nagahama et al., 2011).

Goyette P, Lefebvre C, Ng A, Brant SR, Cho JH, Duerr RH, Silverberg MS, Taylor KD, Latiano A, Aumais G, Deslandres C, Jobin G, Annese V, Daly MJ, Xavier RJ, Rioux JD. Genecentric association mapping of chromosome 3p implicates MST1 in IBD pathogenesis. Mucosal Immunol. 2008 Mar;1(2):131-8

Knee osteoarthritis (OA) Note By using glycoproteomic approach, MSP was found as a prognostic factor for knee OA (Fukuda et al., 2012). In situ hybridization confirmed that abundant MSP mRNA expression was observed in the synovial tissues from OA knee. Prognosis Higher plasma MSP level was associated with the progression of knee OA.

Suzuki Y, Funakoshi H, Machide M, Matsumoto K, Nakamura T. Regulation of cell migration and cytokine production by HGF-like protein (HLP) / macrophage stimulating protein (MSP) in primary microglia. Biomed Res. 2008 Apr;29(2):77-84 Kawaguchi M, Orikawa H, Baba T, Fukushima T, Kataoka H. Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein. FEBS J. 2009 Jul;276(13):3481-90

References

Kretschmann KL, Eyob H, Buys macrophage stimulating protein/Ron therapeutic target to impede multiple breast cancer progression. Curr Sep;11(9):1157-68

Skeel A, Yoshimura T, Showalter SD, Tanaka S, Appella E, Leonard EJ. Macrophage stimulating protein: purification, partial amino acid sequence, and cellular activity. J Exp Med. 1991 May 1;173(5):1227-34

Latiano A, Palmieri O, Corritore G, Valvano MR, Bossa F, Cucchiara S, Castro M, Riegler G, De Venuto D, D'Incà R, Andriulli A, Annese V. Variants at the 3p21 locus influence susceptibility and phenotype both in adults and early-onset patients with inflammatory bowel disease. Inflamm Bowel Dis. 2010 Jul;16(7):1108-17

Yoshimura T, Yuhki N, Wang MH, Skeel A, Leonard EJ. Cloning, sequencing, and expression of human macrophage stimulating protein (MSP, MST1) confirms MSP as a member of the family of kringle proteins and locates the MSP gene on chromosome 3. J Biol Chem. 1993 Jul 25;268(21):15461-8 Kurihara N, Iwama A, Tatsumi J, Ikeda K, Suda T. Macrophage-stimulating protein activates STK receptor tyrosine kinase on osteoclasts and facilitates bone resorption by osteoclast-like cells. Blood. 1996 May 1;87(9):3704-10

Cleynen I, Jüni P, Bekkering GE, Nüesch E, Mendes CT, Schmied S, Wyder S, Kellen E, Villiger PM, Rutgeerts P, Vermeire S, Lottaz D. Genetic evidence supporting the association of protease and protease inhibitor genes with inflammatory bowel disease: a systematic review. PLoS One. 2011;6(9):e24106

Ohshiro K, Iwama A, Matsuno K, Ezaki T, Sakamoto O, Hamaguchi I, Takasu N, Suda T. Molecular cloning of rat macrophage-stimulating protein and its involvement in the male reproductive system. Biochem Biophys Res Commun. 1996 Oct 3;227(1):273-80

Ganesan R, Kolumam GA, Lin SJ, Xie MH, Santell L, Wu TD, Lazarus RA, Chaudhuri A, Kirchhofer D. Proteolytic activation of pro-macrophage-stimulating protein by hepsin. Mol Cancer Res. 2011 Sep;9(9):1175-86

Sakamoto O, Iwama A, Amitani R, Takehara T, Yamaguchi N, Yamamoto T, Masuyama K, Yamanaka T, Ando M, Suda T. Role of macrophage-stimulating protein and its receptor, RON tyrosine kinase, in ciliary motility. J Clin Invest. 1997 Feb 15;99(4):701-9

Ma Q, Guin S, Padhye SS, Zhou YQ, Zhang RW, Wang MH. Ribosomal protein S6 kinase (RSK)-2 as a central effector molecule in RON receptor tyrosine kinase mediated epithelial to mesenchymal transition induced by macrophage-stimulating protein. Mol Cancer. 2011 May 28;10:66

Bezerra JA, Carrick TL, Degen JL, Witte D, Degen SJ. Biological effects of targeted inactivation of hepatocyte growth factor-like protein in mice. J Clin Invest. 1998 Mar 1;101(5):1175-83

Melum E, Franke A, Schramm C, Weismüller TJ, Gotthardt DN, Offner FA, Juran BD, Laerdahl JK, Labi V, Björnsson E, Weersma RK, Henckaerts L, Teufel A, Rust C, Ellinghaus E, Balschun T, Boberg KM, Ellinghaus D, Bergquist A, Sauer P, Ryu E, Hov JR, Wedemeyer J, Lindkvist B, Wittig M, Porte RJ, Holm K, Gieger C, Wichmann HE, Stokkers P, Ponsioen CY, Runz H, Stiehl A, Wijmenga C, Sterneck M, Vermeire S, Beuers U, Villunger A, Schrumpf E, Lazaridis KN, Manns MP, Schreiber S, Karlsen TH. Genome-wide association analysis in primary sclerosing cholangitis identifies two non-HLA susceptibility loci. Nat Genet. 2011 Jan;43(1):17-9

Rampino T, Collesi C, Gregorini M, Maggio M, Soccio G, Guallini P, Dal Canton A. Macrophage-stimulating protein is produced by tubular cells and activates mesangial cells. J Am Soc Nephrol. 2002 Mar;13(3):649-57 Wang MH, Zhou YQ, Chen YQ. Macrophage-stimulating protein and RON receptor tyrosine kinase: potential regulators of macrophage inflammatory activities. Scand J Immunol. 2002 Dec;56(6):545-53

Nagahama J, Daa T, Yada N, Kashima K, Fujiwara S, Saikawa T, Yokoyama S. Tyrosine kinase receptor RON and its ligand MSP in Merkel cell carcinoma. Pathol Res Pract. 2011 Aug 15;207(8):463-7

Bhatt AS, Welm A, Farady CJ, Vásquez M, Wilson K, Craik CS. Coordinate expression and functional profiling identify an extracellular proteolytic signaling pathway. Proc Natl Acad Sci U S A. 2007 Apr 3;104(14):5771-6

Sharda DR, Yu S, Ray M, Squadrito ML, De Palma M, Wynn TA, Morris SM Jr, Hankey PA. Regulation of macrophage arginase expression and tumor growth by the Ron receptor tyrosine kinase. J Immunol. 2011 Sep 1;187(5):2181-92

Camp ER, Yang A, Gray MJ, Fan F, Hamilton SR, Evans DB, Hooper AT, Pereira DS, Hicklin DJ, Ellis LM. Tyrosine kinase receptor RON in human pancreatic cancer: expression, function, and validation as a target. Cancer. 2007 Mar 15;109(6):1030-9

Fukuda I, Ishihara T, Ohmachi S, Sakikawa I, Morita A, Ikeda M, Yamane S, Toyosaki-Maeda T, Takinami Y, Okamoto H, Numata Y, Fukui N. Potential plasma biomarkers for progression of knee osteoarthritis using glycoproteomic

Welm AL, Sneddon JB, Taylor C, Nuyten DS, van de Vijver MJ, Hasegawa BH, Bishop JM. The macrophage-stimulating


SS, Welm AL. The pathway as a potential mechanisms involved in Drug Targets. 2010

831



analysis coupled with a 2D-LC-MALDI system. Proteome Sci. 2012 Jun 6;10(1):36

stimulating protein variation enhances the risk of sporadic extrahepatic cholangiocarcinoma. Dig Liver Dis. 2013 Jul;45(7):612-5

Orikawa H, Kawaguchi M, Baba T, Yorita K, Sakoda S, Kataoka H. Activation of macrophage-stimulating protein by human airway trypsin-like protease. FEBS Lett. 2012 Feb 3;586(3):217-21

Lee KE, Kim EY, Kim CS, Choi JS, Bae EH, Ma SK, Kim KK, Lee JU, Kim SW. Macrophage-stimulating protein attenuates gentamicin-induced inflammation and apoptosis in human renal proximal tubular epithelial cells. Biochem Biophys Res Commun. 2013 May 10;434(3):527-33

Ren X, Daa T, Yada N, Kashima K, Fujitomi Y, Yokoyama S. Expression and mutational status of RON in neoplastic lesions of the breast: analysis of MSP/RON signaling in ductal carcinoma in situ and invasive ductal carcinoma. APMIS. 2012 May;120(5):358-67

Sato S, Hanibuchi M, Kuramoto T, Yamamori N, Goto H, Ogawa H, Mitsuhashi A, Van TT, Kakiuchi S, Akiyama S, Nishioka Y, Sone S. Macrophage stimulating protein promotes liver metastases of small cell lung cancer cells by affecting the organ microenvironment. Clin Exp Metastasis. 2013 Mar;30(3):333-44

Srivastava B, Mells GF, Cordell HJ, Muriithi A, Brown M, Ellinghaus E, Franke A, Consortium UP, Karlsen TH, Sandford RN, Alexander GJ, Chapman RW, Rushbrook SM, Melum E. Fine mapping and replication of genetic risk loci in primary sclerosing cholangitis. Scand J Gastroenterol. 2012 Jul;47(7):820-6

This article should be referenced as such: Kawaguchi M, Kataoka H. MST1 (macrophage stimulating 1 (hepatocyte growth factor-like)). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):828-832.

Krawczyk M, Höblinger A, Mihalache F, Grünhage F, Acalovschi M, Lammert F, Zimmer V. Macrophage


832


OPEN ACCESS JOURNAL

Gene Section Review

PIWIL1 (piwi-like RNA-mediated gene silencing 1) Shozo Honda, Yohei Kirino Department of Biomedical Sciences, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, California 90048, USA (SH, YK) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/PIWIL1ID46561ch12q24.html DOI: 10.4267/2042/51873 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Other names: HIWI, MIWI, PIWI HGNC (Hugo): PIWIL1 Location: 12q24.33 Note: The HIWI gene belongs to an evolutionarily conserved PIWI gene family that comprises four members in human (PIWIL1/HIWI, PIWIL2, PIWIL3/HILI and PIWIL4/HIWI2) (Sasaki et al., 2003).

al., 2001). It is 3591 nt in length and comprises 21 verified exons, of which 20 are coding exons with a total length of 2586 nt. The 5'- and 3'-UTRs are 271 and 734 nt long, respectively. Variant 2 has an alternative 3'-UTR, resulting in shorter protein with truncated C-terminus compared with variant 1. Variant 2 was detected by transcriptome analyses of the "full-length long JAPAN" (FLJ) collection (Ota et al., 2004).

DNA/RNA

Protein

Note HIWI cDNA was first partially isolated as an ortholog of Drosophila PIWI (Cox et al., 1998) and then fully identified in a human testis cDNA library (Qiao et al., 2002; Sharma et al., 2001).

Note HIWI protein (NCBI Ref Seq: NP_004755.2) belongs to the PIWI subgroup of Argonaute family proteins, evolutionarily conserved proteins containing two characteristic protein motifs, PAZ and PIWI (Carmell et al., 2002). Argonaute family proteins can be divided into two subclades, AGO and PIWI, and form complexes with small RNAs to regulate gene expressions (Carmell et al., 2002; Hock and Meister, 2008).

Identity

Transcription HIWI has two transcript variants. Variant 1 (NCBI Ref Seq: NM_004764.4) was cloned from a human testis cDNA library (Qiao et al., 2002; Sharma et

HIWI gene occupies a 34445-bp region from positions 130822433 to 130856877 on chromosome 12.


833

PIWIL1 (piwi-like RNA-mediated gene silencing 1)

Honda S, Kirino Y

2002; Houwing et al., 2008; Houwing et al., 2007; Kuramochi-Miyagawa et al., 2004). Since 2006, the small RNAs bound to PIWI proteins have been identified and termed PIWI-interacting RNAs (piRNAs) (Siomi et al., 2011). piRNAs are 24-31 nt in length and are a highly complex mix of sequences derived from defined genomic regions called piRNA clusters. Many piRNAs are derived from transposable elements, and PIWI/piRNA complexes play a crucial role in silencing transposons during germline development (Siomi et al., 2011).

Description The HIWI gene encodes an 861-amino-acid protein (98 kDa). The HIWI protein contains two characteristic protein motifs: a PAZ domain (aa 278-413) and a PIWI domain (aa 556-847). In Argonaute family proteins, the PAZ domain serves as a docking site for the 3'-end of small RNA, whereas the PIWI domain has a structure similar to RNaseH, which cleaves the RNA strand of an RNA-DNA hybrid (Elkayam et al., 2012; Parker and Barford, 2006). Indeed, all three species of the Drosophila PIWI protein family show small RNA-guided RNA cleavage (slicer) activity (Gunawardane et al., 2007; Nishida et al., 2007; Saito et al., 2006). In mouse, MIWI (mouse orthologs of HIWI) and MILI also have the slicer activity, which is essential for transposon silencing and fertility (De Fazio et al., 2011; Reuter et al., 2011). In addition, the HIWI protein contains glycine-arginine-rich repeats mainly in its Nterminus (aa 3-15:GRARARARGRARG; aa1820:GRG; aa728-730:GRG), and these are the motifs for symmetrical dimethylarginine (sDMA) modifications catalyzed by PRMT5 methyltransferase (Kirino et al., 2009). sDMA positions of MIWI were determined by mass spectrometry (Chen et al., 2009; Vagin et al., 2009). PIWI sDMAs serve as binding elements for TUDOR-domain containing proteins, and the sDMAdependent protein interactions play crucial roles in piRNA function and germline development (Chen et al., 2011; Siomi et al., 2010).

Implicated in Various cancers Note Although the expression of PIWI family proteins is normally restricted to germline cells, HIWI has been reported to be aberrantly expressed in a variety of cancers (Suzuki et al., 2012).

Seminoma Note The first report on PIWI expression in cancer was in seminomas (Qiao et al., 2002). HIWI was detected in seminomas but not in nonseminomas, spermatocytic seminomas, or testicular tumors originating from somatic cells such as Sertoli cells and Leydig cells (Qiao et al., 2002).

Gastric cancer

Expression

Note HIWI was expressed in gastric cancer cell lines and tissues, and its expression was correlated with precancerous development and cell proliferation (Liu et al., 2006). HIWI expression was also positively correlated with T stage, lymph node metastasis, and clinical TNM, and patients with higher HIWI expression had shorter survival times (Wang et al., 2012).

Expression of the PIWI protein family is restricted to germline cells (Farazi et al., 2008).

Function PIWI protein family was named after the Drosophila protein PIWI (P-element induced wimpy testis) (Carmell et al., 2002; Farazi et al, 2008). The Drosophila PIWI was first identified in a genetic screen for mutants that affect stem cell division in the germline, and subsequent studies demonstrated that Drosophila PIWI is essential for gametogenesis and is a key regulator of female germline stem cells (Cox et al., 1998; Cox et al., 2000; Lin and Spradling, 1997). PIWI protein mutations in various organisms, including mice and zebrafish, commonly cause defects in gametogenesis, indicating evolutionarily conserved essential roles for PIWI proteins in germline development (Carmell et al., 2007; Deng and Lin,


Sarcoma Note An increased expression of HIWI mRNA was correlated with prognosis of patients with soft-tissue sarcomas (Taubert et al., 2007). HIWI expression promoted sarcomagenesis in cells, developed sarcoma in mice, and correlated with DNA methylation in sarcoma cells (Siddiqi et al., 2012).

834


Honda S, Kirino Y

Pancreatic cancer

References

Note Patients with altered levels of HIWI mRNA had increased risk of tumor-related death (Grochola et al., 2008).

Lin H, Spradling AC. A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development. 1997 Jun;124(12):2463-76 Cox DN, Chao A, Baker J, Chang L, Qiao D, Lin H. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev. 1998 Dec 1;12(23):3715-27

Esophageal cancer Note The cytoplasmic expression of HIWI significantly correlated with histological grade and poorer clinical outcome (He et al., 2009).

Cox DN, Chao A, Lin H. piwi encodes a nucleoplasmic factor whose activity modulates the number and division rate of germline stem cells. Development. 2000 Feb;127(3):503-14 Sharma AK, Nelson MC, Brandt JE, Wessman M, Mahmud N, Weller KP, Hoffman R. Human CD34(+) stem cells express the hiwi gene, a human homologue of the Drosophila gene piwi. Blood. 2001 Jan 15;97(2):426-34

Cervical cancer Note Elevated HIWI expression was associated with cervical cancer invasion and human papillomavirus infection, but not with patient age or histological grade (Liu et al., 2010a).

Carmell MA, Xuan Z, Zhang MQ, Hannon GJ. The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev. 2002 Nov 1;16(21):2733-42

Endometrial cancer

Deng W, Lin H. miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell. 2002 Jun;2(6):819-30

Note HIWI was expressed in endometrial adenocarcinoma but did not correlate with pathological features (Liu et al., 2010b).

Qiao D, Zeeman AM, Deng W, Looijenga LH, Lin H. Molecular characterization of hiwi, a human member of the piwi gene family whose overexpression is correlated to seminomas. Oncogene. 2002 Jun 6;21(25):3988-99

Glioma

Sasaki T, Shiohama A, Minoshima S, Shimizu N. Identification of eight members of the Argonaute family in the human genome small star, filled. Genomics. 2003 Sep;82(3):323-30

Note The expression level of HIWI was positively correlated with tumor grade, and patients with high HIWI expression had poorer clinical outcomes (Sun et al., 2011).

Kuramochi-Miyagawa S, Kimura T et al.. Mili, a mammalian member of piwi family gene, is essential for spermatogenesis. Development. 2004 Feb;131(4):839-49

Colon cancer

Ota T, Suzuki Y, Nishikawa T, Otsuki T et al.. Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 2004 Jan;36(1):40-5

Note In colorectal cancer, HIWI expression in early stage and in adjacent non-cancerous tissues negatively correlated with survival rates and times of the patients (Zeng et al., 2011). Among colon cancer patients without lymph node metastasis, those with HIWI-positive tumors had a significantly lower survival rate than those with HIWInegative tumors (Liu et al., 2012).

Liu X, Sun Y, Guo J, Ma H, Li J, Dong B, Jin G, Zhang J, Wu J, Meng L, Shou C. Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells. Int J Cancer. 2006 Apr 15;118(8):1922-9 Parker JS, Barford D. Argonaute: A scaffold for the function of short regulatory RNAs. Trends Biochem Sci. 2006 Nov;31(11):622-30 Saito K, Nishida KM, Mori T, Kawamura Y, Miyoshi K, Nagami T, Siomi H, Siomi MC. Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev. 2006 Aug 15;20(16):2214-22

Liver cancer Note HIWI expression in hepatocellular carcinoma tissues was significantly higher than in adjacent normal hepatic tissue and was correlated with metastasis (Jiang et al., 2011). HIWI expression positively correlated with tumor size and metastasis and negatively correlated with survival rates in hepatocellular carcinoma cells and tissues (Zhao et al., 2012).

Carmell MA, Girard A, van de Kant HJ, Bourc'his D, Bestor TH, de Rooij DG, Hannon GJ. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline. Dev Cell. 2007 Apr;12(4):503-14 Gunawardane LS, Saito K, Nishida KM, Miyoshi K, Kawamura Y, Nagami T, Siomi H, Siomi MC. A slicer-mediated mechanism for repeat-associated siRNA 5' end formation in Drosophila. Science. 2007 Mar 16;315(5818):1587-90

Lung cancer

Houwing S, Kamminga LM, Berezikov E et al.. A role for Piwi and piRNAs in germ cell maintenance and transposon silencing in Zebrafish. Cell. 2007 Apr 6;129(1):69-82

Note HIWI knockdown decreased cell proliferation and promoted apoptosis of lung cancer stem cells (Liang et al., 2013; Liang et al., 2012).


Nishida KM, Saito K, Mori T, Kawamura Y, Nagami-Okada T, Inagaki S, Siomi H, Siomi MC. Gene silencing mechanisms

835


Honda S, Kirino Y

mediated by Aubergine piRNA complexes in Drosophila male gonad. RNA. 2007 Nov;13(11):1911-22

De Fazio S, Bartonicek N, Di Giacomo M, Abreu-Goodger C, Sankar A, Funaya C, Antony C, Moreira PN, Enright AJ, O'Carroll D. The endonuclease activity of Mili fuels piRNA amplification that silences LINE1 elements. Nature. 2011 Oct 23;480(7376):259-63

Taubert H, Greither T, Kaushal D, Würl P, Bache M, Bartel F, Kehlen A, Lautenschläger C, Harris L, Kraemer K, Meye A, Kappler M, Schmidt H, Holzhausen HJ, Hauptmann S. Expression of the stem cell self-renewal gene Hiwi and risk of tumour-related death in patients with soft-tissue sarcoma. Oncogene. 2007 Feb 15;26(7):1098-100

Jiang J, Zhang H, Tang Q, Hao B, Shi R. Expression of HIWI in human hepatocellular carcinoma. Cell Biochem Biophys. 2011 Sep;61(1):53-8

Farazi TA, Juranek SA, Tuschl T. The growing catalog of small RNAs and their association with distinct Argonaute/Piwi family members. Development. 2008 Apr;135(7):1201-14

Reuter M, Berninger P, Chuma S, Shah H, Hosokawa M, Funaya C, Antony C, Sachidanandam R, Pillai RS. Miwi catalysis is required for piRNA amplification-independent LINE1 transposon silencing. Nature. 2011 Nov 27;480(7376):264-7

Grochola LF, Greither T, Taubert H, Möller P, Knippschild U, Udelnow A, Henne-Bruns D, Würl P. The stem cell-associated Hiwi gene in human adenocarcinoma of the pancreas: expression and risk of tumour-related death. Br J Cancer. 2008 Oct 7;99(7):1083-8

Siomi MC, Sato K, Pezic D, Aravin AA. PIWI-interacting small RNAs: the vanguard of genome defence. Nat Rev Mol Cell Biol. 2011 Apr;12(4):246-58

Höck J, Meister G. The Argonaute protein family. Genome Biol. 2008;9(2):210

Sun G, Wang Y, Sun L, Luo H, Liu N, Fu Z, You Y. Clinical significance of Hiwi gene expression in gliomas. Brain Res. 2011 Feb 10;1373:183-8

Houwing S, Berezikov E, Ketting RF. Zili is required for germ cell differentiation and meiosis in zebrafish. EMBO J. 2008 Oct 22;27(20):2702-11

Zeng Y, Qu LK, Meng L, Liu CY, Dong B, Xing XF, Wu J, Shou CC. HIWI expression profile in cancer cells and its prognostic value for patients with colorectal cancer. Chin Med J (Engl). 2011 Jul;124(14):2144-9

Chen C, Jin J, James DA, Adams-Cioaba MA, Park JG, Guo Y, Tenaglia E, Xu C, Gish G, Min J, Pawson T. Mouse Piwi interactome identifies binding mechanism of Tdrkh Tudor domain to arginine methylated Miwi. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20336-41

Elkayam E, Kuhn CD, Tocilj A, Haase AD, Greene EM, Hannon GJ, Joshua-Tor L. The structure of human argonaute2 in complex with miR-20a. Cell. 2012 Jul 6;150(1):100-10

He W, Wang Z, Wang Q, Fan Q, Shou C, Wang J, Giercksky KE, Nesland JM, Suo Z. Expression of HIWI in human esophageal squamous cell carcinoma is significantly associated with poorer prognosis. BMC Cancer. 2009 Dec 8;9:426

Liang D, Fang Z, Dong M, Liang C, Xing C, Zhao J, Yang Y. Effect of RNA interference-related HiWi gene expression on the proliferation and apoptosis of lung cancer stem cells. Oncol Lett. 2012 Jul;4(1):146-150 Liu C, Qu L, Dong B, Xing X, Ren T, Zeng Y, Jiang B, Meng L, Wu J, Shou C. Combined phenotype of 4 markers improves prognostic value of patients with colon cancer. Am J Med Sci. 2012 Apr;343(4):295-302

Kirino Y, Kim N, de Planell-Saguer M, Khandros E, Chiorean S, Klein PS, Rigoutsos I, Jongens TA, Mourelatos Z. Arginine methylation of Piwi proteins catalysed by dPRMT5 is required for Ago3 and Aub stability. Nat Cell Biol. 2009 May;11(5):652-8

Siddiqi S, Terry M, Matushansky I. Hiwi mediated tumorigenesis is associated with DNA hypermethylation. PLoS One. 2012;7(3):e33711

Vagin VV, Wohlschlegel J, Qu J, Jonsson Z, Huang X, Chuma S, Girard A, Sachidanandam R, Hannon GJ, Aravin AA. Proteomic analysis of murine Piwi proteins reveals a role for arginine methylation in specifying interaction with Tudor family members. Genes Dev. 2009 Aug 1;23(15):1749-62

Suzuki R, Honda S, Kirino Y. PIWI Expression and Function in Cancer. Front Genet. 2012;3:204 Wang Y, Liu Y, Shen X, Zhang X, Chen X, Yang C, Gao H. The PIWI protein acts as a predictive marker for human gastric cancer. Int J Clin Exp Pathol. 2012;5(4):315-25

Liu WK, Jiang XY, Zhang ZX. Expression of PSCA, PIWIL1 and TBX2 and its correlation with HPV16 infection in formalinfixed, paraffin-embedded cervical squamous cell carcinoma specimens. Arch Virol. 2010a May;155(5):657-63 Liu WK, Jiang XY, Zhang ZX. Expression of PSCA, PIWIL1, and TBX2 in endometrial adenocarcinoma. Onkologie. 2010b;33(5):241-5

Zhao YM, Zhou JM, Wang LR, He HW, Wang XL, Tao ZH, Sun HC, Wu WZ, Fan J, Tang ZY, Wang L. HIWI is associated with prognosis in patients with hepatocellular carcinoma after curative resection. Cancer. 2012 May 15;118(10):2708-17

Siomi MC, Mannen T, Siomi H. How does the royal family of Tudor rule the PIWI-interacting RNA pathway? Genes Dev. 2010 Apr 1;24(7):636-46

Liang D, Dong M, Hu LJ, Fang ZH, Xu X, Shi EH, Yang YJ. Hiwi knockdown inhibits the growth of lung cancer in nude mice. Asian Pac J Cancer Prev. 2013;14(2):1067-72

Chen C, Nott TJ, Jin J, Pawson T. Deciphering arginine methylation: Tudor tells the tale. Nat Rev Mol Cell Biol. 2011 Sep 14;12(10):629-42

This article should be referenced as such:


Honda S, Kirino Y. PIWIL1 (piwi-like RNA-mediated gene silencing 1). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):833-836.

836


OPEN ACCESS JOURNAL

Gene Section Review

SET (SET nuclear oncogene) Rebeca Manso-Alonso Pathology Department and Translational Oncology Division, IIS "Fundacion Jimenez Diaz", E-28040 Madrid, Spain (RMA) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/SETID42272ch9q34.html DOI: 10.4267/2042/51874 This article is an update of : Strehl S. SET (SET translocation (myeloid leukemia-associated)). Atlas Genet Cytogenet Oncol Haematol 2005;9(4):321-322. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

(von Lindern et al., 1992), Wilms' tumor (Carlson et al., 1998), T-ALL (Quentmeier et al., 2009), B-CLL and B-NHL (Christensen et al., 2011), and AML (Cristóbal et al., 2012).

Identity Other names: PHAPII, 2PP2A, IPP2A2, IGAAD, TAF-I, I2PP2A, TAF-IBETA HGNC (Hugo): SET Location: 9q34.11 Local order: From centromere to telomere: SET, ABL1, NUP214 (alias CAN), NOTCH1 (alias TAN1).

Localisation SET localizes predominantly in the nucleus; in the cytoplasm, it is found both in the cytosol and associated with the endoplasmic reticulum and with plasmatic membrane.

DNA/RNA

Function SET is a multitasking protein involved in multiple cellular processes. Role in apoptosis: SET oncogene inhibits the tumor suppressor NM23-H1, a Granzyme A-activated DNase during CTL-Mediated Apoptosis (Fan et al., 2003). Its role in apoptosis depends on the cellular model since while overexpression of SET induces neuronal apoptosis (Madeira et al., 2005), in AML resulted in decreased caspase-dependent apoptosis (Cristóbal et al., 2012). Role in cell cycle: Overexpression of SET blocks the cell cycle at the G2/M transition in the colorrectal cancer cell line HCT116, inhibiting cyclin B-CDK1 activity in these cells. SET did not inhibit either cyclin A-CDK2 or cyclin E-CDK2 complexes. Moreover, SET and p21Cip1 cooperate in the inhibition of cyclin B-CDK1 activity (Canela et al., 2003). Role in migration: SET stimulates cell migration in a Rac1-dependent manner. In fact, reduction of SET inhibits Rac1-induced migration, indicating that efficient Rac1 signaling requires membrane recruitment of SET (ten Klooster et al., 2007). A novel peptide antagonist of SET (COG112) inhibits SET association

Description The SET gene spans 6.81 kb on the genomic DNA. The gene includes 8 exons.

Transcription There are four transcript variants: 2863 bp (variant a); 2936 bp (variant b); 2638 bp (variant c); 2562 bp (variant d).

Protein Description The SET protein is a potent endogenous inhibitor of protein phosphatase 2A (PP2A) that encodes three alternative isoforms; isoform 1 (TAF1 alpha)-290 amino acids, 33.5 kDa; isoform 2 (TAF1 beta) - 277 amino acids, 32 kDa ; isoform 3 - 265 amino acids, 31 kDa.

Expression SET is expressed in a wide variety of tissues such as liver, kidney, pancreas, lung, uterus, muscle, brain, bladder and cochlea. Additionally, SET is overexpressed in numerous cancer types such as AUL


837

SET (SET nuclear oncogene)

Manso-Alonso R

normal karyotipe, in T-cell acute lymphoblastic leukemia (T-ALL) (von Lindern et al., 1992) and in one case of acute myeloid leukemia (AML) (Quentmeier et al., 2009; Chae et al., 2012). Functionally, it could promote an elevated expression of HOXA cluster genes in T-ALL. A pharmacologic SET antagonist (FTY720) has been found to induce apoptosis in T-ALL cells (Don et al., 2007; WallingtonBeddoe et al., 2011). Furthermore, overexpression of SET in AML promoted cell growth and resulted in decreased caspase-dependent apoptosis (Cristóbal I et al., 2012). Moreover, SET expression is elevated in B-cell chronic lymphocytic leukemia (CLL), and a SET antagonist peptide (COG449) has been reported to induce apoptosis in primary CLL cells (Christensen et al., 2011).

with Rac1 leading to decreased cellular migration and invasion (Switzer et al., 2011). Role in nucleosome assembly: SET plays a role in MCPH1-mediated chromosome condensation/decondensation. SET inhibits PCAFmediated acetylation of histones. In addition, SET also inhibits the histone acetyl transferases CREBBP and EP300. Besides, overexpression of SET has also been shown to inhibit demethylation of ectopically methylated DNA resulting in gene silencing (Cervoni et al., 2002). Role in regulating AP-1 activity: Expression of SET in HEK-293 cells increased levels and DNA binding of c-Jun as well as the transcriptional activity of AP-1 (Al-Murrani et al., 1999). Role in neuronal development: SET is a negative regulator of neuronal development (Kim et al., 2010) and it is involved in the pathogenesis of primary microcephaly (Leung et al., 2011) and Alzheimer's disease (AD) (Madeira et al., 2005).

B-cell non-Hodgkin lymphoma (NHL) Oncogenesis SET is significantly overexpressed in NHL cells relative to normal B cells (Christensen et al., 2011).

Homology Belongs to the nucleosome assembly protein (NAP) family.

Wilms' tumor Oncogenesis High SET levels has been observed in Wilms' tumor, but not in renal cell carcinoma, adult polycystic kidney disease or transitional cell carcinoma (Carlson et al., 1998).

Implicated in t(9;9)(q34;q34) --> SET-NUP214 (alias CAN)

Alzheimer's disease (AD)

Disease Acute undifferentiated leukemia (AUL); only one case described so far. Cytogenetics Normal karyotype; may be overlooked. Hybrid/Mutated gene 5' SET - 3' NUP214. Abnormal protein The SET-NUP214 (alias CAN) fusion protein consists of almost the whole SET protein fused to the Cterminus of NUP214. Oncogenesis SET-NUP214 leads to disorganization of nuclear export.

Oncogenesis SET protein specifically binds Jcasp early after internalization. Downregulation of SET reduces Jcasp-induced cell death, confirming a role of this protein in Jcasp induced apoptosis. However, overexpression of SET induces neuronal apoptosis, independently of Jcasp internalization, which suggests that SET level is crucial for neuronal survival/death (Madeira et al., 2005).

Primary microcephaly Oncogenesis SET functions as a MCPH1-associated protein, negatively regulating chromosome condensation (Leung et al., 2011). SET expression shows variability throughout the cell cycle and is markedly reduced in the G2 phase, which coincides with Cdk1 activation (Brautigan et al., 1990). SET has also been suggested to be a negative regulator of mitotic entry by blocking cyclin B-CDK1 (Canela et al., 2003). Moreover, SET also binds to histones protecting them from acetylation by acetyltransferases, and this function may contribute to the potencial role of SET in regulating chromatin compaction and transcription (Cervoni et al., 2002).

Chronic and acute leukemias Oncogenesis Acute leukemias are very heterogeneous clonal diseases that disrupt normal hematopoiesis. SET is a reported oncoprotein with a preferentially nuclear location that has been shown to be fused to a putative oncoprotein, CAN/NUP214, in different types of leukemias. The SET-NUP214 (alias CAN) fusion protein consist of almost the whole SET protein fused to the Cterminus of NUP214 (5' SET - 3' NUP214). The fusion gene SET-NUP214 has been reported so far in a patient with acute undifferentiated leukemia (AUL) and


Lung cancer Oncogenesis SET is highly expressed in lung tumors.

838


Manso-Alonso R

Kandilci A, Mientjes E, Grosveld G. Effects of SET and SETCAN on the differentiation of the human promonocytic cell line U937. Leukemia. 2004 Feb;18(2):337-40

It has been reported that the FTY720-mediated necroptosis and lung tumor suppression involves SET and the kinase domain of RIPK1 (Saddoughi et al., 2013).

Saito S, Miyaji-Yamaguchi M, Nagata K. Aberrant intracellular localization of SET-CAN fusion protein, associated with a leukemia, disorganizes nuclear export. Int J Cancer. 2004 Sep 10;111(4):501-7

To be noted

Madeira A, Pommet JM, Prochiantz A, Allinquant B. SET protein (TAF1beta, I2PP2A) is involved in neuronal apoptosis induced by an amyloid precursor protein cytoplasmic subdomain. FASEB J. 2005 Nov;19(13):1905-7

Note miR that target SET: hsa-mir-199b has been reported to be underexpressed in choriocarcinoma and targets SET (Chao et al., 2010).

Don AS, Martinez-Lamenca C, Webb WR, Proia RL, Roberts E, Rosen H. Essential requirement for sphingosine kinase 2 in a sphingolipid apoptosis pathway activated by FTY720 analogues. J Biol Chem. 2007 May 25;282(21):15833-42

References Brautigan DL, Sunwoo J, Labbé JC, Fernandez A, Lamb NJ. Cell cycle oscillation of phosphatase inhibitor-2 in rat fibroblasts coincident with p34cdc2 restriction. Nature. 1990 Mar 1;344(6261):74-8

ten Klooster JP, Leeuwen Iv, Scheres N, Anthony EC, Hordijk PL. Rac1-induced cell migration requires membrane recruitment of the nuclear oncogene SET. EMBO J. 2007 Jan 24;26(2):336-45

von Lindern M, van Baal S, Wiegant J, Raap A, Hagemeijer A, Grosveld G. Can, a putative oncogene associated with myeloid leukemogenesis, may be activated by fusion of its 3' half to different genes: characterization of the set gene. Mol Cell Biol. 1992 Aug;12(8):3346-55

Quentmeier H, Schneider B, Röhrs S, Romani J, Zaborski M, Macleod RA, Drexler HG. SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemiaderived cell lines. J Hematol Oncol. 2009 Jan 23;2:3

Adachi Y, Pavlakis GN, Copeland TD. Identification of in vivo phosphorylation sites of SET, a nuclear phosphoprotein encoded by the translocation breakpoint in acute undifferentiated leukemia. FEBS Lett. 1994a Mar 7;340(3):2315

Chao A, Tsai CL, Wei PC, Hsueh S, Chao AS, Wang CJ, Tsai CN, Lee YS, Wang TH, Lai CH. Decreased expression of microRNA-199b increases protein levels of SET (protein phosphatase 2A inhibitor) in human choriocarcinoma. Cancer Lett. 2010 May 1;291(1):99-107

Adachi Y, Pavlakis GN, Copeland TD. Identification and characterization of SET, a nuclear phosphoprotein encoded by the translocation break point in acute undifferentiated leukemia. J Biol Chem. 1994b Jan 21;269(3):2258-62

Kim DW, Kim KB, Kim JY, Lee KS, Seo SB. Negative regulation of neuronal cell differentiation by INHAT subunit SET/TAF-Iβ. Biochem Biophys Res Commun. 2010 Sep 24;400(3):419-25

Nagata K, Kawase H, Handa H, Yano K, Yamasaki M, Ishimi Y, Okuda A, Kikuchi A, Matsumoto K. Replication factor encoded by a putative oncogene, set, associated with myeloid leukemogenesis. Proc Natl Acad Sci U S A. 1995 May 9;92(10):4279-83

Christensen DJ, Chen Y, Oddo J, Matta KM, Neil J, Davis ED, Volkheimer AD, Lanasa MC, Friedman DR, Goodman BK, Gockerman JP, Diehl LF, de Castro CM, Moore JO, Vitek MP, Weinberg JB. SET oncoprotein overexpression in B-cell chronic lymphocytic leukemia and non-Hodgkin lymphoma: a predictor of aggressive disease and a new treatment target. Blood. 2011 Oct 13;118(15):4150-8

Li M, Makkinje A, Damuni Z. The myeloid leukemia-associated protein SET is a potent inhibitor of protein phosphatase 2A. J Biol Chem. 1996 May 10;271(19):11059-62

Leung JW, Leitch A, Wood JL, Shaw-Smith C, Metcalfe K, Bicknell LS, Jackson AP, Chen J. SET nuclear oncogene associates with microcephalin/MCPH1 and regulates chromosome condensation. J Biol Chem. 2011 Jun 17;286(24):21393-400

Carlson SG, Eng E, Kim EG, Perlman EJ, Copeland TD, Ballermann BJ. Expression of SET, an inhibitor of protein phosphatase 2A, in renal development and Wilms' tumor. J Am Soc Nephrol. 1998 Oct;9(10):1873-80

Switzer CH, Cheng RY, Vitek TM, Christensen DJ, Wink DA, Vitek MP. Targeting SET/I(2)PP2A oncoprotein functions as a multi-pathway strategy for cancer therapy. Oncogene. 2011 Jun 2;30(22):2504-13

Al-Murrani SW, Woodgett JR, Damuni Z. Expression of I2PP2A, an inhibitor of protein phosphatase 2A, induces c-Jun and AP-1 activity. Biochem J. 1999 Jul 15;341 ( Pt 2):293-8 Cervoni N, Detich N, Seo SB, Chakravarti D, Szyf M. The oncoprotein Set/TAF-1beta, an inhibitor of histone acetyltransferase, inhibits active demethylation of DNA, integrating DNA methylation and transcriptional silencing. J Biol Chem. 2002 Jul 12;277(28):25026-31

Wallington-Beddoe CT, Hewson J, Bradstock KF, Bendall LJ. FTY720 produces caspase-independent cell death of acute lymphoblastic leukemia cells. Autophagy. 2011 Jul;7(7):707-15 Chae H, Lim J, Kim M, Park J, Kim Y, Han K, Lee S, Min WS. Phenotypic and genetic characterization of adult T-cell acute lymphoblastic leukemia with del(9)(q34);SET-NUP214 rearrangement. Ann Hematol. 2012 Feb;91(2):193-201

Fan Z, Beresford PJ, Zhang D, Lieberman J. HMG2 interacts with the nucleosome assembly protein SET and is a target of the cytotoxic T-lymphocyte protease granzyme A. Mol Cell Biol. 2002 Apr;22(8):2810-20

Cristóbal I, Garcia-Orti L, Cirauqui C, Cortes-Lavaud X, García-Sánchez MA, Calasanz MJ, Odero MD. Overexpression of SET is a recurrent event associated with poor outcome and contributes to protein phosphatase 2A inhibition in acute myeloid leukemia. Haematologica. 2012 Apr;97(4):543-50

Canela N, Rodriguez-Vilarrupla A, Estanyol JM, Diaz C, Pujol MJ, Agell N, Bachs O. The SET protein regulates G2/M transition by modulating cyclin B-cyclin-dependent kinase 1 activity. J Biol Chem. 2003 Jan 10;278(2):1158-64 Fan Z, Beresford PJ, Oh DY, Zhang D, Lieberman J. Tumor suppressor NM23-H1 is a granzyme A-activated DNase during CTL-mediated apoptosis, and the nucleosome assembly protein SET is its inhibitor. Cell. 2003 Mar 7;112(5):659-72


Leopoldino AM, Squarize CH, Garcia CB, Almeida LO, Pestana CR, Polizello AC, Uyemura SA, Tajara EH, Gutkind JS, Curti C. Accumulation of the SET protein in HEK293T cells

839


Manso-Alonso R

and mild oxidative stress: cell survival or death signaling. Mol Cell Biochem. 2012 Apr;363(1-2):65-74

I2PP2A/SET and mediates lung tumour suppression via activation of PP2A-RIPK1-dependent necroptosis. EMBO Mol Med. 2013 Jan;5(1):105-21

Saddoughi SA, Gencer S, Peterson YK, Ward KE, Mukhopadhyay A, Oaks J, Bielawski J, Szulc ZM, Thomas RJ, Selvam SP, Senkal CE, Garrett-Mayer E, De Palma RM, Fedarovich D, Liu A, Habib AA, Stahelin RV, Perrotti D, Ogretmen B. Sphingosine analogue drug FTY720 targets


This article should be referenced as such: Manso-Alonso R. SET (SET nuclear oncogene). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):837-840.

840


OPEN ACCESS JOURNAL

Gene Section Review

TRPM8 (transient receptor potential cation channel, subfamily M, member 8) María Llanos Valero, Luis A Pardo Molecular Oncology Laboratory. Facultad de Medicina. CRIB. UCLM. Albacete, Spain (MLV), Department of Molecular Biology of Neuronal Signals, Max-Planck Institute of Experimental Medicine, Gottingen, Germany (LAP) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Genes/TRPM8ID42709ch2q37.html DOI: 10.4267/2042/51875 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Identity

The ion pore domains are located between exons 16 and 20.

Other names: LTRPC6, TRPP8 HGNC (Hugo): TRPM8 Location: 2q37.1

Transcription The 1104 aa compose a each of the 130 KDa subunits that convey to form a homotetramer. Alternative splicing produces 11 mRNA species. The promoter contains some transcription factor binding sites for NKX3-1, NKX2-5, USF1, MYC, LMOR and ARNt (Kaiser, 2004). There are two short functional splice variants described in prostate cancer; SM8α and SM8β, that act as regulatory subunits of the full-length protein (Bidaux et al., 2012).

DNA/RNA Description TRPM8 consists of 27 exons that span102 kilo base pairs located at 2q37. The open reading frame (ORF) has 3312 bp resulting in an 1104 residue product. It exhibits the highly conserved region characteristic of the TRP family.

Genomic structure of human TRPM8.


841

TRPM8 (transient receptor potential cation channel, subfamily M, member 8)

Valero ML, Pardo LA

Schematic representation of TRPM8 protein (adapted from Latorre et al., 2011).

(Phelps and Gaudet, 2007). The protein shows 8 putative glycosylation sites and an immunogenic epitope that will facilitate the future design of peptide vaccination (Kiessling et al., 2003).

Protein Description Structurally, the TRPM8 channel is formed by four identical subunits. Each subunit shows 6 transmembrane domains (S1-S6) that surround the central pore, with S5 and S6 forming the gate and selective filter. The N- and C-terminal domains are in the cytoplasmic side (Peier et al., 2002; Latorre et al., 2011). The C- terminal domain is essential for the maturation, oligomerization and trafficking of the channel to the plasma membrane (Erler et al., 2006; Cayouette and Boulay, 2007). The "TRP box", in common with all the TRP family members and a binding site for PIP2, are located in this C-terminal tail. Functional TRPM8 channels require the presence of the COOH terminal as well as the region compromised between amino acids 40 to 86 of the NH2 terminal


Expression TRPM8 is expressed mainly in a subpopulation of primary afferent neurons from both, dorsal root and trigeminal ganglia, and in the nodose and geniculate ganglia in the peripheral nervous system. The protein has been also identified in prostate and genitourinary tract, bladder, sperm, vascular smooth muscle, liver, lung and odontoblasts (Latorre et al., 2011).

Localisation The channel is expressed in the plasma membrane and in the membrane rafts. In prostate cancer cells, it is expressed in the endoplasmic reticulum membrane too (Latorre et al., 2011).

842


Function

Implicated in

TRPM8 is a non-selective cation channel that primarily mediates the detection of cold thermal stimuli by primary afferent sensory neurons of afferent nerve fibres. In these cells, a temperature decrease from 28 to 8°C generates an increase in the intracellular calcium and action potential firing (McKemy et al., 2002; Peier et al., 2002; Bautista et al., 2007). This cold sensitivity is strongly compromised in the knock-out mice, disclosing a central role for TRPM8 in the detection of innocuous cold in vivo (Knowlton et al., 2013). TRPM8 is a polymodal receptor, activated by cold and also by membrane depolarization, as well as several inflammatory agents, and natural and chemical compounds as menthol and icilin. The activation by icilin requiries the presence of intracellular calcium (Chuang et al., 2004). The residues involved in menthol activation are Tyr745 in the S2 segment and Tyr1005 and Leu1009, located in the C-terminus (Bandell et al., 2006). Besides menthol and icilin, there are many agonist described for the channel as WS-12, CPS-39, linalool, geraniol, frescolat etc, as well as well-known antagonists; BCTC, thio-BCTC, capsazepine, AMTB and JNJ41876666 (Behrendt et al., 2004; Valero et al., 2012; Journigan and Zaveri, 2013). One year before being cloned, TRPM8 was described as a transcript overexpressed in prostate cancer cells (Tsavaler et al., 2001; Zhang and Barritt, 2004). Nowadays, the presence of the channel has been described for a variety of tumours (Lehen'kyi and Prevarskaya, 2011) as melanoma (Guo et al., 2012), colon or breast (Dhennin-Duthille et al., 2011). Modulation TRPM8 channels are activated by stimulation of tyrosin-kinase and protein G-coupled receptors. The channel is also capable of activating Gq protein (Klasen et al., 2012). PI(4,5)P2 acts as a positive modulator of cold and menthol sensitivity by changing the voltage-sensitivity of the channel (Rohacs et al., 2005; Daniels et al., 2009; Yudin and Rohacs, 2012). Protein Kinase C is implicated in TRPM8 desensitization (Yudin and Rohacs, 2012). Phospolipase C (PLC)-coupled receptors mediate adaptation of TRPM8 to thermal stimuli (Daniels et al., 2009; Yudin and Rohacs, 2012). There are indications of modulation by PKC and PKA, which would underlie reduced responses to cold and menthol in neurons in the presence of bradykinin and prostaglandin E2 (Latorre et al., 2011; Yudin and Rohacs, 2012). TRPM8 also co-expresses with TrkA, the high affinity tyrosine kinase receptor for NGF (Latorre et al., 2011).


Valero ML, Pardo LA

Prostate cancer Note The TRPM8 channel is expressed in prostate cancer and normal prostatic cells. In the prostate cancer cells, the channel is functional in the cells of the different stadia of the illness. Inhibition of the expression or function of the channel reduces proliferation rates and proliferative fraction in the tumor cells, but not in nontumor prostate cells. There is no consistent acceleration of growth after stimulation of the channel with menthol or icilin, indicating that basal TRPM8 expression is enough to sustain growth of prostate cancer cells. The evidence supports a tumor-specific role of TRPM8 rather than a tumor-specific expression of the channel, thus reinforcing the relevance of this channel as a candidate for prostate cancer therapy (Zhang and Barritt, 2004; Van Haute et al., 2010; Valero et al., 2012).

Melanoma Note TRPM8 channels are expressed in human melanocytes and melanoma cells where its activation produces sustained Ca2+ influx. Different studies have revealed the involvement of the channel in inhibition of pigmentation and melanoma proliferation. Targeting TRPM8 with natural compounds as adjuvant may help in melanoma therapy (Guo et al., 2012).

Pain Note The hypersensitivity to cold manifested as cold hyperalgesia or allodynia, often noted in patients with neuropathic pain, is mediated by TRPM8, making the channel a potential molecular target for pain relief. There are however concerns regarding thermoregulation upon manipulation of TRPM8 activity (Belmonte et al., 2009; Caspani et al., 2009; Brederson et al., 2013).

References Tsavaler L, Shapero MH, Morkowski S, Laus R. Trp-p8, a novel prostate-specific gene, is up-regulated in prostate cancer and other malignancies and shares high homology with transient receptor potential calcium channel proteins. Cancer Res. 2001 May 1;61(9):3760-9 McKemy DD, Neuhausser WM, Julius D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature. 2002 Mar 7;416(6876):52-8 Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA, Story GM, Earley TJ, Dragoni I, McIntyre P, Bevan S, Patapoutian A. A TRP channel that senses cold stimuli and menthol. Cell. 2002 Mar 8;108(5):705-15

843


Kiessling A, Füssel S, Schmitz M, Stevanovic S, Meye A, Weigle B, Klenk U, Wirth MP, Rieber EP. Identification of an HLA-A*0201-restricted T-cell epitope derived from the prostate cancer-associated protein trp-p8. Prostate. 2003 Sep 1;56(4):270-9

Valero ML, Pardo LA

Van Haute C, De Ridder D, Nilius B.. TRP channels in human prostate. ScientificWorldJournal. 2010 Aug 17;10:1597-611. doi: 10.1100/tsw.2010.149. (REVIEW) Dhennin-Duthille I, Gautier M, Faouzi M, Guilbert A, Brevet M, Vaudry D, Ahidouch A, Sevestre H, Ouadid-Ahidouch H.. High expression of transient receptor potential channels in human breast cancer epithelial cells and tissues: correlation with pathological parameters. Cell Physiol Biochem. 2011;28(5):81322. doi: 10.1159/000335795. Epub 2011 Dec 15.

Behrendt HJ, Germann T, Gillen C, Hatt H, Jostock R. Characterization of the mouse cold-menthol receptor TRPM8 and vanilloid receptor type-1 VR1 using a fluorometric imaging plate reader (FLIPR) assay. Br J Pharmacol. 2004 Feb;141(4):737-45

Latorre R, Brauchi S, Madrid R, Orio P.. A cool channel in cold transduction. Physiology (Bethesda). 2011 Aug;26(4):273-85. doi: 10.1152/physiol.00004.2011. (REVIEW)

Chuang HH, Neuhausser WM, Julius D. The super-cooling agent icilin reveals a mechanism of coincidence detection by a temperature-sensitive TRP channel. Neuron. 2004 Sep 16;43(6):859-69

Lehen'kyi V, Prevarskaya N.. Oncogenic TRP channels. Adv Exp Med Biol. 2011;704:929-45. doi: 10.1007/978-94-0070265-3_48. (REVIEW)

Kaiser S.. Identification and Characterization of the Ion Channel TRPM8 in Prostate Cancer. Dissertation; http://edoc.hu-berlin.de/dissertationen/kaiser-simone-2004-0610/HTML/

Bidaux G, Beck B, Zholos A, Gordienko D, Lemonnier L, Flourakis M, Roudbaraki M, Borowiec AS, Fernandez J, Delcourt P, Lepage G, Shuba Y, Skryma R, Prevarskaya N.. Regulation of activity of transient receptor potential melastatin 8 (TRPM8) channel by its short isoforms. J Biol Chem. 2012 Jan 27;287(5):2948-62. doi: 10.1074/jbc.M111.270256. Epub 2011 Nov 28.

Zhang L, Barritt GJ.. Evidence that TRPM8 is an androgendependent Ca2+ channel required for the survival of prostate cancer cells. Cancer Res. 2004 Nov 15;64(22):8365-73. Rohacs T, Lopes CM, Michailidis I, Logothetis DE.. PI(4,5)P2 regulates the activation and desensitization of TRPM8 channels through the TRP domain. Nat Neurosci. 2005 May;8(5):626-34. Epub 2005 Apr 24.

Guo H, Carlson JA, Slominski A.. Role of TRPM in melanocytes and melanoma. Exp Dermatol. 2012 Sep;21(9):650-4. doi: 10.1111/j.1600-0625.2012.01565.x.

Bandell M, Dubin AE, Petrus MJ, Orth A, Mathur J, Hwang SW, Patapoutian A.. High-throughput random mutagenesis screen reveals TRPM8 residues specifically required for activation by menthol. Nat Neurosci. 2006 Apr;9(4):493-500. Epub 2006 Mar 5.

Klasen K, Hollatz D, Zielke S, Gisselmann G, Hatt H, Wetzel CH.. The TRPM8 ion channel comprises direct Gq proteinactivating capacity. Pflugers Arch. 2012 Jun;463(6):779-97. doi: 10.1007/s00424-012-1098-7. Epub 2012 Mar 30. Valero ML, Mello de Queiroz F, Stuhmer W, Viana F, Pardo LA.. TRPM8 ion channels differentially modulate proliferation and cell cycle distribution of normal and cancer prostate cells. PLoS One. 2012;7(12):e51825. doi: 10.1371/journal.pone.0051825. Epub 2012 Dec 14.

Erler I, Al-Ansary DM, Wissenbach U, Wagner TF, Flockerzi V, Niemeyer BA.. Trafficking and assembly of the cold-sensitive TRPM8 channel. J Biol Chem. 2006 Dec 15;281(50):38396404. Epub 2006 Oct 25. Bautista DM, Siemens J, Glazer JM, Tsuruda PR, Basbaum AI, Stucky CL, Jordt SE, Julius D.. The menthol receptor TRPM8 is the principal detector of environmental cold. Nature. 2007 Jul 12;448(7150):204-8. Epub 2007 May 30.

Yudin Y, Rohacs T.. Regulation of TRPM8 channel activity. Mol Cell Endocrinol. 2012 Apr 28;353(1-2):68-74. doi: 10.1016/j.mce.2011.10.023. Epub 2011 Oct 28. (REVIEW)

Cayouette S, Boulay G.. Intracellular trafficking of TRP channels. Cell Calcium. 2007 Aug;42(2):225-32. Epub 2007 Mar 21. (REVIEW)

Brederson JD, Kym PR, Szallasi A.. Targeting TRP channels for pain relief. Eur J Pharmacol. 2013 Mar 14. pii: S00142999(13)00173-8. doi: 10.1016/j.ejphar.2013.03.003. [Epub ahead of print]

Phelps CB, Gaudet R.. The role of the N terminus and transmembrane domain of TRPM8 in channel localization and tetramerization. J Biol Chem. 2007 Dec 14;282(50):36474-80. Epub 2007 Oct 1.

Journigan VB, Zaveri NT.. TRPM8 ion channel ligands for new therapeutic applications and as probes to study menthol pharmacology. Life Sci. 2013 Mar 19;92(8-9):425-37. doi: 10.1016/j.lfs.2012.10.032. Epub 2012 Nov 16. (REVIEW)

Belmonte C, Brock JA, Viana F.. Converting cold into pain. Exp Brain Res. 2009 Jun;196(1):13-30. doi: 10.1007/s00221-0091797-2. Epub 2009 Apr 28. (REVIEW)

Knowlton WM, Palkar R, Lippoldt EK, McCoy DD, Baluch F, Chen J, McKemy DD.. A sensory-labeled line for cold: TRPM8expressing sensory neurons define the cellular basis for cold, cold pain, and cooling-mediated analgesia. J Neurosci. 2013 Feb 13;33(7):2837-48. doi: 10.1523/JNEUROSCI.194312.2013.

Caspani O, Zurborg S, Labuz D, Heppenstall PA.. The contribution of TRPM8 and TRPA1 channels to cold allodynia and neuropathic pain. PLoS One. 2009 Oct 8;4(10):e7383. doi: 10.1371/journal.pone.0007383.

This article should be referenced as such:

Daniels RL, Takashima Y, McKemy DD.. Activity of the neuronal cold sensor TRPM8 is regulated by phospholipase C via the phospholipid phosphoinositol 4,5-bisphosphate. J Biol Chem. 2009 Jan 16;284(3):1570-82. doi: 10.1074/jbc.M807270200. Epub 2008 Nov 18.


Valero ML, Pardo LA. TRPM8 (transient receptor potential cation channel, subfamily M, member 8). Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):841-844.

844


OPEN ACCESS JOURNAL

Leukaemia Section Short Communication

1q translocations (unbalanced) in myeloid malignancies Adriana Zamecnikova, Soad Al Bahar Kuwait Cancer Control Center, Dep of Hematology, Laboratory of Cancer Genetics, Kuwait (AZ, SA) Published in Atlas Database: May 2013 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/Unb1qMyeloidMalignID1638.html DOI: 10.4267/2042/51876 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Prognosis

Clinics and pathology

While mechanistically unbalanced 1q abnormalities result in gain of 1q, the prognostic implication may be entirely different, depending on partner chromosomes. Although more case studies are needed, previously published data indicate a possible association of unbalanced 1q rearrangements with a highly proliferative phenotype in myeloproliferative disorders with a propensity of disease transformation.

Disease BCR-ABL-negative chronic myeloproliferative neoplasms (MPN): essential thrombocythemia (ET), polycythemia vera (PV), primary myelofibrosis (PMF), myelodysplastic syndromes (MDS) and less frequently in acute myeloid leukemia and other myeloproliferative disorders.

Etiology

Genetics

Although the underlying mechanism for these chromosomal alterations is unclear, it is possible that chromosomes with large constitutive heterochromatin bands such as chromosome 1 may be at risk of centromeric instability and be predisposed to centromeric fusion with other chromosomes. This possibility is supported by observations that unbalanced chromosome rearrangements frequently involve the fusion of the large constitutive heterochromatin regions of chromosomes. Therefore, it is likely, that larger constitutive heterochromatin chromosomes may be more at risk of centromeric instability and predisposed to chromosome breakage at the centromere (Caramazza et al., 2010; Millington et al., 2008).

Note der(Y)t(Y;1)(q11-12;12-25). Myelodysplastic syndromes (MDS), acute myeloid leukemia (AML) (M2, M4 mostly), chronic myelomonocytic leukemia (CMMoL) and less frequently other chronic myeloproliferative disorders (MPD). Most cases involve Yq12 and 1q12 breakpoints. Sole anomaly in the majority of myeloid disorders, may be accompanied by numerical anomalies (+8, +9). Rarely found in lymphoid malignancies as part of complex karyotypes (Manabe et al., 2013; Michaux et al., 1996b). der(1)t(1;1)(p36;q11-q32). The balanced translocation t(1;1)(p36;q21) involving the DUSP10/PRDM16 genes is associated with myeloid disorders; the unbalanced der(1)t(1;1) involving 1q11-32 breakpoints may be observed in both myeloid and lymphoid proliferations and is frequently associated with a highly complex karyotype (Duhoux et al., 2011; Noguchi et al., 2007). der(2)t(1;2)(q12;q37). Identified in patients suffering from different acute myeloid leukemia subtypes; less frequently chronic myeloid disorders. Found mostly in complex karyotypes; likely to be a secondary anomaly. The balanced t(1;2)(q12;q37) is occurring in acute myeloid leukemia (Busson-Le Coniat et al., 1999).

Pathology While the mechanism(s) is not entirely clear, hypomethylation of heterochromatic 1q sequences may be a cause of centromeric instability leading to centromeric DNA decondensation. Immunodeficiency may be a factor involved in centromeric instability, at least in some cases. This is supported by observations of high frequency of centromeric heterochromatin instability and frequent 1q exchanges in some patients with immunodeficiency (Sawyer et al., 1995a; Sawyer et al., 1995b; Polito et al., 1996).


845

1q translocations (unbalanced) in myeloid malignancies

Zamecnikova A, Al Bahar S

patients with myelodysplastic syndromes (Leon et al., 2011). der(11)t(1;11)(q12-21;q14-25). Unbalanced form is identified in myeloid and lymphoid malignancies; described mainly in secondary cases as part of highly complex karyotypes (Secker-Walker et al., 1998; Douet-Guilbert et al., 2008). The balanced t(1;11)(q21;q23) and MLL rearrangement is associated with in AML, mainly M4/M5. der(12)t(1;12)(q11-21;p11-13). Rare abnormality, found in myeloid and lymphoid neoplasm, described in complex karyotypes; most likely as a secondary rearrangement (La Starza et al., 1999; Andersen et al., 2005). der(1;13)(q10;q10). Uncommon in myeloid malignancies; described in chronic myeloid neoplasms including polycythemia vera and essential thrombocythemia (Flach et al., 2011; Tanaka et al., 2006). der(1;14)(q10;q10). Detected in chronic and acute myeloid disorders found as a single anomaly in a majority of patients (Fogu et al., 2012). dic(1;15)(p11;p11). Found in patients with various conditions, including both lymphoid and myeloid neoplasms. Rare, but nonrandom anomaly in MPD, mostly MDS and AML (Michaux et al., 1996a). der(16)t(1;16)(q11-25;q11-24). Occurs in a wide variation of hematologic malignancies mostly as a part of complex karyotypes; limited number of additional anomalies in myeloproliferative disorders. A rare but nonrandom abnormality in myelodysplastic syndromes, associated with male predominance, suggesting a putative association of this translocation with male gender (Lunghi et al., 2010). der(18)t(1;18)(q10-25;q11-23). Heterogeneous breakpoints; the anomaly is relatively restricted to myeloid disorders; found mostly in a highly proliferative ET/PV phenotype with a propensity to transform into myelofibrosis and acute leukemia. In particular, the subtype der(18)(q10;q10) seems to be associated with the aggressive phenotype of PV. Found as the sole karyotypic abnormality in the majority of patients. A relatively high incidence of JAK2 mutations in these patients suggests a possible link between JAK2 mutations and disease etiology (Trautmann et al., 1992; Diez-Martin et al., 1991; Gangat et al., 2008; Wan et al., 2001a; Azuma et al., 2010; Alter et al., 2000). der(1)t(1;19)(q23;p13.1). Cytogenetic appearance identical to t(1;19)(q23;p13.3), a specific aberration in ALL; occasionally described in myeloid neoplasms (MDS and AML) with various 1q21-1q25 breakpoints (Tchinda et al., 2002). der(20)t(1;20)(q10-21;q11-13). Rare occurrence in myeloid lineages; apparently secondary anomaly, found mostly as part of complex karyotypes (Wan et al 2001b; Raimondi et al., 1999).

der(5)t(1;5)(q12-q25;q13-q35). Found in lymphoid and myeloid malignancies with cytogenetically heterogeneous breakpoints. In both lineages found as part of complex karyotypes, most likely as a secondary anomaly. In myeloid disorders the anomaly seems to confer a poor prognosis with a possible link to previous mutagenic exposure. The balanced t(1;5)(q23;q33) involving the PDGFRB gene is associated with a myeloproliferative disorder and eosinophilia (Johansson et al., 1997). der(6)t(1;6)(q21-23;p21.3). Found in chronic myeloproliferative disorders and less frequently in AML/MDS. DNA sequences may be overrepresented at 6p as either cryptic duplications or cryptic low-copy gains. The presence of fragile site FRA6C, located in 6p22 suggest, that 6p gains may arise from acquired and/or congenital genomic instability. In addition, the occurrence of translocations involving 6p22 after chemotherapy or radiation therapy indicates, that one or more therapeutic agents might play a role in their origin (Dingli et al., 2005; Busson-Le Coniat et al., 1999). der(1;7)(q10;p10). Defines a unique clinicopathological subgroup of myeloid neoplasms; found particularly in MDS and AML and less frequently in chronic myeloproliferative disorders. Previous history of chemo- and/or radiotherapies has been described in more than half cases. Sole cytogenetic anomaly in around one-half cases, limited number of additional abnormalities, consisting mostly of trisomy 8. The unbalanced translocation, der(1;7)(q10;p10), leading to allelic imbalance of trisomy 1q and 7q monosomy is associated with high rates of progression to AML in MDS and unfavorable prognosis (Caramazza et al., 2010; Slovak et al., 2009; Sanada et al., 2007). der(1;9)(q10;p10). Rarely found in patients of essential thrombocythemia with JAK2 V617F mutation that transformed to acute myelogenous leukemia or to myelofibrosis, suggesting the anomaly may play a role in the progression of myeloproliferative neoplasms (Bobadilla et al., 2007). der(9)t(1;9)(q11;q34). Rare occurrence, found in 3 cases of acute myeloid leukemia, 1 case of polycythemia vera, 1 case with chronic myelomonocytic leukemia and 1 case of multiple myeloma (Suh et al., 2009). der(9)t(1;9)(q12;q12). Rare, found in 2 patients with polycythemia vera in transformation and in 1 patient with myelofibrosis, which later evolved into acute myelomonocytic leukemia; may be consistently associated with myeloproliferative disorders showing a high propensity to transformation. Sole abnormality in most cases; gain of 9p might play a role for gain of function of the JAK2 gene on 9p24 (Rege-Cambrin et al., 1991). der(1;10)(q10;p10). Rare anomaly, described in


846



Cytogenetics

References

Cytogenetics morphological

Diez-Martin JL, Graham DL, Petitt RM, Dewald GW. Chromosome studies in 104 patients with polycythemia vera. Mayo Clin Proc. 1991 Mar;66(3):287-99

Unbalanced rearrangements, resulting in partial or total trisomy of 1q and loss of genomic sequences from the partner chromosome. Abnormal clones containing extra copies of 1q may originate by several mechanisms, including whole-arm translocations, unbalanced rearrangements between variable partner chromosomes, 'dicentric' translocations and partial duplications of 1q.

Rege-Cambrin G, Speleman F, Kerim S, Scaravaglio P, Carozzi F, Dal Cin P, Michaux JL, Offner F, Saglio G, Van den Berghe H. Extra translocation +der(1q9p) is a prognostic indicator in myeloproliferative disorders. Leukemia. 1991 Dec;5(12):1059-63

Additional anomalies

Trautmann U, Rubbert A, Gramatzki M, Henschke F, Gebhart E. Multiple chromosomal changes and karyotypic evolution in a patient with myelofibrosis. Cancer Genet Cytogenet. 1992 Jul 1;61(1):6-10

Usually appear as a sole chromosomal abnormality during the entire clinical courses or accompanied only by a limited number of additional abnormalities, suggesting that gain of 1q plays a role in the pathogenesis of these rearrangements.

Sawyer JR, Swanson CM, Koller MA, North PE, Ross SW. Centromeric instability of chromosome 1 resulting in multibranched chromosomes, telomeric fusions, and "jumping translocations" of 1q in a human immunodeficiency virusrelated non-Hodgkin's lymphoma. Cancer. 1995a Oct 1;76(7):1238-44 Sawyer JR, Swanson CM, Wheeler G, Cunniff C. Chromosome instability in ICF syndrome: formation of micronuclei from multibranched chromosomes 1 demonstrated by fluorescence in situ hybridization. Am J Med Genet. 1995b Mar 27;56(2):203-9

Genes involved and proteins Note No specific gene targets at the breakpoints are likely to be involved. In these rearrangements, the critical region between 1q21 and 1q32 is known to be commonly spanned, but no pathogenetically relevant genes have been demonstrated.

Michaux L, Dierlamm J, Mecucci C, Meeus P, Ameye G, Libouton JM, Verhoef G, Ferrant A, Louwagie A, VerellenDumoulin C, Van Den Berghe H. Dicentric (1;15) in myeloid disorders. Cancer Genet Cytogenet. 1996a May;88(1):86-9 Michaux L, Wlodarska I, Vellosa ER, Verhoef G, Van Orshoven A, Michaux JL, Scheiff JM, Mecucci C, Van den Berghe H. Translocation (Y;1)(q12;q12) in hematologic malignancies. Report on two new cases, FISH characterization, and review of the literature. Cancer Genet Cytogenet. 1996b Jan;86(1):35-8

Result of the chromosomal anomaly

Polito P, Canzonieri V, Cilia AM, Gloghini A, Carbone A, Gaidano G. Centromeric instability of chromosome 1 resulting in multibranched chromosomes, telomeric fusions, and "jumping translocations" of 1q in a human immunodeficiency virus-related non-Hodgkin's lymphoma. Cancer. 1996 Sep 1;78(5):1142-4

Fusion protein Oncogenesis The unbalanced nature of these rearrangements indicates that mechanistically, either trisomy of 1q and/or loss of putative tumor suppressors may potentially contribute to disease pathogenesis. As the gain of 1q that results from these translocations is consistently associated with myeloproliferative disorders, it is likely that certain chromosome 1q regions are pathogenetically relevant to both chronic and advanced phases of MPN. This finding suggests that the gain of 1q and appears to be one of the progressional steps in these disorders, while the loss of tumor suppressor genes may also contribute to clonal proliferation, analogous to numerical aberrations and chromosome deletions.

Johansson B, Brøndum-Nielsen K, Billström R, Schiødt I, Mitelman F. Translocations between the long arms of chromosomes 1 and 5 in hematologic malignancies are strongly associated with neoplasms of the myeloid lineages. Cancer Genet Cytogenet. 1997 Dec;99(2):97-101 Secker-Walker LM, Moorman AV, Bain BJ, Mehta AB. Secondary acute leukemia and myelodysplastic syndrome with 11q23 abnormalities. EU Concerted Action 11q23 Workshop. Leukemia. 1998 May;12(5):840-4 Busson-Le Coniat M, Salomon-Nguyen F, Dastugue N, Maarek O, Lafage-Pochitaloff M, Mozziconacci MJ, Baranger L, Brizard F, Radford I, Jeanpierre M, Bernard OA, Berger R. Fluorescence in situ hybridization analysis of chromosome 1 abnormalities in hematopoietic disorders: rearrangements of DNA satellite II and new recurrent translocations. Leukemia. 1999 Dec;13(12):1975-81

To be noted Note A relatively high incidence of JAK2 mutations in combination with 1q rearrangements in MPN, suggests a possible link between JAK2 mutations and 1q rearrangements in myeloid malignances, pathologically relevant either at diagnosis or in advanced stages of the disease.


La Starza R, Stella M, Testoni N, Di Bona E, Ciolli S, Marynen P, Martelli MF, Mandelli F, Mecucci C. Characterization of 12p molecular events outside ETV6 in complex karyotypes of acute myeloid malignancies. Br J Haematol. 1999 Nov;107(2):340-6 Raimondi SC, Chang MN, Ravindranath Y, Behm FG, Gresik MV, Steuber CP, Weinstein HJ, Carroll AJ. Chromosomal abnormalities in 478 children with acute myeloid leukemia: clinical characteristics and treatment outcome in a cooperative

847



pediatric oncology group study-POG 8821. Blood. 1999 Dec 1;94(11):3707-16

Millington K, Hudnall SD, Northup J, Panova N, Velagaleti G. Role of chromosome 1 pericentric heterochromatin (1q) in pathogenesis of myelodysplastic syndromes: report of 2 new cases. Exp Mol Pathol. 2008 Apr;84(2):189-93

Alter BP, Caruso JP, Drachtman RA, Uchida T, Velagaleti GV, Elghetany MT. Fanconi anemia: myelodysplasia as a predictor of outcome. Cancer Genet Cytogenet. 2000 Mar;117(2):125-31

Hussein K, Van Dyke DL, Tefferi A. Conventional cytogenetics in myelofibrosis: literature review and discussion. Eur J Haematol. 2009 May;82(5):329-38

Wan TS, Ma SK, Au WY, Chan LC. Derivative (1;18)(q10;q10): a recurrent and novel unbalanced translocation involving 1q in myeloid disorders. Cancer Genet Cytogenet. 2001a Jul 1;128(1):35-8

Slovak ML, O'Donnell M, Smith DD, Gaal K. Does MDS with der(1;7)(q10;p10) constitute a distinct risk group? A retrospective single institutional analysis of clinical/pathologic features compared to -7/del(7q) MDS. Cancer Genet Cytogenet. 2009 Sep;193(2):78-85

Wan TS, Ma SK, Ho MY, Chan LC, Yip SF, Wong LG, Yeung YM. Cytogenetic biclonality in polycythemia vera: unusual and unrelated clones. Cancer Genet Cytogenet. 2001b Nov;131(1):86-9

Suh B, Park TS, Kim JS, Song J, Kim J, Yoo JH, Choi JR. Chronic myelomonocytic leukemia with der(9)t(1;9)(q11;q34) as a sole abnormality. Ann Clin Lab Sci. 2009 Summer;39(3):307-12

Tchinda J, Volpert S, Neumann T, Kennerknecht I, Ritter J, Büchner T, Berdel WE, Horst J. Novel der(1)t(1;19) in two patients with myeloid neoplasias. Cancer Genet Cytogenet. 2002 Feb;133(1):61-5

Azuma T, Yamanouchi J, Inoue K, Kohno M, Narumi H, Fujiwara H, Yakushijin Y, Hato T, Yasukawa M. Derivative (1;18)(q10;q10) in essential thrombocythemia. Cancer Genet Cytogenet. 2010 May;199(1):62-4

Andersen MK, Christiansen DH, Pedersen-Bjergaard J. Centromeric breakage and highly rearranged chromosome derivatives associated with mutations of TP53 are common in therapy-related MDS and AML after therapy with alkylating agents: an M-FISH study. Genes Chromosomes Cancer. 2005 Apr;42(4):358-71

Caramazza D, Hussein K, Siragusa S, Pardanani A, Knudson RA, Ketterling RP, Tefferi A. Chromosome 1 abnormalities in myeloid malignancies: a literature survey and karyotypephenotype associations. Eur J Haematol. 2010 Mar;84(3):191200

Dingli D, Grand FH, Mahaffey V, Spurbeck J, Ross FM, Watmore AE, Reilly JT, Cross NC, Dewald GW, Tefferi A. Der(6)t(1;6)(q21-23;p21.3): a specific cytogenetic abnormality in myelofibrosis with myeloid metaplasia. Br J Haematol. 2005 Jul;130(2):229-32

Lunghi M, Casorzo L, De Paoli L, Riccomagno P, Rossi D, Gaidano G. Derivative (1)t(1;16)(p11;p11.1) in myelodysplastic syndrome: a case report and review of the literature. Cancer Genet Cytogenet. 2010 Jan 1;196(1):89-92

Tanaka Y, Nagai Y, Mori M, Fujita H, Togami K, Kurata M, Matsushita A, Maeda A, Nagai K, Tanaka K, Takahashi T. Multiple granulocytic sarcomas in essential thrombocythemia. Int J Hematol. 2006 Dec;84(5):413-6

Duhoux FP, Ameye G, Lambot V, Herens C et al.. Refinement of 1p36 alterations not involving PRDM16 in myeloid and lymphoid malignancies. PLoS One. 2011;6(10):e26311

Bobadilla D, Enriquez EL, Alvarez G, Gaytan P, Smith D, Slovak ML. An interphase fluorescence in situ hybridisation assay for the detection of 3q26.2/EVI1 rearrangements in myeloid malignancies. Br J Haematol. 2007 Mar;136(6):806-13

Flach J, Dicker F, Schnittger S, Schindela S, Kohlmann A, Haferlach T, Kern W, Haferlach C. An accumulation of cytogenetic and molecular genetic events characterizes the progression from MDS to secondary AML: an analysis of 38 paired samples analyzed by cytogenetics, molecular mutation analysis and SNP microarray profiling. Leukemia. 2011 Apr;25(4):713-8

Noguchi M, Tashiro H, Shirasaki R, Gotoh M, Kawasugi K, Shirafuji N. Dual-specificity phosphatase 10 is fused to MDS1/EVI1-like gene 1 in a case of acute myelogenous leukemia with der1t1;1(p36.3;q21). Int J Hematol. 2007 Feb;85(2):175-6

Leon A, Staropoli JF, Hernandez JM, Longtine JA, Kuo FC, Dal Cin P. Translocation t(1;9) is a recurrent cytogenetic abnormality associated with progression of essential thrombocythemia patients displaying the JAK2 V617F mutation. Leuk Res. 2011 Sep;35(9):1188-92

Sanada M, Uike N, Ohyashiki K et al.. Unbalanced translocation der(1;7)(q10;p10) defines a unique clinicopathological subgroup of myeloid neoplasms. Leukemia. 2007 May;21(5):992-7

Fogu G, Campus PM, Cambosu F, Moro MA, Sanna R, Fozza C, Nieddu RM, Longinotti M, Montella A. Unbalanced 1q whole-arm translocation resulting in der(14)t(1;14)(q11-12;p11) in myelodysplastic syndrome. Cytogenet Genome Res. 2012;136(4):256-63

Douet-Guilbert N, Basinko A, Morel F, Le Bris MJ, Ugo V, Morice P, Berthou C, De Braekeleer M. Chromosome 20 deletions in myelodysplastic syndromes and Philadelphiachromosome-negative myeloproliferative disorders: characterization by molecular cytogenetics of commonly deleted and retained regions. Ann Hematol. 2008 Jul;87(7):537-44

Manabe M, Takeda O, Okita J, Takakuwa T et al.. A rare der(Y)t(Y;1)(q12;q12) in a patient with post-polycythemic myelofibrosis: a case report. Am J Blood Res. 2013;3(2):186-90

Gangat N, Strand J, Lasho TL, Finke CM et al.. Cytogenetic studies at diagnosis in polycythemia vera: clinical and JAK2V617F allele burden correlates. Eur J Haematol. 2008 Mar;80(3):197-200


This article should be referenced as such: Zamecnikova A, Al Bahar S. 1q translocations (unbalanced) in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):845-848.

848


OPEN ACCESS JOURNAL

Deep Insight Section Common fragile sites and genomic instability Yuri Pekarsky, Alessandra Drusco, Eugenio Gaudio, Carlo M Croce, Nicola Zanesi Department of Molecular Virology, Immunology, and Medical Genetics, The Ohio State University, Columbus, OH, USA (YP, AD, EG, CMC, NZ) Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Deep/CommFragSitesID20122.html DOI: 10.4267/2042/51877 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

induced by aphidicolin, an inhibitor of DNA synthesis that, by affecting DNA polymerases alpha, delta and epsilon, has been shown to activate most fragile sites (Mrasek et al., 2010), inducing gaps that are microscopically visible in metaphase chromosomes. At the molecular level, the phenomenon of common fragility on chromosomes is still not completely understood (Brueckner et al., 2012). The ATR DNA damage checkpoint pathway has been suggested to have an important role in maintaining the stability of CFSs since a deficiency of proteins associated with this pathway, like ATR, BRCA1, and CHK1, results in increased breakages of CFSs (Casper et al., 2002; Durkin et al., 2008). Moreover, CFSs fragility has been associated with late DNA replication (Debatisse et al., 2006) and histone hypoacetylation (Jiang et al., 2009). It has also been hypothesized that, following DNA replication stress CFSs instability derives from prolonged single-stranded regions of unreplicated DNA accumulating at stalled replication forks that escaped the ATR replication checkpoint (Brueckner et al., 2012). In fact, some aCFSs with delayed late replication due to aphidicolin treatment can enter G2 with only 50% of some aCFSs regions completely replicated (Pelliccia et al., 2008). DNA breakage within aCFSs is thought to derive from failing to complete replication prior to the end of telophase and chromosome segregation (Chan et al., 2009). It has been recently shown that the activity of topoisomerase I is necessary for CFSs fragility due to the requirement for polymerase - helicase uncoupling (Arlt and Glover, 2010). It has been suggested that impaired replication of such regions may be due to the formation of stable secondary structures in their DNA sequences (Burrow et al., 2010; Zlotorynski et al., 2003).

Keywords CFSs, common fragile sites, aphidicolin, genomic instability, FRA3B, FRA16D, CFS tumor suppressor genes

General features Specific alterations in the genome that modify the expression of genetic elements involved in the regulation of cell growth and maintenance of genomic integrity are responsible for driving tumorigenesis. These changes are not random, even though each tumor has a particular set of genome alterations. Typically, overexpression of oncogenes and inactivation of tumor suppressor genes occur often and are being extensively studied. Moreover, in malignant cells there is a group of genomic loci that is frequently unstable and contributes actively to tumorigenesis, the common fragile sites (CFSs) (Casper et al., 2012). These regions are non-random sites on chromosomes that under conditions of DNA replication stress, such as mild inhibition of DNA polymerase activity, form gaps and breaks (Glover et al., 1984). As signified by the "common" in their name, CFSs occur at specific chromosome bands of all humans and are a normal component of the chromosomal structure (Durkin et al., 2008). These loci are conserved in other mammals, including, but not limited to, primates and rodents (Fungtammasan et al., 2012). Endogenous and exogenous factors, such as hypoxia, chemotherapeutics and other pharmaceuticals, exposure to radiations, pesticides, cigarette smoke, caffeine and alcohol, may trigger activation of replication fork stress and DNA breaks at CFSs in vivo (Dillon et al., 2010). On the other hand, in vitro, a subset of CFSs (aCFSs) may be


849

Common fragile sites and genomic instability

Pekarsky Y, et al.

Table 1. Association of the best characterized common fragile sites with their chromosome regions and genes affected by their activity. Modified from Saxena, 2012.

mechanism that determines the placement of replication origins. This suggests that all the hypothesizing about the effect that specific sequences have in fragile regions may become questionable (Debatisse et al., 2012; Huebner, 2011; Letessier et al., 2011). While rare fragile sites are generally associated with a single DNA element, several sequence motifs spread along an aCFS locus may determine its fragility (Durkin et al., 2008; Ragland et al., 2008) thus making the characterization of aCFSs a computational challenge (Fungtammasan et al., 2012). However, previous analyses of single aCFSs showed that these loci are enriched in Alu repeats (Tsantoulis et al., 2008), gene-coding regions (Helmrich et al., 2006), histone hypoacetylation (Jiang et al., 2009), high DNA flexibility sequences, and highly AT-rich sequences (Mishmar et al., 1998). Nevertheless, these sequence characteristics seemed not to be associated with the propensity for DNA gaps, breaks, deletions and other genomic rearrangements at CFSs; for example, LINE1 elements are common in the fragile site FRA3B but quite rare in FRA16D, while Alu repeats are dominant in the latter (Ried et al., 2000). The organization of human chromosomes was traditionally investigated by a variety of banding methods (Comings, 1978). Yunis and Soreng observed that several types of fragile sites are more frequent in R bands that have a relatively high gene and CpG island density and correspond to early replicating genomic regions (Yunis and Soreng, 1984). Among different CFSs the level of fragility is variable and the most fragile and bestcharacterized CFS in the entire human genome is FRA3B at chromosome band 3p14.2 (Mrasek et al., 2010). The second and third most active CFSs are FRA16D and FRAXB respectively at 16q23.2 and Xp22.3. Generally, in somatic cells CFSs are stable but in many cancers they display frequent chromosomal aberrations. Lung, kidney, breast, and digestive tract malignancies are mainly where heterozygous and homozygous deletions are

Many of the CFS genomic loci have not yet been molecularly defined. Thus far, the relatively well characterized CFSs are the following: FRA1E, FRA2C, FRA2G, FRA3B, FRA7G, FRA9G, FRA13A, FRA16D, and FRAXB (Brueckner et al., 2012), summarized in Table 1, that are all AT-dinucleotide-rich sites spanning between 300 kb and 1 Mb (Schwartz et al., 2006). Unlike rare fragile sites, in which fragility is attributable to either CGG repeat expansions or ATrich minisatellites (Sutherland, 2003), in CFSs no such long repeat motifs have been found. However, the nine CFSs defined at molecular level seem to be characterized by segments of discontinuous AT-rich sequences potentially forming secondary structures able to affect replication fork progression and thus leading to chromosomal breakage (Dillon et al., 2010; Zlotorynski et al., 2003). Accordingly, it has been reported that specific DNA sequences, such as [A/T]n and [AT/TA]n repeats, and/or the formation of non-B DNA secondary structures within aCFSs can inhibit replicative DNA polymerases (Shah et al., 2010) and the progression of replication forks (Zhang and Freudenreich, 2007). Recently, scarcity of replication origins, inefficient origin initiation, and failure to activate latent origins have all been proposed to play a role in delayed replication at specific aCFSs (Letessier et al., 2011; Ozeri-Galai et al., 2011). The Debatisse Laboratory reported the most important new findings in the recent years, showing that CFSs differ in different tissue types and are caused by the paucity of replication origins within the regions - i.e. both FRA3B and FRA16D have replication origins flanking the fragile locus and must replicate the DNA from flanking sites to meet in the middle late S or in G2, in lymphocytes, but the placement of replication origins is different in fibroblasts and these loci are much less fragile in fibroblasts, while different loci are more fragile in fibroblasts. Obviously, this may apply to other tissue types too and shows that the position of fragile regions in specific tissues is due to an epigenetic


850


Pekarsky Y, et al.

identified as the most common genomic rearrangements in CFSs (Arlt et al., 2006). All CFSs investigated at molecular level up to now contain protein-coding genes, most of which extend over hundreds of kilobases of DNA (Smith et al., 2007). The FHIT and WWOX genes encompassing FRA3B and FRA16D, respectively, are both > 1 Mb in length and have been shown to exhibit tumor suppressor activity in vivo and in vitro (Drusco et al., 2011; Lewandowska et al., 2009; Saldivar et al., 2010). There are many reports of deletions within CFSs harboring these genes (McAvoy et al., 2007). Actually, the fact that very large genes present in mammalian genomes are preferentially affected by deletions in tumor cells suggests that these genes are all CFSs in the cell type in which they are expressed (Debatisse et al., 2012). Mitotic sister chromatid exchanges are often described at CFSs (Durkin et al., 2008), which suggests that CFS breaks may possibly drive loss of heterozygosity (LOH) in cancer cells when the repair occurs by homologous recombination. During neoplastic progression, damage at CFS regions seems to be among the earliest occurrences, mainly due to DNA replication stress (Halazonetis et al., 2008) as suggested by the presence of these genomic alterations in pre-neoplastic lesions (Lai et al., 2010). Oncogene amplification and preferred integration sites for some oncogenic viruses are also triggered by CFS activity (Brueckner et al., 2012). Germline genomic alterations in CFSs seem also to lead to other human illnesses of nonmalignant origin. In support of this possibility is the recent sequencing of breakpoint junctions in the CFS genes PARK2 at FRA6E and DMD at FRAXC in many patients affected, respectively, by juvenile Parkinsonism and muscular dystrophies (Mitsui et al., 2010). Somatic breakpoints in cancer cell lines and germline breakpoints within PARK2 and DMD shared some features that suggested involvement of common mechanisms in the generation of CFS rearrangements.

that take place within domains spatially and temporally separated (Wei et al., 1998). Usually transcription occurs in G1 phase and sometimes in S phase. When this happens, transcription is thought to be spatially separated from replication sites (Vieira et al., 2004). Gene expression induction in mammalian cells caused recombination processes within the transcription unit, thus suggesting that collisions between replication and transcription complexes provoke instability at the genomic level (Gottipati et al., 2008). Recently, Helmrich et al. demonstrated that the time required to transcribe human genes larger than 800 kb spans more than one complete cell cycle, while their transcription speed is equivalent to that of smaller genes. CFS instability depends on the expression of the underlying long genes and may be suppressed by RNase H1 enzyme when intervenes on R-loops, which are RNA:DNA hybrids between nascent transcripts and the DNA template strand, while the nontemplate strand remains as single-stranded DNA (Helmrich et al., 2011). The wealth of genome-wide profiling studies now available offers unique opportunities to study causes of genome instability in depth. Current evidence suggests that aCFSs are caused by a series of genomic factors (Dillon et al., 2010). Consequently, building a statistical model that takes into consideration multiple factors simultaneously is thought to be more biologically reliable on the contribution to fragility by the diverse genomic features. Moreover, studies usually do not incorporate in their models the different breakage frequencies of aCFSs. To better understand the relationship between aCFSs and their genomic contexts, Fungtammasan et al. built statistical models to explain the fragility of wellcharacterized aCFSs by considering their genomic neighborhoods and comparing them with non-fragile regions (NFRs) (Fungtammasan et al., 2012). The authors focused on aphidicolin-induced CFSs because they are well-characterized genomewide (Mrasek et al., 2010), are the most numerous CFSs, and fragile sites induced by other agents might have different breakage mechanisms and characteristics. Multiple logistic regression was used to predict the probability of a given region to be either an aCFS or an NFR and multiple linear regression for the prediction of expected breakage frequency. Eventually these models were validated using mouse fragile sites (Fungtammasan et al., 2012). Results showed that local genomic features are effective predictors both of regions harboring aCFSs, explaining circa 77% of the deviance in logistic regression models, and of aCFS breakage frequencies, explaining approximately 45% of the variance in standard regression models. In models with the highest explanatory power, aCFSs are mainly located in G-negative chromosomal bands and far from centromeres, are enriched in Alu repeats, and have high DNA flexibility. In addition, aCFSs have

Recent developments DNA replication and gene transcription are basic biological processes essential for cell division and growth. Large protein complexes moving at high speed along the chromosomes, and for long distances, make such processes possible. The RNA polymerase II (Pol II) enzyme, in mammalian cells, transcribes 18-72 nucleotides of DNA per second into RNA (Darzacq et al., 2007). One of the longest human loci, the 2.2 Mb dystrophin gene, is transcribed over a period of 16 hours (Tennyson et al., 1995) and similar figures are reported for other long genes. As for typical fastcycling mammalian cells the cell cycle time is approximately 10 hours, it is expected that these longterm transcription cycles interfere with replication in cell cycle S phase. Unlike in bacteria, transcription and replication in higher eukaryotes are coordinated events


851


Pekarsky Y, et al.

Fhit+/+ cells (Turner et al., 2002), and the frequency of mutations following replicative and oxidative stress in Fhit-deficient cells was 2 to 5-fold greater than in Fhit-expressing cells (Ishii et al., 2008; Ottey et al., 2004). Despite these findings and strong evidence that Fhit acts as a tumor suppressor (Joannes et al., 2010; Pekarsky et al., 1998; Siprashvili et al., 1997) it has been proposed that deletions within the FHIT locus are secondary alterations rather than cancer-driving mutations (Bignell et al., 2010). In a new study, Kay Huebner and colleagues (Saldivar et al., 2012) examined further the role of Fhit loss in DNA damage process. Specifically, it has been shown that Fhit loss causes replication stress-induced DNA double-strand breaks in normal, transformed, and cancer-derived cell lines. In Fhit-deficient cells, a defect was observed in replication fork progression that stemmed mainly from fork stalling and collapse. The possible mechanism for the role of Fhit in replication fork progression is by regulation of thymidine kinase 1 expression and thymidine triphosphate pool levels. Interestingly, restoration of nucleotide balance rescued DNA replication defects and suppressed DNA breakage in Fhit-deficient cells. Loss of Fhit did not activate the DNA damage response nor cause cell cycle arrest, allowing continued cell proliferation and ongoing chromosome instability. Such a result was consistent with in vivo studies, where Fhit knockout mouse tissues showed no evidence of cell cycle arrest or senescence yet exhibited numerous somatic DNA copy number aberrations at replication-sensitive loci. Moreover, cells established from Fhit KO tissues showed rapid immortalization together with DNA deletions and amplifications. Of note, the murine gene Mdm2, an oncogene involved in cell transformation, was also amplified with 4-fold increase in Mdm2 mRNA expression, suggesting that genome instability induced by FHIT depletion facilitates the transformation process. In conclusion, this study proposes that Fhit depletion in precancerous lesions is the first step in the initiation of genomic instability and links alterations at CFSs to the very origin of this important phenomenon (Saldivar et al., 2012). To conclude this short panoramic on CFSs and genomic instability, we would like to draw the reader's attention to the most recent findings about Polζ polymerase. Polζ, which consists of the catalytic subunit Rev3 and the accessory subunit Rev7, is a trans-lesion DNA synthesis (TLS) polymerase capable of bypassing certain DNA adducts efficiently (Gibbs et al., 1998). Besides its role in TLS, Rev3 is also essential for mouse embryonic development (Bemark et al., 2000), whereas no other TLS polymerases studied to date are required for this fundamental function. Rev3 has been also implicated in homologous recombination repair (Sharma et al., 2012). Because of its extremely large size (>350 kDa), little progress has been made in understanding the essential function of Rev3. Bhat et

high fragility when co-located with evolutionarily conserved chromosomal breakpoints (Fungtammasan et al., 2012). In order to investigate the mechanisms of CFS-induced breaks, Casper et al. asked whether the flexibility peaks that have been identified within human CFS FRA3B are hotspots of instability (Casper et al., 2012). These authors, to analyze the consequences of CFS breaks, also investigated whether repair of fragile site breaks drives LOH events due to mitotic homologous recombination. To gather detailed data on exact break locations within CFSs, a yeast artificial chromosome (YAC) containing the human locus FRA3B was used. Data suggested that break sites are not randomly distributed, but rather clustered at the centromere-distal end of the FRA3B sequence insert. They also took advantage of a naturally occurring yeast fragile site known as FS2 (fragile site 2) to study mitotic homologous recombination. Similar to human CFSs, recurrent breaks at FS2 occur where replication is impaired because of stressful conditions (Lemoine et al., 2005). Results demonstrated that LOH is, in fact, a consequence of mitotic recombination between homologous chromatids with reciprocal crossovers at FS2 induced by inhibition of yeast DNA polymerase (Casper et al., 2012). Since not many CFSs have been molecularly characterized, despite the growing interest in understanding the precise nature of CFS instability, Brueckner et al. took into consideration the FRA2H CFS and after having fine-mapped the location with six-color fluorescence in situ hybridization, demonstrated that it is one of the most active CFSs in the human genome (Brueckner et al., 2012). FRA2H encompasses approximately 530 kb of a gene-poor region containing a novel large inter-genic non coding RNA gene (AC097500.2). Using custom-designed array comparative genomic hybridization, gross and submicroscopic chromosomal rearrangements were detected, involving FRA2H in a panel of 54 neuroblastoma, colon, and breast cancer cell lines. Genomic alterations often affected different classes of long terminal repeats (LTRs) and long interspersed nuclear elements (LINEs). Sequence analysis of breakpoint junctions revealed that DNA damage repair at FRA2H mostly appeared to occur via nonhomologous end-joining events mediated by short micro-homologies (Brueckner et al., 2012). Deletions at FRA3B CFS occur in pre-neoplasias and may be the most frequent and earliest alterations. FRA3B overlaps the FHIT gene, and its fragility frequently results in deletions of FHIT exons and loss of FHIT expression in precancerous and cancer cells (Sozzi et al., 1998). Examination of cells that have lost FHIT revealed that the protein has some functional roles in response to DNA damage (Saldivar et al., 2010). In particular, kidney epithelial cells established from Fhit-/- mice exhibited >2-fold increased chromosome breaks at fragile sites vs. corresponding


852


Pekarsky Y, et al.

CM, Pilotti S. Loss of FHIT function in lung cancer and preinvasive bronchial lesions. Cancer Res. 1998 Nov 15;58(22):5032-7

al. found that the cellular level of Rev3 is elevated in mitotic cells, and the protein is associated with chromatin. Experimental depletion of Rev3 results in elevated CFS expression and chromosomal instability, indicating that Rev3 is required for the late replication of these sites. Rev3 activity is independent of Rev7, as the depletion of cellular Rev7 does not cause CFS expression. Moreover, constitutive depletion of Rev3 in cultured human cells resulted in accumulated genomic instability and eventual arrest of cell division, suggesting that Rev3 is required not only for embryonic development but also for cell viability (Bhat et al., 2013). Interestingly, comparison of yeast and mammalian Rev3 proteins reveals a large exon that is unique to the mammalian gene that will surely be subjected to future investigations for its role in the maintenance of mitotic genomic stability.

Wei X, Samarabandu J, Devdhar RS, Siegel AJ, Acharya R, Berezney R. Segregation of transcription and replication sites into higher order domains. Science. 1998 Sep 4;281(5382):1502-6 Bemark M, Khamlichi AA, Davies SL, Neuberger MS. Disruption of mouse polymerase zeta (Rev3) leads to embryonic lethality and impairs blastocyst development in vitro. Curr Biol. 2000 Oct 5;10(19):1213-6 Ried K, Finnis M, Hobson L, Mangelsdorf M, Dayan S, Nancarrow JK, Woollatt E, Kremmidiotis G, Gardner A, Venter D, Baker E, Richards RI. Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells. Hum Mol Genet. 2000 Jul 1;9(11):1651-63 Casper AM, Nghiem P, Arlt MF, Glover TW. ATR regulates fragile site stability. Cell. 2002 Dec 13;111(6):779-89

Acknowledgements

Turner BC, Ottey M, Zimonjic DB, Potoczek M, Hauck WW, Pequignot E, Keck-Waggoner CL, Sevignani C, Aldaz CM, McCue PA, Palazzo J, Huebner K, Popescu NC. The fragile histidine triad/common chromosome fragile site 3B locus and repair-deficient cancers. Cancer Res. 2002 Jul 15;62(14):405460

We thank Dr. Kay Huebner for critical reading of the manuscript and Prasanthi Kumchala for technical assistance. This work was supported by NIH grant U01CA152758 (to CMC).

References

Sutherland GR. Rare fragile sites. Cytogenet Genome Res. 2003;100(1-4):77-84

Comings DE. Mechanisms of chromosome banding and implications for chromosome structure. Annu Rev Genet. 1978;12:25-46

Zlotorynski E, Rahat A, Skaug J, Ben-Porat N, Ozeri E, Hershberg R, Levi A, Scherer SW, Margalit H, Kerem B. Molecular basis for expression of common and rare fragile sites. Mol Cell Biol. 2003 Oct;23(20):7143-51

Glover TW, Berger C, Coyle J, Echo B. DNA polymerase alpha inhibition by aphidicolin induces gaps and breaks at common fragile sites in human chromosomes. Hum Genet. 1984;67(2):136-42

Ottey M, Han SY, Druck T, Barnoski BL, McCorkell KA, Croce CM, Raventos-Suarez C, Fairchild CR, Wang Y, Huebner K. Fhit-deficient normal and cancer cells are mitomycin C and UVC resistant. Br J Cancer. 2004 Nov 1;91(9):1669-77

Yunis JJ, Soreng AL. Constitutive fragile sites and cancer. Science. 1984 Dec 7;226(4679):1199-204 Tennyson CN, Klamut HJ, Worton RG. The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nat Genet. 1995 Feb;9(2):184-90

Vieira KF, Levings PP, Hill MA, Crusselle VJ, Kang SH, Engel JD, Bungert J. Recruitment of transcription complexes to the beta-globin gene locus in vivo and in vitro. J Biol Chem. 2004 Nov 26;279(48):50350-7

Siprashvili Z, Sozzi G, Barnes LD, McCue P, Robinson AK, Eryomin V, Sard L, Tagliabue E, Greco A, Fusetti L, Schwartz G, Pierotti MA, Croce CM, Huebner K. Replacement of Fhit in cancer cells suppresses tumorigenicity. Proc Natl Acad Sci U S A. 1997 Dec 9;94(25):13771-6

Lemoine FJ, Degtyareva NP, Lobachev K, Petes TD. Chromosomal translocations in yeast induced by low levels of DNA polymerase a model for chromosome fragile sites. Cell. 2005 Mar 11;120(5):587-98 Arlt MF, Durkin SG, Ragland RL, Glover TW. Common fragile sites as targets for chromosome rearrangements. DNA Repair (Amst). 2006 Sep 8;5(9-10):1126-35

Gibbs PE, McGregor WG, Maher VM, Nisson P, Lawrence CW. A human homolog of the Saccharomyces cerevisiae REV3 gene, which encodes the catalytic subunit of DNA polymerase zeta. Proc Natl Acad Sci U S A. 1998 Jun 9;95(12):6876-80

Debatisse M, El Achkar E, Dutrillaux B. Common fragile sites nested at the interfaces of early and late-replicating chromosome bands: cis acting components of the G2/M checkpoint? Cell Cycle. 2006 Mar;5(6):578-81

Mishmar D, Rahat A, Scherer SW, Nyakatura G, Hinzmann B, Kohwi Y, Mandel-Gutfroind Y, Lee JR, Drescher B, Sas DE, Margalit H, Platzer M, Weiss A, Tsui LC, Rosenthal A, Kerem B. Molecular characterization of a common fragile site (FRA7H) on human chromosome 7 by the cloning of a simian virus 40 integration site. Proc Natl Acad Sci U S A. 1998 Jul 7;95(14):8141-6

Helmrich A, Stout-Weider K, Hermann K, Schrock E, Heiden T. Common fragile sites are conserved features of human and mouse chromosomes and relate to large active genes. Genome Res. 2006 Oct;16(10):1222-30 Schwartz M, Zlotorynski E, Kerem B. The molecular basis of common and rare fragile sites. Cancer Lett. 2006 Jan 28;232(1):13-26

Pekarsky Y, Druck T, Cotticelli MG, Ohta M, Shou J, Mendrola J, Montgomery JC, Buchberg AM, Siracusa LD, Manenti G, Fong LY, Dragani TA, Croce CM, Huebner K. The murine Fhit locus: isolation, characterization, and expression in normal and tumor cells. Cancer Res. 1998 Aug 1;58(15):3401-8

Darzacq X, Shav-Tal Y, de Turris V, Brody Y, Shenoy SM, Phair RD, Singer RH. In vivo dynamics of RNA polymerase II transcription. Nat Struct Mol Biol. 2007 Sep;14(9):796-806

Sozzi G, Pastorino U, Moiraghi L, Tagliabue E, Pezzella F, Ghirelli C, Tornielli S, Sard L, Huebner K, Pierotti MA, Croce


McAvoy S, Ganapathiraju SC, Ducharme-Smith AL, Pritchett JR, Kosari F, Perez DS, Zhu Y, James CD, Smith DI. Non-

853


Pekarsky Y, et al.

random inactivation of large common fragile site genes in different cancers. Cytogenet Genome Res. 2007;118(2-4):260-9

Joannes A, Bonnomet A, Bindels S, Polette M, Gilles C, Burlet H, Cutrona J, Zahm JM, Birembaut P, Nawrocki-Raby B. Fhit regulates invasion of lung tumor cells. Oncogene. 2010 Feb 25;29(8):1203-13

Smith DI, McAvoy S, Zhu Y, Perez DS. Large common fragile site genes and cancer. Semin Cancer Biol. 2007 Feb;17(1):31-41

Lai LA, Kostadinov R, Barrett MT, Peiffer DA, Pokholok D, Odze R, Sanchez CA, Maley CC, Reid BJ, Gunderson KL, Rabinovitch PS. Deletion at fragile sites is a common and early event in Barrett's esophagus. Mol Cancer Res. 2010 Aug;8(8):1084-94

Zhang H, Freudenreich CH. An AT-rich sequence in human common fragile site FRA16D causes fork stalling and chromosome breakage in S. cerevisiae. Mol Cell. 2007 Aug 3;27(3):367-79 Durkin SG, Ragland RL, Arlt MF, Mulle JG, Warren ST, Glover TW. Replication stress induces tumor-like microdeletions in FHIT/FRA3B. Proc Natl Acad Sci U S A. 2008 Jan 8;105(1):246-51

Mitsui J, Takahashi Y, Goto J, Tomiyama H, Ishikawa S, Yoshino H, Minami N, Smith DI, Lesage S, Aburatani H, Nishino I, Brice A, Hattori N, Tsuji S. Mechanisms of genomic instabilities underlying two common fragile-site-associated loci, PARK2 and DMD, in germ cell and cancer cell lines. Am J Hum Genet. 2010 Jul 9;87(1):75-89

Gottipati P, Cassel TN, Savolainen L, Helleday T. Transcription-associated recombination is dependent on replication in Mammalian cells. Mol Cell Biol. 2008 Jan;28(1):154-64

Mrasek K, Schoder C, Teichmann AC, Behr K, Franze B, Wilhelm K, Blaurock N, Claussen U, Liehr T, Weise A. Global screening and extended nomenclature for 230 aphidicolininducible fragile sites, including 61 yet unreported ones. Int J Oncol. 2010 Apr;36(4):929-40

Halazonetis TD, Gorgoulis VG, Bartek J. An oncogene-induced DNA damage model for cancer development. Science. 2008 Mar 7;319(5868):1352-5

Saldivar JC, Shibata H, Huebner K. Pathology and biology associated with the fragile FHIT gene and gene product. J Cell Biochem. 2010 Apr 1;109(5):858-65

Ishii H, Mimori K, Ishikawa K, Okumura H, Pichiorri F, Druck T, Inoue H, Vecchione A, Saito T, Mori M, Huebner K. Fhitdeficient hematopoietic stem cells survive hydroquinone exposure carrying precancerous changes. Cancer Res. 2008 May 15;68(10):3662-70 Pelliccia F, Bosco N, Curatolo A, Rocchi A. Replication timing of two human common fragile sites: FRA1H and FRA2G. Cytogenet Genome Res. 2008;121(3-4):196-200

Shah SN, Opresko PL, Meng X, Lee MY, Eckert KA. DNA structure and the Werner protein modulate human DNA polymerase delta-dependent replication dynamics within the common fragile site FRA16D. Nucleic Acids Res. 2010 Mar;38(4):1149-62

Ragland RL, Glynn MW, Arlt MF, Glover TW. Stably transfected common fragile site sequences exhibit instability at ectopic sites. Genes Chromosomes Cancer. 2008 Oct;47(10):860-72

Drusco A, Pekarsky Y, Costinean S, Antenucci A, Conti L, Volinia S, Aqeilan RI, Huebner K, Zanesi N. Common fragile site tumor suppressor genes and corresponding mouse models of cancer. J Biomed Biotechnol. 2011;2011:984505

Tsantoulis PK, Kotsinas A, Sfikakis PP, Evangelou K, Sideridou M, Levy B, Mo L, Kittas C, Wu XR, Papavassiliou AG, Gorgoulis VG. Oncogene-induced replication stress preferentially targets common fragile sites in preneoplastic lesions. A genome-wide study. Oncogene. 2008 May 22;27(23):3256-64

Helmrich A, Ballarino M, Tora L. Collisions between replication and transcription complexes cause common fragile site instability at the longest human genes. Mol Cell. 2011 Dec 23;44(6):966-77

Chan KL, Palmai-Pallag T, Ying S, Hickson ID. Replication stress induces sister-chromatid bridging at fragile site loci in mitosis. Nat Cell Biol. 2009 Jun;11(6):753-60

Letessier A, Millot GA, Koundrioukoff S, Lachagès AM, Vogt N, Hansen RS, Malfoy B, Brison O, Debatisse M. Cell-typespecific replication initiation programs set fragility of the FRA3B fragile site. Nature. 2011 Feb 3;470(7332):120-3

Huebner K. Molecular biology: DNA fragility put into context. Nature. 2011 Feb 3;470(7332):46-7

Jiang Y, Lucas I, Young DJ, Davis EM, Karrison T, Rest JS, Le Beau MM. Common fragile sites are characterized by histone hypoacetylation. Hum Mol Genet. 2009 Dec 1;18(23):4501-12

Ozeri-Galai E, Lebofsky R, Rahat A, Bester AC, Bensimon A, Kerem B. Failure of origin activation in response to fork stalling leads to chromosomal instability at fragile sites. Mol Cell. 2011 Jul 8;43(1):122-31

Lewandowska U, Zelazowski M, Seta K, Byczewska M, Pluciennik E, Bednarek AK. WWOX, the tumour suppressor gene affected in multiple cancers. J Physiol Pharmacol. 2009 May;60 Suppl 1:47-56

Brueckner LM, Sagulenko E, Hess EM, Zheglo D, Blumrich A, Schwab M, Savelyeva L. Genomic rearrangements at the FRA2H common fragile site frequently involve nonhomologous recombination events across LTR and L1(LINE) repeats. Hum Genet. 2012 Aug;131(8):1345-59

Arlt MF, Glover TW. Inhibition of topoisomerase I prevents chromosome breakage at common fragile sites. DNA Repair (Amst). 2010 Jun 4;9(6):678-89

Casper AM, Rosen DM, Rajula KD. Sites of genetic instability in mitosis and cancer. Ann N Y Acad Sci. 2012 Sep;1267:24-30

Bignell GR, Greenman CD, Davies H, Butler AP, Edkins S, Andrews JM, Buck G, Chen L, Beare D, Latimer C, Widaa S, Hinton J, Fahey C, Fu B, Swamy S, Dalgliesh GL, Teh BT, Deloukas P, Yang F, Campbell PJ, Futreal PA, Stratton MR. Signatures of mutation and selection in the cancer genome. Nature. 2010 Feb 18;463(7283):893-8

Debatisse M, Le Tallec B, Letessier A, Dutrillaux B, Brison O. Common fragile sites: mechanisms of instability revisited. Trends Genet. 2012 Jan;28(1):22-32 Fungtammasan A, Walsh E, Chiaromonte F, Eckert KA, Makova KD. A genome-wide analysis of common fragile sites: what features determine chromosomal instability in the human genome? Genome Res. 2012 Jun;22(6):993-1005

Burrow AA, Marullo A, Holder LR, Wang YH. Secondary structure formation and DNA instability at fragile site FRA16B. Nucleic Acids Res. 2010 May;38(9):2865-77 Dillon LW, Burrow AA, Wang YH. DNA instability at chromosomal fragile sites in cancer. Curr Genomics. 2010 Aug;11(5):326-37


Saldivar JC, Miuma S, Bene J, Hosseini SA, Shibata H, Sun J, Wheeler LJ, Mathews CK, Huebner K. Initiation of genome instability and preneoplastic processes through loss of Fhit expression. PLoS Genet. 2012;8(11):e1003077

854


Pekarsky Y, et al.

Saxena AK. Are fragile sites "hot-spots": a causative factor in tumor biology. J Exp Ther Oncol. 2012;10(1):19-29

Bhat A, Andersen PL, Qin Z, Xiao W. Rev3, the catalytic subunit of Polζ, is required for maintaining fragile site stability in human cells. Nucleic Acids Res. 2013 Feb 1;41(4):2328-39

Sharma S, Hicks JK, Chute CL, Brennan JR, Ahn JY, Glover TW, Canman CE. REV1 and polymerase ζ facilitate homologous recombination repair. Nucleic Acids Res. 2012 Jan;40(2):682-91


This article should be referenced as such: Pekarsky Y, Drusco A, Gaudio E, Croce CM, Zanesi N. Common fragile sites and genomic instability. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):849-855.

855


OPEN ACCESS JOURNAL

Deep Insight Section Inflammatory programming and immune modulation in cancer by IDO Courtney Smith, George C Prendergast Lankenau Institute for Medical Research (LIMR), Wynnewood PA USA (CS), Department of Pathology, Anatomy and Cell Biology, Jefferson Medical School and Kimmel Cancer Center, Thomas Jefferson University, Philadelphia PA USA (GCP) Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Deep/IDOandCancerID20121.html DOI: 10.4267/2042/51878 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Immune dysregulation is one of the hallmarks of tumor growth and progression, a key event that allows for tumor evasion of the host immune system. More recent cancer modalities are embracing combinations incorporating immunotherapy with more traditional chemotherapy and radiotherapy. Traditional approaches are difficult to tolerate for the patient and become less effective as tumors evolve to survive these treatments. Immunotherapy has the benefit of reduced toxicity as it utilizes the patient's own immune system to identify and eliminate tumor cells. One mechanism manipulated by tumors is upregulation of the immunoregulatory enzyme indoleamine 2,3-dioxygenase (IDO). In this review, we focus on the mechanism by which tumors use IDO to evade detection by T cell immunity, as well as on novel small molecules that inhibit it as a cancer therapeutic strategy. IDO1 is found in various cells including immune cells, endothelial cells, fibroblast and some tumor cells (Serafini, et al., 2006; Friberg et al., 2002; Uyttenhove et al., 2003; Munn et al., 2004). IDO1 is relatively well conserved between species suggesting evolutionary importance. The primary sequence of IDO1 is 63% identical between mouse and human. The crystal structure of IDO1 and the resulting site-directed mutagenesis show that both substrate binding and the precise relationship between the substrate and iron-bound dioxygen are necessary for activity (Sugimoto et al., 2006). More recently, a homolog to IDO1, termed IDO2, has been identified. Initially, a missannotation in the human genome database prevented the identification of IDO2. The correction of this error revealed the 420 amino acid open-reading frame that shares 44% sequence homology with IDO1 (Ball et al., 2007; Metz et al., 2007). Importantly, IDO2 contains the conserved residues that are identified as critical for tryptophan binding and catabolism (Sugimoto et al., 2006). Between mouse and human, IDO2 is 73% identical at the primary sequence. Due to the recent discovery of IDO2, there is still much to learn about this enzyme. While both human and murine IDO2 enzyme have been

Diversity of IDO-related immunoregulatory enzymes Identification of the non-hepatic tryptophan catabolizing enzyme, indoleamine 2,3-deoxygenase (IDO; EC 1.13.11.42; originally D-tryptophan pyrrolase) was first reported in 1963 (Higuchi and Hayaishi, 1967; Higuchi et al., 1963). IDO, also known as IDO1, catalyzes the first and rate-limiting step that converts tryptophan to N-formyl-kynurenine, a process that utilizes oxidative cleavage of the 2,3 double bond in the indole ring resulting in the biosynthesis of nicotinamide adenine dinucleotide (NAD) (Takikawa, 2005). The catabolism of tryptophan can also occur through the enzyme tryptophan 2,3-dioxygenase (TDO2), though studies have shown that the enzymes are not redundant. While both IDO1 and TDO2 catalyze this same reaction, beyond that the two enzymes are structurally distinct and do not share any significant sequence similarity. Structurally, IDO1 exists as a 41kD monomeric enzyme whereas TDO2 is a 320kD homotetramer (Watanabe et al., 1981). Furthermore, TDO2 and IDO1 are differentially localized. Unlike TDO2, IDO1 is not involved in the dietary homeostasis of tryptophan degradation. Instead


856

Inflammatory programming and immune modulation in cancer by IDO

regulates immunity at the level of T cells but is regulated by or and regulated by cytokine production in the host that is associated with the generation of a protumorigenic microenvironment. A role for IDO1 in cancer is further suggested by the fact that many human tumor cells themselves express IDO1 (Uyttenhove et al., 2003; Taylor and Feng, 1991).

shown to catabolize tryptophan to kynurenine, IDO2 has a distinct pattern of expression that differs from both IDO1 and TDO2 (Metz et al., 2012). Using total RNAs from human tissues, full-length IDO2 was found expressed in the placenta and brain. Interestingly, primers located in exon 10 showed IDO2 mRNA in a greater number of tissues including liver, small intestine, spleen, placental, thymus, lung, brain, kidney and colon supporting the possible existence of additional splice isoforms and perhaps transcriptional start or polyadenylation sites. To further complicate its study, transcripts of IDO2 in murine tissues are localized to liver and kidney which differs from human tissues somewhat. Interestingly, IDO2 mRNA is expressed in murine pre-dendritic cells and following stimulation with IFNγ, IL-10 or lipopolysaccharide (LPS), IDO2 protein can be detected (Metz et al., 2012), suggesting in these specialized antigenpresenting cells of the immune system.

IDO in cancer Treatment of cancer commonly entails surgical resection followed by chemotherapy and radiotherapy. The standard regimens show highly variable degrees of success in the longer term, because of the ability of tumor cells to escape these treatments to regenerate primary tumor growth and more importantly seed distant metastasis. The production of IDO in the tumor microenvironment appears to aid in tumor growth and metastasis. It is logical then to target IDO as a means of slowing tumor progression. This has been the premise of several recent studies. Studies have revealed a pathophysiological link between IDO1 and cancer, with increased levels of IDO1 activity associated with a variety of different tumors (Brandacher et al., 2006; Okamoto et al., 2005). In a case study of ovarian cancer, overexpression of IDO correlated with poorer survival. Immunohistochemical staining on tumor sections were categorized as negative or positive, with the latter further defined as sporadic, focal or diffusely staining. While patients with no IDO expression had greater than 5-year survival following surgery, the three subcategories of positive IDO staining showed a 50% survival of patients to 41, 17 and 11 months, inversely correlated with the amount of staining (Okamoto et al., 2005). Two mechanisms by which IDO suppresses the local immune system are inhibition of effector T cells or activation of Tregs (Fallarino et al., 2006; Munn and Mellor, 2007). In the colorectal study, high IDO expression was associated with few tumor infiltrating CD3+ T cells. In addition to affecting the local environment, tumor biopsies with high expression of IDO in both colorectal and hepatocellular carcinomas have shown greater metastasis in patients (Brandacher et al., 2006; Pan et al., 2008). While these studies showed IDO expressed by the tumor itself, other clinical studies have found both stromal cells and surrounding immune cells to be the source of IDO overexpression. Poor survival correlated with IDOpositive eosinophils in small cell lung cancer (Astigiano et al., 2005) while a study of melanoma patients showed poor prognosis in patients with detectable IDO in the dendritic cells (DC) from the tumor draining lymph nodes (Lee et al., 2003; Munn et al., 2004). These clinical cancer studies are supported and enhanced by studies in the mouse model. As shown in the clinical studies, tumors may induce IDO1 production in neighboring cells such as antigen presenting dendritic cells located in the tumor-draining

IDO in the immune system The first evidence for a role of IDO in immune regulation was observed when IDO expression was induced following viral infection or treatment with interferon (IFNγ), an important inflammatory cytokine (Yoshida et al., 1979; Yoshida et al., 1981). A prior observation that IDO is present in the urine of cancer patients then re-surfaced and its importance reevaluated (Rose, 1967). A groundbreaking study from Munn and Mellor in 1999 directly established IDO as an important immune regulator (Munn et al., 1998). This study showed that pregnant female mice treated with 1-methyl-tryptophan (1MT), an IDO inhibitor, caused rejection of allogeneic concepti but not syngeneic concepti. Further studies showed that this occurs through an MHC-restricted T cell-mediated rejection of the allogeneic mouse concepti (Mellor et al., 2001). These findings have been widely interpreted to mean that the normally high levels of IDO in the placenta are important in preventing the maternal immune system from attacking the "foreign" fetus. Once IDO was established as an immune modulator, studies have focused on its role both in disease states as well as in normal immune surveillance. The immunosuppressive function of IDO1 manifests in several manners. Collectively, IDO1 and its metabolites can directly suppress T cells (Fallarino et al., 2002; Frumento et al., 2002; Terness et al., 2002; Weber et al., 2006) and NK cells (Della Chiesa et al., 2006) as well as enhance local Tregs (Fallarino et al., 2003). The protumorigenic capabilities of myeloid derived suppressor cells (MDSCs) (Smith et al., 2012) suggest that this population is also affected by IDO1. Furthermore, IDO1 is produced in response to IFN-γ in endothelial cells, fibroblasts and the immune cells including dendritic cells and myeloid derived cells (Taylor and Feng, 1991; Burke et al., 1995; Varga et al., 1996; Munn et al., 1999; Hwu et al., 2000). It has therefore been hypothesized that IDO1 not only


Smith C, Prendergast GC

857


mimicking the effects of Bin1 attenuation in human tumor cells. Notably, the beneficial effects of Bin1 deletion to tumor growth were lost in immune deficient or T-cell depleted mice, revealing the importance of the immune system in mediating the primary effects of Bin1 on tumor growth. Studies in Bin1-deficient cells established that IDO expression was upregulated and that the inhibitor 1MT could phenocopy the effect of Bin1 competency. This work also indicated that Bin1 limits IDO transcription by limiting the activity of NFκB and STAT which are sufficient to support IDO expression (Muller et al., 2004; Bild et al., 2002). GCN2 signaling is another mechanism by which IDO may regulate immune cell function. GCN2 is a kinase that acts as a sensor for amino acid starvation. The depletion of tryptophan from the microenvironment can trip GCN2 signaling resulting in apoptosis, cell cycle arrest and differentiation. GCN2 rapidly responds to amino acid deprivation through the phosphorylation of eIF-2α resulting in inhibition of translation (Bild et al., 2006). GCN2 is activated by IDO as a result of the tryptophan deprivation it creates. GCN2 is also a signaling component of T cells which may be a mechanism by which IDO regulates the immune system and produces biological effects. Notably, GCN2-deficient T cells are resistant to the immune suppressive effects of IDO (Munn and Mellor, 2007; Munn et al., 2005). GCN2 signaling switches on the expression of stress-activated proteins that trigger growth arrest and apoptosis as well as differentiation. ATF4, ATF3 and CHOP/GADD153 (Harding et al., 2000; Jiang et al., 2004; Vattem and Wek, 2004; Lu et al., 2004; Hai et al., 1999; Wang et al., 1996; Fan et al.,2002) have been implicated as three critical targets of GCN2 in responding to amino acid deprivation. Cytokines are critical for immune recognition of tumor cells, but when they are hijacked by the tumor they may provide a mechanism of immune escape for both the primary tumor and distant metastases. This was seen in Ido1-nullizygous mice that exhibited both reduced lung tumor burden in the oncogenic KRASinduced model as well as in the metastatic 4T1 orthotopic breast cancer model. Both models showed reduction of lung tumor burden that was directly correlated with improved survival of Ido1-/- mice (Smith et al., 2012). Further investigation into the immune regulatory role revealed a reduction in the levels of the inflammatory cytokine IL-6 in IDOdeficient mice. However, when IL-6 was restored in these mice, the rate of metastasis was also restored to levels of wild-type mice. Ex vivo studies of myeloid derived suppressor cells (MDSC) from IDO-deficient mice with 4T1 primary tumors showed an impairment in the ability of MDSC to suppress T cell function, compared to MDSC derived from 4T1 tumor-bearing wild-type mice. The attenuation of IL-6 levels in IDOdeficient mice was associated with an impairment in MDSC function, and as before restoring IL-6 overcame the MDSC defect, allowed metastatic disease to

lymph nodes (TDLNs). 4T1 is a highly malignant breast carcinoma-derived cell line that, following orthotopic engraftment into the murine mammary fatpad, forms tumors of the latter variety in which no IDO1 expression is detectable in the primary tumor but is found expressed at high levels in the TDLNs. The IDO1-expressing cells in the TDLNs appear morphologically to be plasmacytoid dendritic cells. A similar pattern of IDO1 expression has previously been observed in a mouse model of melanoma (Munn et al., 2004). Importantly D-1MT treatment of 4T1-tumor bearing mice cooperated with chemotherapy to suppress primary tumor growth, ascribing an immunosuppressive role of IDO1 in the TDLNs (Hou et al., 2007). The use of an immunogenic tumor cell line transfected to overexpress IDO demonstrated that IDO prevents immune surveillance from rejecting these tumors in preimmunized mice. There was also a reduction in tumor associated T cells. Furthermore the use of 1MT resulted in a slowed progression of the tumor, further implicating IDO as a tumor evasion mechanism (Uyttenhove et al., 2003). In the MMTV-neu mouse model of breast cancer, the synergistic benefit of combining chemotherapy with the indoleamine-2,3dioxygenase (IDO1) inhibitor 1-methyl-D-tryptophan was observed (Muller et al., 2005). It was shown that the effects of D-1MT were greatly enhanced when given in conjunction with the commonly used chemotherapeutic agent paclitaxel. Depletion of either CD4+ or CD8+ T-cells in these mice abolished the benefit provided by D-1MT, indicating the importance of T cell immunity to the antitumor response. These studies have all led to the initiation of phase I clinical trials testing the efficacy of 1-MT as a cancer vaccine adjuvant.

Signaling mechanisms upstream and downstream of IDO The NF-κB signaling pathway has been implicated in IDO1 signaling through the initial observation that INDO can be induced by interferon-γ (IFN-γ) treatment (Ozaki et al., 1988). A more detailed report showed that BAR adapter proteins encoded by the Bin1 gene are important mediators of NF-κB signaling to IDO. Bin1 is a suppressor of tumor growth that is poorly expressed in tumor cells (Ge et al., 1999; Ge et al., 2000; Tajiri et al., 2003). Using a knockout mouse for Bin1 it was shown that there was an increase in STAT1 and NF-κB signaling leading to increased IDO (Muller et al., 2005; Muller et al., 2004). This suggested that under normal conditions, Bin1 acts to suppress tumor growth by keeping levels of IDO under control. However, loss of this regulatory gene led to increased tumor growth as Bin1 supported T-cell mediated immune surveillance was impaired (Muller et al., 2005). The engraftment of c-myc+ras-transformed skin epithelial cells in syngeneic mice resulted in limited tumor growth if Bin1 was present than if it was deleted,



858


progress at the rate observed in wild-type mice (Smith et al., 2012). The implication of these results was that IL-6 serves as a key regulator of tumor growth downstream of IDO, a connection of potential therapeutic value since IL-6 levels are increased in patients with recurring tumors (Kita et al., 2011). The mechanisms through which IDO affects tumor growth remain only partly elucidated. One intriguing effector pathway appears to involve the aryl hydrocarbon receptor (AHR), discovered to be a target receptor for kynurenine (Opitz et al., 2011). AHR was discovered originally as the receptor for dioxin (2,3,7,8-tetrachlorodibenzo-p-dioxin [TCDD]). Upon binding to AHR in dendritic cell cultures, TCDD can induce expression of both IDO1 and IDO2 suggesting the presence of a feed-forward regulatory loop (Vogel et al., 2008). It is postulated that induction of IDO1 through TCDD requires a combination of signaling by AHR and RelB, the non-canonical NF-κB signaling molecule that may work through IL-8 and AHR following CD40 ligation (Vogel et al., 2007a; Tas et al., 2007; Vogel et al., 2007b). Furthermore, it was shown that TCDD treatment of mouse splenic T-cells resulted in increased levels of FoxP3, an effect that was abrogated in Ahr-null mice signifying that Ahr is important in the development of Tregs (Vogel et al., 2008). Further mechanistic connections are suggested by observations that kynurenic acid, a byproduct of tryptophan catabolism, also induces AHR activity and results in IL-6 signaling (DiNatale et al., 2010). Interestingly, IDO1-nullizygous mice show a diminished IL-6 levels in primary lung tumors and pulmonary metastases (Smith et al., 2012). Taken together, studies identify AHR and IL-6 (a target of the GCN2 pathway activated by IDO (Metz et al., 2007)) as key players in IDO signaling in cancer.

antitumor effects, recent preclinical studies in mice have suggested that 1MT does not act directly on IDO but rather downstream in an effector pathway leading to mTOR control (Metz et al., 2012). An enzymatic inhibitor of IDO termed INCB024360 has entered clinical trials. INCB024360 is a hydrozyamidine that competitively blocks the degradation of tryptophan to kynurenine through IDO with an IC50 of approximately 72 nM (Liu et al., 2010). Similarly to 1MT, treatment with INCB024360 showed attenuated tumor growth in wild-type mice but not in immune-deficient mice (Liu et al., 2010; Koblish et al., 2010). In both mice and dogs, INCB024360 was given orally, resulting in a reduction of kynurenine in the tumors, tumor draining lymph nodes and also plasma (Koblish et al., 2010). There was no apparent maximum tolerated dose determined in the Phase I trials allowing it to move into Phase II trials, where it will be tested as a monotherapy in ovarian cancer and as a combination therapy with ipilimumab for metastatic melanoma. One interesting aspect of IDO inhibition is that it may already be occurring with other cancer drugs. For example, the paradigm targeted cancer drug Gleevec has been found to suppress IDO expression in GIST cells as a result of Kit inhibition (Balachandran et al., 2011). Another recent study has revealed that the cytotoxic agent β-lapachone is a direct inhibitor of IDO, postulating that this cytotoxic agent may benefit from the additional immunological effects that derive from its potent uncompetitive inhibitory effects on IDO1 activity. Other drugs in use include NSAIDs that indirectly block IDO activity as a result of COX2 inhibition (Sayama et al., 1981). Another effective IDO inhibitor in mouse studies is the anti-inflammatory ethyl pyruvate, which by inhibiting NF-kB activity blocks IDO expression and produces robust anti-tumor responses that are both T cell and IDO dependent (Muller et al., 2010). Taken together, these findings point to a promising future for IDO inhibitors as new tools for immunotherapy and immunochemotherapy of cancer.

Clinical trials of IDO inhibitors IDO is an appealing therapeutic target for cancer treatment for several reasons. Structurally, it is welldefined, allowing for easier discovery of molecular inhibitors. Furthermore, it is both structurally and spatially distinct from the tryptophan catabolic enzymes IDO2 and TDO2. From a clinical viewpoint, pharmodynamic evaluations are eased by measuring serum tryptophan and kynurenine levels. Additionally, while immunotherapies are gaining clinical use, they are often restricted by being either tailored to each patient or expensive. An enzymatic inhibitor provides a more generic and less expensive method to alter immune recognition and elimination of tumor cells. The potential value of targeting IDO in cancer was further given credence by the addition of 1MT onto a select list of the 12 immunotherapeutic agents identified by an NCI workshop panel as having high potential for use in cancer therapy (Koblish et al., 2008). 1MT is a tryptophan analog that entered early stage clinical trials in 2008 and results are expected by the conclusion of 2013. While 1MT may provide



References Higuchi K, Kuno S, Hayaishi O.. Enzymatic formation of Dkynurenine. Federation Proc. 1963; 22:243. Higuchi K, Hayaishi O.. Enzymic formation of D-kynurenine from D-tryptophan. Arch Biochem Biophys. 1967 May;120(2):397-403. Rose DP.. Tryptophan metabolism in carcinoma of the breast. Lancet. 1967 Feb 4;1(7484):239-41. Yoshida R, Urade Y, Tokuda M, Hayaishi O.. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl Acad Sci U S A. 1979 Aug;76(8):4084-6. Sayama S, Yoshida R, Oku T, Imanishi J, Kishida T, Hayaishi O.. Inhibition of interferon-mediated induction of indoleamine 2,3-dioxygenase in mouse lung by inhibitors of prostaglandin

859


biosynthesis. Proc Dec;78(12):7327-30.

Natl

Acad

Sci

U

S

A.

1981


Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P.. T cell apoptosis by tryptophan catabolism. Cell Death Differ. 2002 Oct;9(10):106977.

Watanabe Y, Yoshida R, Sono M, Hayaishi O.. Immunohistochemical localization of indoleamine 2,3dioxygenase in the argyrophilic cells of rabbit duodenum and thyroid gland. J Histochem Cytochem. 1981 May;29(5):623-32. Yoshida R, Imanishi J, Oku T, Kishida T, Hayaishi O.. Induction of pulmonary indoleamine 2,3-dioxygenase by interferon. Proc Natl Acad Sci U S A. 1981 Jan;78(1):129-32.

Fan F, Jin S, Amundson SA, Tong T, Fan W, Zhao H, Zhu X, Mazzacurati L, Li X, Petrik KL, Fornace AJ Jr, Rajasekaran B, Zhan Q.. ATF3 induction following DNA damage is regulated by distinct signaling pathways and over-expression of ATF3 protein suppresses cells growth. Oncogene. 2002 Oct 24;21(49):7488-96.

Ozaki Y, Edelstein MP, Duch DS.. Induction of indoleamine 2,3-dioxygenase: a mechanism of the antitumor activity of interferon gamma. Proc Natl Acad Sci U S A. 1988 Feb;85(4):1242-6.

Friberg M, Jennings R, Alsarraj M, Dessureault S, Cantor A, Extermann M, Mellor AL, Munn DH, Antonia SJ.. Indoleamine 2,3-dioxygenase contributes to tumor cell evasion of T cellmediated rejection. Int J Cancer. 2002 Sep 10;101(2):151-5.

Taylor MW, Feng GS.. Relationship between interferongamma, indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J. 1991 Aug;5(11):2516-22. (REVIEW)

Frumento G, Rotondo R, Tonetti M, Damonte G, Benatti U, Ferrara GB.. Tryptophan-derived catabolites are responsible for inhibition of T and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J Exp Med. 2002 Aug 19;196(4):459-68.

Burke F, Knowles RG, East N, Balkwill FR.. The role of indoleamine 2,3-dioxygenase in the anti-tumour activity of human interferon-gamma in vivo. Int J Cancer. 1995 Jan 3;60(1):115-22.

Terness P, Bauer TM, Rose L, Dufter C, Watzlik A, Simon H, Opelz G.. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. J Exp Med. 2002 Aug 19;196(4):447-57.

Varga J, Yufit T, Hitraya E, Brown RR.. Control of extracellular matrix degradation by interferon-gamma. The tryptophan connection. Adv Exp Med Biol. 1996;398:143-8.

Fallarino F, Grohmann U, Hwang KW, Orabona C, Vacca C, Bianchi R, Belladonna ML, Fioretti MC, Alegre ML, Puccetti P.. Modulation of tryptophan catabolism by regulatory T cells. Nat Immunol. 2003 Dec;4(12):1206-12. Epub 2003 Oct 26.

Wang XZ, Ron D.. Stress-induced phosphorylation and activation of the transcription factor CHOP (GADD153) by p38 MAP Kinase. Science. 1996 May 31;272(5266):1347-9. Munn DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL.. Prevention of allogeneic fetal rejection by tryptophan catabolism. Science. 1998 Aug 21;281(5380):1191-3.

Lee JR, Dalton RR, Messina JL, Sharma MD, Smith DM, Burgess RE, Mazzella F, Antonia SJ, Mellor AL, Munn DH.. Pattern of recruitment of immunoregulatory antigen-presenting cells in malignant melanoma. Lab Invest. 2003 Oct;83(10):1457-66.

Ge K, DuHadaway J, Du W, Herlyn M, Rodeck U, Prendergast GC.. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. Proc Natl Acad Sci U S A. 1999 Aug 17;96(17):9689-94.

Tajiri T, Liu X, Thompson PM, Tanaka S, Suita S, Zhao H, Maris JM, Prendergast GC, Hogarty MD.. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. Clin Cancer Res. 2003 Aug 15;9(9):3345-55.

Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U.. ATF3 and stress responses. Gene Expr. 1999;7(4-6):321-35. (REVIEW)

Uyttenhove C, Pilotte L, Theate I, Stroobant V, Colau D, Parmentier N, Boon T, Van den Eynde BJ.. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat Med. 2003 Oct;9(10):1269-74. Epub 2003 Sep 21.

Munn DH, Shafizadeh E, Attwood JT, Bondarev I, Pashine A, Mellor AL.. Inhibition of T cell proliferation by macrophage tryptophan catabolism. J Exp Med. 1999 May 3;189(9):136372.

Jiang HY, Wek SA, McGrath BC, Lu D, Hai T, Harding HP, Wang X, Ron D, Cavener DR, Wek RC.. Activating transcription factor 3 is integral to the eukaryotic initiation factor 2 kinase stress response. Mol Cell Biol. 2004 Feb;24(3):136577.

Ge K, Minhas F, Duhadaway J, Mao NC, Wilson D, Buccafusca R, Sakamuro D, Nelson P, Malkowicz SB, Tomaszewski J, Prendergast GC.. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Int J Cancer. 2000 Apr 15;86(2):155-61.

Lu PD, Harding HP, Ron D.. Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J Cell Biol. 2004 Oct 11;167(1):27-33.

Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, Ron D.. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell. 2000 Nov;6(5):1099-108.

Muller AJ, DuHadaway JB, Donover PS, Sutanto-Ward E, Prendergast GC.. Targeted deletion of the suppressor gene bin1/amphiphysin2 accentuates the neoplastic character of transformed mouse fibroblasts. Cancer Biol Ther. 2004 Dec;3(12):1236-42. Epub 2004 Dec 14.

Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA.. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. J Immunol. 2000 Apr 1;164(7):3596-9. Mellor AL, Sivakumar J, Chandler P, Smith K, Molina H, Mao D, Munn DH.. Prevention of T cell-driven complement activation and inflammation by tryptophan catabolism during pregnancy. Nat Immunol. 2001 Jan;2(1):64-8.

Munn DH, Sharma MD, Hou D, Baban B, Lee JR, Antonia SJ, Messina JL, Chandler P, Koni PA, Mellor AL.. Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. J Clin Invest. 2004 Jul;114(2):280-90.

Bild AH, Turkson J, Jove R.. Cytoplasmic transport of Stat3 by receptor-mediated endocytosis. EMBO J. 2002 Jul 1;21(13):3255-63.


Vattem KM, Wek RC.. Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. Proc

860


Natl Acad Sci U S A. 2004 Aug 3;101(31):11269-74. Epub 2004 Jul 26.

of indoleamine 2,3-dioxygenase in dendritic cells by stereoisomers of 1-methyl-tryptophan correlates with antitumor responses. Cancer Res. 2007 Jan 15;67(2):792-801.

Astigiano S, Morandi B, Costa R, Mastracci L, D'Agostino A, Ratto GB, Melioli G, Frumento G.. Eosinophil granulocytes account for indoleamine 2,3-dioxygenase-mediated immune escape in human non-small cell lung cancer. Neoplasia. 2005 Apr;7(4):390-6.

Metz R, Duhadaway JB, Kamasani U, Laury-Kleintop L, Muller AJ, Prendergast GC.. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indoleamine 2,3-dioxygenase inhibitory compound D-1-methyltryptophan. Cancer Res. 2007 Aug 1;67(15):7082-7.

Muller AJ, DuHadaway JB, Donover PS, Sutanto-Ward E, Prendergast GC.. Inhibition of indoleamine 2,3-dioxygenase, an immunoregulatory target of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Nat Med. 2005 Mar;11(3):312-9. Epub 2005 Feb 13.

Munn DH, Mellor AL.. Indoleamine 2,3-dioxygenase and tumor-induced tolerance. J Clin Invest. 2007 May;117(5):114754. (REVIEW) Tas SW, Vervoordeldonk MJ, Hajji N, Schuitemaker JH, van der Sluijs KF, May MJ, Ghosh S, Kapsenberg ML, Tak PP, de Jong EC.. Noncanonical NF-kappaB signaling in dendritic cells is required for indoleamine 2,3-dioxygenase (IDO) induction and immune regulation. Blood. 2007 Sep 1;110(5):1540-9. Epub 2007 May 4.

Munn DH, Sharma MD, Baban B, Harding HP, Zhang Y, Ron D, Mellor AL.. GCN2 kinase in T cells mediates proliferative arrest and anergy induction in response to indoleamine 2,3dioxygenase. Immunity. 2005 May;22(5):633-42. Okamoto A, Nikaido T, Ochiai K, Takakura S, Saito M, Aoki Y, Ishii N, Yanaihara N, Yamada K, Takikawa O, Kawaguchi R, Isonishi S, Tanaka T, Urashima M.. Indoleamine 2,3dioxygenase serves as a marker of poor prognosis in gene expression profiles of serous ovarian cancer cells. Clin Cancer Res. 2005 Aug 15;11(16):6030-9.

Vogel CF, Sciullo E, Li W, Wong P, Lazennec G, Matsumura F.. RelB, a new partner of aryl hydrocarbon receptor-mediated transcription. Mol Endocrinol. 2007a Dec;21(12):2941-55. Epub 2007 Sep 6. Vogel CF, Sciullo E, Matsumura F.. Involvement of RelB in aryl hydrocarbon receptor-mediated induction of chemokines. Biochem Biophys Res Commun. 2007b Nov 23;363(3):722-6. Epub 2007 Sep 19.

Takikawa O.. Biochemical and medical aspects of the indoleamine 2,3-dioxygenase-initiated L-tryptophan metabolism. Biochem Biophys Res Commun. 2005 Dec 9;338(1):12-9. Epub 2005 Sep 15. (REVIEW)

Cheever MA.. Twelve immunotherapy drugs that could cure cancers. Immunol Rev. 2008 Apr;222:357-68. doi: 10.1111/j.1600-065X.2008.00604.x. (REVIEW)

Della Chiesa M, Carlomagno S, Frumento G, Balsamo M, Cantoni C, Conte R, Moretta L, Moretta A, Vitale M.. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. Blood. 2006 Dec 15;108(13):411825. Epub 2006 Aug 10.

Pan K, Wang H, Chen MS, Zhang HK, Weng DS, Zhou J, Huang W, Li JJ, Song HF, Xia JC.. Expression and prognosis role of indoleamine 2,3-dioxygenase in hepatocellular carcinoma. J Cancer Res Clin Oncol. 2008 Nov;134(11):124753. doi: 10.1007/s00432-008-0395-1. Epub 2008 Apr 26.

Fallarino F, Grohmann U, You S, McGrath BC, Cavener DR, Vacca C, Orabona C, Bianchi R, Belladonna ML, Volpi C, Santamaria P, Fioretti MC, Puccetti P.. The combined effects of tryptophan starvation and tryptophan catabolites downregulate T cell receptor zeta-chain and induce a regulatory phenotype in naive T cells. J Immunol. 2006 Jun 1;176(11):6752-61.

Vogel CF, Goth SR, Dong B, Pessah IN, Matsumura F.. Aryl hydrocarbon receptor signaling mediates expression of indoleamine 2,3-dioxygenase. Biochem Biophys Res Commun. 2008 Oct 24;375(3):331-5. doi: 10.1016/j.bbrc.2008.07.156. Epub 2008 Aug 9. DiNatale BC, Murray IA, Schroeder JC, Flaveny CA, Lahoti TS, Laurenzana EM, Omiecinski CJ, Perdew GH.. Kynurenic acid is a potent endogenous aryl hydrocarbon receptor ligand that synergistically induces interleukin-6 in the presence of inflammatory signaling. Toxicol Sci. 2010 May;115(1):89-97. doi: 10.1093/toxsci/kfq024. Epub 2010 Jan 27.

Serafini P, Borrello I, Bronte V.. Myeloid suppressor cells in cancer: recruitment, phenotype, properties, and mechanisms of immune suppression. Semin Cancer Biol. 2006 Feb;16(1):53-65. Epub 2005 Sep 15. (REVIEW) Weber WP, Feder-Mengus C, Chiarugi A, Rosenthal R, Reschner A, Schumacher R, Zajac P, Misteli H, Frey DM, Oertli D, Heberer M, Spagnoli GC.. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Eur J Immunol. 2006 Feb;36(2):296-304.

Koblish HK, Hansbury MJ, Bowman KJ, Yang G, Neilan CL, Haley PJ, Burn TC, Waeltz P, Sparks RB, Yue EW, Combs AP, Scherle PA, Vaddi K, Fridman JS.. Hydroxyamidine inhibitors of indoleamine-2,3-dioxygenase potently suppress systemic tryptophan catabolism and the growth of IDOexpressing tumors. Mol Cancer Ther. 2010 Feb;9(2):489-98. doi: 10.1158/1535-7163.MCT-09-0628. Epub 2010 Feb 2.

Brandacher G, Perathoner A, Ladurner R, Schneeberger S, Obrist P, Winkler C, Werner ER, Werner-Felmayer G, Weiss HG, Gobel G, Margreiter R, Konigsrainer A, Fuchs D, Amberger A.. Prognostic value of indoleamine 2,3-dioxygenase expression in colorectal cancer: effect on tumor-infiltrating T cells. Clin Cancer Res. 2006 Feb 15;12(4):1144-51.

Liu X, Shin N, Koblish HK, Yang G, Wang Q, Wang K, Leffet L, Hansbury MJ, Thomas B, Rupar M, Waeltz P, Bowman KJ, Polam P, Sparks RB, Yue EW, Li Y, Wynn R, Fridman JS, Burn TC, Combs AP, Newton RC, Scherle PA.. Selective inhibition of IDO1 effectively regulates mediators of antitumor immunity. Blood. 2010 Apr 29;115(17):3520-30. doi: 10.1182/blood-2009-09-246124. Epub 2010 Mar 2.

Wek RC, Jiang HY, Anthony TG.. Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans. 2006 Feb;34(Pt 1):7-11. (REVIEW) Ball HJ, Sanchez-Perez A, Weiser S, Austin CJ, Astelbauer F, Miu J, McQuillan JA, Stocker R, Jermiin LS, Hunt NH.. Characterization of an indoleamine 2,3-dioxygenase-like protein found in humans and mice. Gene. 2007 Jul 1;396(1):203-13. Epub 2007 Apr 18.

Muller AJ, DuHadaway JB, Chang MY, Ramalingam A, Sutanto-Ward E, Boulden J, Soler AP, Mandik-Nayak L, Gilmour SK, Prendergast GC.. Non-hematopoietic expression of IDO is integrally required for inflammatory tumor promotion. Cancer Immunol Immunother. 2010 Nov;59(11):1655-63. doi: 10.1007/s00262-010-0891-4. Epub 2010 Jul 17.

Hou DY, Muller AJ, Sharma MD, DuHadaway J, Banerjee T, Johnson M, Mellor AL, Prendergast GC, Munn DH.. Inhibition



Balachandran VP, Cavnar MJ, Zeng S, Bamboat ZM,

861


Ocuin LM, Obaid H, Sorenson EC, Popow R, Ariyan C, Rossi F, Besmer P, Guo T, Antonescu CR, Taguchi T, Yuan J, Wolchok JD, Allison JP, DeMatteo RP.. Imatinib potentiates antitumor T cell responses in gastrointestinal stromal tumor through the inhibition of Ido. Nat Med. 2011 Aug 28;17(9):1094-100. doi: 10.1038/nm.2438.

Metz R, Rust S, Duhadaway JB, Mautino MR, Munn DH, Vahanian NN, Link CJ, Prendergast GC.. IDO inhibits a tryptophan sufficiency signal that stimulates mTOR: A novel IDO effector pathway targeted by D-1-methyl-tryptophan. Oncoimmunology. 2012 Dec 1;1(9):1460-1468. Smith C, Chang MY, Parker KH, Beury DW, DuHadaway JB, Flick HE, Boulden J, Sutanto-Ward E, Soler AP, Laury-Kleintop LD, Mandik-Nayak L, Metz R, Ostrand-Rosenberg S, Prendergast GC, Muller AJ.. IDO is a nodal pathogenic driver of lung cancer and metastasis development. Cancer Discov. 2012 Aug;2(8):722-35. doi: 10.1158/2159-8290.CD-12-0014. Epub 2012 Jul 19.

Kita H, Shiraishi Y, Watanabe K, Suda K, Ohtsuka K, Koshiishi Y, Goya T.. Does postoperative serum interleukin-6 influence early recurrence after curative pulmonary resection of lung cancer? Ann Thorac Cardiovasc Surg. 2011;17(5):454-60. Epub 2011 Jul 13. Opitz CA, Litzenburger UM, Sahm F, Ott M, Tritschler I, Trump S, Schumacher T, Jestaedt L, Schrenk D, Weller M, Jugold M, Guillemin GJ, Miller CL, Lutz C, Radlwimmer B, Lehmann I, von Deimling A, Wick W, Platten M.. An endogenous tumourpromoting ligand of the human aryl hydrocarbon receptor. Nature. 2011 Oct 5;478(7368):197-203. doi: 10.1038/nature10491.



This article should be referenced as such: Smith C, Prendergast GC. Inflammatory programming and immune modulation in cancer by IDO. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):856-862.

862


OPEN ACCESS JOURNAL

Case Report Section Paper co-edited with the European LeukemiaNet

der(1;18)(q10;q10) in a patient with AML following essential thrombocythemia Adriana Zamecnikova, Soad Al Bahar, Ramesh Pandita Kuwait Cancer Control Center, Dep of Hematology, Laboratory of Cancer Genetics, Kuwait (AZ, SA, RP) Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Reports/der0118q10q10ZamecID100069.html DOI: 10.4267/2042/51879 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Pathology Bone marrow biopsy shows moderate to marked fibrosis with fibroblastic proliferation involving all marrow spaces, there is marked megakaryocytic hyperplasia, few lymphoid cells mixed with erythroid precursors. The megakaryocytes are variable in morphological appearance, many mononuclear and few with hyperlobulated nuclei and are distributed singly or in tiny clusters. The normal erythroid and granulocytic cell lines are suppressed. Electron microscopy Not done. Diagnosis ET transformed to AML.

Clinics Age and sex 52 years old female patient. Previous history No preleukemia, no previous malignancy, no inborn condition of note. Organomegaly Hepatomegaly, splenomegaly, no enlarged lymph nodes, no central nervous system involvement.

Blood WBC: 3.9 X 109/l HB: 7.7g/dl Platelets: 168 X 109/l Blasts: 8% Bone marrow: 20% (myeloblasts)

Survival Date of diagnosis: 03-2012 Treatment: Allogeneic bone marrow transplant on 11/07/2012 Complete remission: after BMT Treatment related death: no Relapse: no Status: Alive Last follow up: 11-2012 Survival: 12 months

Cyto-Pathology Classification Cytology AML following essential thrombocythemia Immunophenotype of the blast cells performed by flowcytometry was positive for CD7 (46%), CD13 (80%), CD15 (58%), CD33 (49%), CD34 (50%), CD45 (68%), and HLDR (76%). Rearranged Ig Tcr Not done.


Karyotype Sample: Bone marrow, peripheral blood

863

der(1;18)(q10;q10) in a patient with AML following essential thrombocythemia

Zamecnikova A, et al.

(A) Partial karyotype of the patient showing a whole-arm chromosome translocation between chromosomes 1 and 18 associated with a 20q deletion. (B) C-banded metaphase showing the der(1;18)(q10;q10) (arrow). (C) Fluorescence in situ hybridization studies with LSI D20S108 (Abbott) and LSI MALT1 Break Apart (Abbott) probes showing the loss of a D20S108 signal and the presence of a MALT1 signal on the der(1;18)(q10;q10). (D) Hybridization with LSI 1p36/1q25 and LSI 20q12 probes showing one red (20q12) signal on chromosome 20 and an extra green signal for 1q25 on the der(1;18)(q10;q10).

Culture time: 24h, direct Banding: G-banding Results 46,XX,+1,der(1;18)(q10;q10),del(20)(q11q13) [20] bone marrow; 46,XX,+1,der(1;18)(q10;q10),del(20)(q11q13) [20] blood Other molecular cytogenetics technics Fluorescence in situ hybridization applying the LSI D20S108, LSI 1p36/1q25 and LSI MALT1 Break Apart probes (Abbott). Other molecular cytogenetics results One signal of D20S108 and 3 signals 1q25 in 80% of bone marrow cells.


Comments A 52-years old female patient, with a history of thrombocythemia of 2 years duration was presented with symptomatic anemia and hepatosplenomegaly on March, 2012. Blood film showed evidence of leukoerythroblastic picture with 8% blast cells and bone marrow biopsy confirmed myelofibrosis with megakaryocytic hyperplasia demonstrated the presence of 20% myeloblast cells. Conventional cytogenetic analysis of blood and bone marrow samples revealed a rare chromosome abnormality: der(18)t(1;18)(q10;q10) associated with a deletion of the long arm of chromosome 20 in all metaphases.

864

der(1;18)(q10;q10) in a patient with AML following essential thrombocythemia

Unbalanced translocations involving the long arm of chromosome 1 are recurrent chromosome aberrations in patients with various myeloid neoplasms, including myeloproliferative disorders. The centromeric fusion between chromosomes 1 and 18, leading to a normal chromosome 18 substituted with a der(1;18) chromosome observed in our patient has been described in only 5 patients. 4 patients were diagnosed with chronic myeloproliferative disorders (MPD) and 1 patient with complex karyotype with multiple myeloma. Among the 4 patients with MPD, additional chromosome anomaly was detected only in 1 patient (+22), indicating that the der(1;18)(q10;q10) is a primary chromosome anomaly in myeloproliferative disorders. However; as deletion of the long arm of chromosome 20 is a known primary anomaly in myeloid disorders, we cannot exclude the possibility that the der(1;18)(q10;q10) is a secondary anomaly in our case; possibly involved in disease transformation. The unbalanced nature of the rearrangement indicates that gain of 1q and/or loss of 18p might be pathogenetically relevant for neoplastic transformation in this group of patients.


Zamecnikova A, et al.

References Trautmann U, Rubbert A, Gramatzki M, Henschke F, Gebhart E. Multiple chromosomal changes and karyotypic evolution in a patient with myelofibrosis. Cancer Genet Cytogenet. 1992 Jul 1;61(1):6-10 Wan TS, Ma SK, Au WY, Chan LC. Derivative (1;18)(q10;q10): a recurrent and novel unbalanced translocation involving 1q in myeloid disorders. Cancer Genet Cytogenet. 2001 Jul 1;128(1):35-8 Gabrea A, Martelli ML, Qi Y, Roschke A, Barlogie B, Shaughnessy JD Jr, Sawyer JR, Kuehl WM. Secondary genomic rearrangements involving immunoglobulin or MYC loci show similar prevalences in hyperdiploid and nonhyperdiploid myeloma tumors. Genes Chromosomes Cancer. 2008 Jul;47(7):573-90 Gangat N, Strand J, Lasho TL et al.. Cytogenetic studies at diagnosis in polycythemia vera: clinical and JAK2V617F allele burden correlates. Eur J Haematol. 2008 Mar;80(3):197-200 Azuma T, Yamanouchi J, Inoue K, Kohno M, Narumi H, Fujiwara H, Yakushijin Y, Hato T, Yasukawa M. Derivative (1;18)(q10;q10) in essential thrombocythemia. Cancer Genet Cytogenet. 2010 May;199(1):62-4 This article should be referenced as such: Zamecnikova A, Al Bahar S, Pandita R. der(1;18)(q10;q10) in a patient with AML following essential thrombocythemia. Atlas Genet Cytogenet Oncol Haematol. 2013; 17(12):863-865.

865


OPEN ACCESS JOURNAL

Case Report Section Paper co-edited with the European LeukemiaNet

t(2;11)(q31;p15) in therapy related myeloid neoplasm: case report and review of literature Amarpreet Bhalla, Anwar N Mohamed Cytogenetics Laboratory, Pathology Department, Wayne State University School of Medicine, Detroit Medical Center, Detroit MI, USA (AB, ANM) Published in Atlas Database: June 2013 Online updated version : http://AtlasGeneticsOncology.org/Reports/t0211q31p15MohamedID100070.html DOI: 10.4267/2042/51880 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2013 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Blasts: 0.9 X 109/L, promyelocytes: 0.9 X 109/L, myelocytes: 1.5 X 109/L, metamyelocytes: 2.3 X 109/L, bands: 4.1 X 109/L, neutrophils: 29.7 X 109/L, monocytes: 17 X 109/L; lymphocytes: 2.3 X 109/L. Bone marrow biopsy revealed a hypercellular marrow with 80% cellularity, multilineage dysplasia, 10.2% immature monocytes and 3.2% myeloblasts. CD34/CD117 showed approximately 10% immature myeloid/monocytic cells. CD64 highlighted the expanded monocytic component. In addition there were scattered metastatic tumor cells positive for AE1/AE3, mammoglobin and BRST1 by immunohistochemistry supporting primary breast origin.

Clinics Age and sex 59 years old female patient. Previous history No preleukemia, no previous malignancy, no inborn condition of note. Main items Patient diagnosed with breast cancer in 1995, treated with adjuvant chemotherapy consisting of 4 cycles of CAF (cyclophosphamide, doxorubicin and fluorouracil) and CMF (cyclophosphamide, methotrexate and fluorouracil) followed by tamoxifen for 6 years. On 6/2006, she had evidence of recurrence and subsequent liver, ribs, and skull metastases. She was treated with several other chemotherapies such as taxotere, gemzar, fluvestrant, taxol, bevacizumab and xeloda, and radiation therapy. On 11/2011, she developed brain metastasis and was successfully treated with gamma knife. Over her last year, she was on oral cyclophosphamide and doxorubicin. Organomegaly No hepatomegaly, no splenomegaly, no enlarged lymph nodes, central nervous system involvement (brain metastasis).

Cyto-Pathology Classification Cytology Therapy related myeloid neoplasm best classified as therapy related myelodysplastic /acute myeloid leukemia (t-MDS/AML). Immunophenotype Flow cytometric of peripheral blood detected 2% myeloblasts expressing CD13, CD33, CD 34, CD117 and HLA-DR, and partially expressing CD14, CD4, CD11d, CD11c and CD64. In addition there were two monocytes gates detected; 18% monocytes were expressing CD13, CD33, and partially expressing CD4, CD11b, CD11c, CD15, CD117, CD64 and CD14. There was a subpopulation of monocytes representing 6% of gated monocytes were negative CD14, CD19, CD2, CD10, CD7, CD34, CD163 but HLA-DR positive.

Blood WBC: 58.7 X 109/l HB: 8.7g/dl Platelets: 47 X 109/l Note: Peripheral blood showed anemia, thrombocytopenia, neutrophilic leukocytosis with absolute monocytosis.


866

t(2;11)(q31;p15) in therapy related myeloid neoplasm: case report and review of literature

Bhalla A, Mohamed AN

46, XX,t(2;11)(q31;p15)[14]/47,XX,t(2;11)(q31;p15),+8[6] (Figure 1)

Rearranged Ig Tcr Not performed. Electron microscopy Not performed. Diagnosis Therapy related MDS/AML

Survival Date of diagnosis: 01-2013 Treatment: Only supportive therapy Complete remission: no Treatment related death: no Relapse: no Status: Death Last follow up: 02-2013 Survival: 0,5 months Note Progressed quickly, expired shortly after diagnosis due to lactic acidosis and hypotention.

Figure 1: (arrows).

G-banded karyotype showing t(2;11)(q31;p15)

Other Molecular Studies Technics: Fluorescence in situ hybridization (FISH) using MDS panel DNA probes included EGR1/5q31, D5S23: D5S721/5p15.2, D7S486/7q31, D7Z1/CEP-7, D8Z2/CEP-8, D20S108/20q12, as well as the LSI MLL dual color break apart DNA probe (Abbott Molecular). FISH results were consistent with trisomy chromosome 8 in 9% of cells and a normal pattern for the remaining loci. In addition, dual color FISH using Signature Genomic DNA probes Rp11-387A1/2q31.1 covering HOXD gene cluster including both HOXD11 and HOXD13 genes was labeled SpectrumOrange, while the RP11-120E20/11p15.4 covering NUP98 gene was labeled SpectrumGreen (PerkinElmer, Spokane, WA).

Karyotype Sample: Bone marrow aspirate Culture time: 24h, unstimulated culture and 48 hrs culture with 10% conditioned medium Banding: GTG

Results

Figure 2: Dual color FISH analysis performed on a metaphase with t(2;11) using BAC probes for NUP98 (RP11-120E20) labeled in green and for HOXD (RP11387A1) labeled in orange, showed the presence of a fusion signal on der(2) (arrow); two orange signals on der(11) and chromosome 2; single green on normal chromosome 11.


867

t(2;11)(q31;p15) in therapy related myeloid neoplasm: case report and review of literature

Bhalla A, Mohamed AN

Table 1: Leukemia cases with t(2;11)(q31;p15) previously reported and the present case. Y: Years; Mon: Months; F: Female; M: Male.

The hybridization revealed a fusion signal located on der(2) due to a translocation of NUP98/15p15 (green) to HOXD/2q31(orange) gene region (Figure 2). The remainder of HOXD signal was translocated to 11p15.

The partner gene fused with NUP98 in leukemia harboring t(2;11) was the homeobox genes HOXD13 in all case, and HOXD11 in one patient (Table 1). The NUP98-HOXD13 and NUP98-HOXD11 fusion transcripts were detected in bone marrow of these patients, respectively. In a mouse model, studies have shown that NUP98-HOXD13 transgenic mice developed MDS similar to human, including peripheral blood cytopenia, ineffective hematopoiesis with dysplasia, and increased apoptosis in bone marrow. Within 14 months, all mice died of either leukemic transformation or severe pancytopenia. In our patient, FISH showed a fusion pattern suggestive NUP98-HOXD13 or HOXD11 gene fusion but not with certainty since the BAC RP11-387A1 probe covers other HOXD genes in the region (Figure 2). In Summary, t(2;11)(q31;p13) translocation in leukemia is rare but recurrent, and occurs in de novo AML as well as t-MDS/AML, and six out eight of patients were