HUMAN MUTATION 27(4), 370^375, 2006
RESEARCH ARTICLE
A Second-Site Mutation in the Initiation Codon of WAS (WASP) Results in Expansion of Subsets of Lymphocytes in an Wiskott-Aldrich Syndrome Patient Wei Du,1 Satoru Kumaki,1 Toru Uchiyama,1 Akihiro Yachie,3 Chung Yeng Looi,1 Shin Kawai,1 Masayoshi Minegishi,2 Narayanaswamy Ramesh,4,5 Raif S. Geha,4,5 Yoji Sasahara,1 and Shigeru Tsuchiya1 1
Department of Pediatric Oncology, Institute of Development, Aging and Cancer, Tohoku University, Sendai, Japan; 2Division of Transfusion, Tohoku University Hospital, Sendai, Japan; 3Department of Laboratory Sciences, School of Health Sciences, Faculty of Medicine, Kanazawa University, Kanazawa, Japan; 4Division of Immunology, Children’s Hospital, Harvard Medical School, Boston, Massachusetts; 5Department of Pediatrics, Harvard Medical School, Boston, Massachusetts Communicated by Nancy Spinner Wiskott-Aldrich syndrome (WAS) is caused by mutations in the gene encoding WAS protein (WASP). Recently, somatic mosaicism caused by reversions or second-site mutations has been reported in some inherited disorders including WAS. In this article, we describe somatic mosaicism in a 15-year-old WAS patient due to a second-hit mutation in the initiation codon. The patient originally had a single-base deletion (c.11delG; p.G4fsX40) in the WAS (WASP) gene, which resulted in a frameshift and abrogated protein expression. Subsequently, a fraction of T and natural killer (NK) cells expressed a smaller WASP, which binds to its cellular partner WASP-interacting protein (WIP). The T and NK cells were found to have an additional mutation in the initiation codon (c.1A4T; p.M1_P5del). The results strongly suggest that the smaller WASP is translated from the second ATG downstream of the original mutation, and not only Tcells but also NK cells carrying the second mutation acquired a growth advantage over WASP negative counterparts. To our knowledge, this is the first report describing somatic mosaicism due to a second-site mutation in the initiation codon of any inherited r 2006 Wiley-Liss, Inc. disorders. Hum Mutat 27(4), 370–375, 2006.
INTRODUCTION The Wiskott-Aldrich syndrome (WAS; MIM]s 301000, 277970) is an X-linked recessive immunodeficiency characterized by thrombocytopenia, eczema, and recurrent infections, and increased susceptibility to lymphoid malignancies and autoimmune disorders [Aldrich et al., 1954]. WASP, the product of the gene mutated in WAS, is expressed in all hematopoietic cells including CD341 stem cells, platelets, lymphocytes, neutrophils, macrophages, and dendritic cells [Derry et al., 1994; Kawai et al., 2002; Wengler et al., 1995]. It plays an important role in signal transduction pathway for cell growth and cytoskeletal organization through its interaction with many cellular partners such as WASP interacting protein (WIP), Grb2, Btk, Itk, Nck, and Arp2/3 complex [Badour et al., 2004; Ramesh et al., 1997]. Among them, WIP binds to the NH2-terminal EVH1 (WH1) domain of WASP, where most of the missense mutations of WAS patients are located [Jin et al., 2004]. In addition, interaction of WIP with WASP has been demonstrated to be involved in regulation of T cell activation [Badour et al., 2004]. Recently, somatic mosaicism has been reported in growing numbers of inherited disorders including WAS [Ariga et al., 1998, 2001; Hirschhorn, 2003; Holzelova et al., 2004; Jin et al., 2004; Lutskiy et al. 2005; Wada et al., 2001, 2002, 2003]. Somatic mosaicism due to reversions or second-site mutations resulting in compensatory functional changes is caused by several different r 2006 WILEY-LISS, INC.
mechanisms. The mechanisms include intragenic recombination, mitotic gene conversion, second site compensating mutation, DNA slippage, and site-specific reversion of a mutated nucleotide to normal. Functional recovery by somatic mosaicism becomes evident when mutation corrected cells have a selective growth advantage. This rare event may modify the clinical phenotype of the disease, leading to atypical and unexpectedly mild presentations [Hirschhorn et al., 1996; Lutskiy et al., 2005; Pittis et al., 2004; Stephan et al., 1996; Wada et al., 2001]. In this article, we describe the somatic mosaicism of a 15-year-old WAS patient due to a second-site mutation in the initiation codon. The patient originally had a single-base deletion (c.11delG; p.G4fsX40) in the WAS gene, which results in a frameshift and abrogates protein expression [Sasahara et al., 2000, 2001]. Seven years after Received1 July 2005; accepted revised manuscript 4 January 2006. Correspondence to: Satoru Kumaki, M.D., Ph.D., Department
of Pediatric Oncology, Institute of Development, Aging and Cancer, Tohoku University, 4 -1 Seiryo-Machi, Sendai 980- 8575, Japan. E-mail:
[email protected] Grant sponsors: Grants-in-Aid for Scienti¢c Research, Japan Society for the Promotion of Science; Ministry of Health, Labour and Welfare, Japan. DOI 10.1002/humu.20308 Published online1March 2006 inWiley InterScience (www.interscience. wiley.com).
HUMAN MUTATION 27(4), 370^375, 2006
chemotherapy for Hodgkin disease, WASP expression was detectable in a fraction of T and natural killer (NK) cells carrying the second-site mutation (c.1A4T; p.M1_P5del). Thus, it was suggested that cells carrying the second-site mutation had expanded due to selective growth advantage over the WASPnegative cells. MATERIALS AND METHODS Case Report The patient was a 15-year-old male without a clear family history. Thrombocytopenia was noticed at 1 month of age and thereafter, eczema and recurrent infections were remarkable. At 8 years of age, he had complications and persistent cough due to pulmonary hilar lymph node swelling. From the result of hilar lymph node biopsy, he was diagnosed with Hodgkin disease and received chemotherapy and local radiotherapy [Sasahara et al., 2000, 2001]. The patient has been in complete remission since then. His platelet count was in the range of 6,000–15,000/ml. The serum immunoglobulin (Ig) was as follows: IgG 1,466 mg/dl; IgA 239 mg/dl, and IgM 25 mg/dl; the lymphocyte profile was CD3 70.6%, CD4 22.4%, CD8 42.8%, CD19 15.9%, and CD56/16 5.1%. In recent years, episodes of respiratory infections were gradually reduced, although severe eczema and thrombocytopenia persisted. Cell Preparations Peripheral blood mononuclear cells (PBMCs) from heparinized blood samples were isolated by Ficoll-PaqueTM (Amersham Pharmacia, Uppsala, Sweden) density centrifugation. The cells were fractionated into CD41, CD81, CD191, and CD561 cells by positive magnetic immunoselection using automated magnetic cell sorting (autoMACS; Miltenyi Biotec, Bergisch Gladbach, Germany) as described previously [Kumaki et al., 2001]. Each fraction contained 96.5% CD41 cells, 91.5% CD81 cells, 82.5% CD191 cells, and 83.3% CD561 cells (data not shown). The Epstein-Barr virus (EBV)–transformed B cell lines and Cos7 cells were maintained in Roswell Park Memorial Institute 1640 medium (RPMI 1640) and Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS; Gibco BRL, Rockville, MD) at 371C in 5% CO2, respectively. Flow Cytometric Analysis of WASP Intracellular staining with a mouse anti-human WASP monoclonal antibody (mAb), 5A5, was performed as previously described [Kawai et al., 2002]. Briefly, cells were fixed in 4% paraformaldehyde and then permeabilized in 0.1% Triton X-100. Subsequently, these cells were reacted with 10 mg/ml of 5A5. The stained cells were immediately analyzed on a FACSCalibur (Beckton Dickinson, Franklin Lakes, NJ) flow cytometer. WASP fluorescence was assayed on CD41, CD81, CD191, and CD561 lymphocytes selected by fluorescent mode vs. side scattered light (SSC) gate. Sequencing Analysis of Genomic DNA Blood samples were collected from the patient and his mother with informed consent after approval of the Tohoku University Ethics Committee. Genomic DNA was isolated from fractionated PBMCs or the EBV-transformed B cell lines using the QIAamp Blood Kit (Qiagen, Chatsworth, CA). The WAS gene was amplified using primer pairs encompassing each exon–intron boundary [Sasahara et al., 2000]. The fragment including the WAS exon 1, in which the patient’s mutation was located, was PCR amplified with a primer pair of W-2 and W-496c (Table 1)
371
[Zhu et al., 1995]. Sequencing was performed directly on the PCR products as previously described [Sasahara et al., 2000]. Analysis of T-Cell Antigen Receptor Vb Repertoire Diversities To determine T-cell antigen receptor (TCR) diversities, we examined TCR Vb repertoire distributions by flow cytometry and CDR3 size distribution by an automated sequencer and GeneScan software, as described previously [Wada et al., 2001, 2005]. Peripheral blood samples were stained with appropriate phycoerythrin (PE)-conjugated monoclonal antibodies (mAbs) with specificity for TCR Vb 1-24 (Beckman Coulter, Fullerton, CA), and analyzed with a FACSCalibur flow cytometer. TCR Vb expression was represented as a percentage of CD41 or CD81 cells for each family. Next, total RNA was extracted from CD41 and CD81 T cells, and first-strand cDNA was generated from 2 mg of total RNA with random hexanucleotides and RAV-2 reverse transcriptase (Takara Bio Inc., Shiga, Japan). Each TCR Vb fragment was amplified with one of the 24 Vb-specific primers and a 6-fluorescein phosphoramidite (6-FAM)-labeled Cb primer recognizing both Cb1 and Cb2. One microliter of 1:10 diluted PCR products was mixed with 12 ml of deionized formamide and 0.5 ml of size standard and heated at 951C for 3 min. The size distribution of each fluorescent PCR product was determined by electrophoresis in the Performance Optimized Polymer 4 on the Applied Biosystems 310 automated sequencer, and data was analyzed by GeneScan software (Applied Biosystems, Foster City, CA). Expression Plasmid Construction and Transfection The wild-type WASP cDNA (a generous gift from Dr. J Derry; Immunex Corp, Seattle, WA) was cloned into an expression vector, pcDNA3 (pcDNA/WASP). Vectors containing the mutant cDNAs were generated by site-directed mutagenesis as described elsewhere [Kumaki et al., 2001]. Briefly, a pcDNA3 vector containing c.11delG mutation of WASP (pcDNA/WASPdelG) was constructed using a template vector pcDNA/WASP with a primer pair of dG-50 and dG-30 (Table 1). Next, pcDNA3 vector containing both c.1A4T and c.11delG mutations (pcDNA/ WASP2m) were constructed using a template vector pcDNA/ WASPdelG with a primer pair of A35T-50 and A35T-30 (Table 1). Sequences of the mutant cDNAs were confirmed by comparing with a reference cDNA sequence (GenBank accession: NM_000377). For the expression of WIP, pcDNA/WIP-GFP was used. The expression vectors were transiently transfected into Cos7 cells using FuGeneTM 6 (Roche Diagnostics, Mannheim, Germany). WASP and WIP expression in Cos-7 cells were detected by immunoblotting using anti-WASP mAb 5A5, and mouse anti-GFP monoclonal antibody for WIP (Becton Dickinson), respectively. Immunoprecipitation and Western blotting were performed according to the standard procedures [Kumaki et al., 2001]. TABLE 1.
Primers used for sequencing and mutant generation
Primer dG-30 dG-50 (2) W-2 W-496c A35T-5(3) A35T-3(3)
Sequence (50 -3 0) CCCAATGGGAGGAAGGCCCCG CCCCACTCATGGTGCTTTCTC GCTTCGCCAGAGAAGACAAG TCCACTTTGCCTCTGATTCC CTCTAGAGAAAGCACCTTGAGTGGGGCCCAATG CATTGGGCCCCACTCAAGGTGCTTTCTCTAGAG
Human Mutation DOI 10.1002/humu
372
HUMAN MUTATION 27(4), 370^375, 2006
RESULTS Expression of WASP in a Fraction of the Patient’s T and NK Cells We first analyzed WASP expression in PBMCs from the patient by intracellular staining with an anti-WASP mAb, 5A5 [Kawai et al., 2002]. Expression of WASP was detected in about half of the CD41 T cells and most of the CD81 T cells, and in a quarter of the CD561 NK cells, but not in CD191 B cells and CD141 monocytes by flow cytometric analysis (Fig. 1; and data not shown). Absolute cell counts of WASP positive CD41, CD81, and CD561 cells were 254, 1,288, and 73/ml, respectively. To further characterize the WASP expressed in a fraction of Tand NK cells, Western blot analysis was performed. The size of the WASP was slightly smaller than that of healthy controls (Fig. 2A). Presence of a Second-Site Mutation in the Initiation Codon The patient originally had a single-base deletion (c.11delG) in exon 1 of WAS gene as described previously [Sasahara et al., 2000, 2001]. This mutation resulted in a frameshift and abrogated protein expression. Seven years after chemotherapy for Hodgkin disease, expression of WASP was observed in a fraction of T and NK cells. To determine whether the original mutation was still presented in the WASP expressing cells, genomic sequencing was performed on magnetically sorted CD41, CD81, CD191, and CD561 cells. We demonstrated that the c.11delG mutation was present in all of the cells, whereas an additional mutation in the initiation codon (c.1A4T) was detectable only in CD41, CD81, and CD561 cells, but not in CD191 cells (data reviewed, but not shown). Genomic DNA from his mother contained only the original mutation but not the second-site mutation (data not shown). Therefore, we hypothesized that the de novo second-site c.1A4T point mutation mitigates the effects of the original mutation by initiating alternate translation downstream of the original mutation site (Fig. 3).
FIGURE 1. Expression of WASP in a fraction of T and NK cells. Flow cytometric analysis of WASP expression in gated CD4 1 T cells, CD81 T cells, CD561 NK cells, and CD191 B cells from a normal control (left panel) and the WAS patient (right panel). Histograms present the staining pro¢le of intracytoplasmic £uorescence with isotype-matched control (empty histogram) and 5A5 mAb (hatched histogram). [Color ¢gure can be viewed in the online issue, which is available at www.interscience.wiley.com]
Human Mutation DOI 10.1002/humu
FIGURE 2. A smaller WASP is expressed in the patient’s PBMCs and transfected cells. A: Expression of a smallerWASP in the patient’s PBMCs. PBMCs from a normal control (Ctr), the patient (Pt), a WAS patient with a reversion in a limited T cell fraction (W1), and a typical WAS patient (W2) were lysed and separated by SDS-PAGE followed by immunoblotting with an anti-WASP mAb, 5A5. Arrow and arrowhead indicate the wild-type WASP and a smaller WASP, respectively. B: The second-site mutation resulted in expression of a smallerWASP in vitro. Cos7 cells were transfected with pcDNA/WASP (WT), pcDNA/WASPdelG (delG), pcDNA/WASP2m (2m), or the vector control (mock). Expression of WASP in the transfected cells was assessed by Western blot.
FIGURE 3. Schematic representation of the mutant WASP. A bar and an asterisk indicate the original mutation, c.11delG, and the second-site mutation, c.1A4T, respectively. The original mutation resulted in a frameshift after codon 4 and a premature stop codon at codon 44. The second-site mutation in the initiation codon alters translation initiation from the second ATG locates downstream of the original mutation.
HUMAN MUTATION 27(4), 370^375, 2006
373
Signi¢cant Skewing of TCR Vb Usage To determine clonal dominance or restriction within T lymphocyte populations, we analyzed by flow cytometry the entire TCR Vb repertoire in CD41 and CD81 T cells of the patient and found significant skewing of TCR Vb usage (data not shown). In addition, CDR3 distributions were markedly skewed and most of the repertoires were undetectable or with only few peaks (Fig. 4). These results demonstrated that the smaller WASP expressed in this patient’s T cells is not enough to reconstitute normal TCRb repertoire, although it confers growth advantage over WASP negative T cells. The Mutant WASP Was Expressed and Associated With WIP To prove that WASP produced due to the c.1A4T mutation was translated in cells, we examined the expression of WASP in transiently transfected Cos7 cells. As shown in Figure 2B, 5A5 FIGURE 5. Association of the WASP with WIP. Cos7 cells were transfected with pcDNA/WASP (WT), pcDNA/WASP2m (2m), or the vector control (mock) together with pcDNA/WIP-GFP. Lysates from transiently cotransfected Cos7 cells were immunoprecipitated with 5A5 or isotype-matched control (Ctr). The immunoprecipitates were sequentially immunoblotted with anti-GFP mAb (A) and anti-WASP mAb 5A5 (B).
recognized the mutant WASP carrying the original and secondsite mutations but not the original mutation alone. The expression level was comparable to that of the wild type, although the size was slightly smaller, demonstrating that the mutant WASP is efficiently translated and expressed. The result is compatible with the result of Western blot using the patient’s PBMC (Fig. 2A). From deduced amino acid sequence of the mutant WASP carrying the original and second mutations, translated WASP lacks Nterminal 5 amino acids. In addition, a much smaller band was also detected in the mutant WASP but not in the wild-type WASP (Fig. 2B). The much smaller band might result from an alternative splicing or from the third ATG that locates 112 nucleotides downstream of the initiation codon. Because WIP binds to the NH2-terminal WH1 domain of WASP and plays an important role in regulation of T cell activation, association of the mutant WASP with WIP was evaluated. For this purpose, we transiently transfected Cos7 cells with a vector encoding the wild-type WASP or the mutant WASP carrying both mutations, together with WIP-GFP. The lysates of the transfected cells were immunoprecipitated with 5A5 or a control antibody followed by immunoblotting with anti-GFP antibody and 5A5. WIP was coprecipitated with the wild-type WASP and the mutant WASP carrying both mutations (Fig. 5A). In contrast, WIP was not detected in control mAb immunoprecipitates (Fig. 5A). The membrane was reprobed with 5A5 to confirm the presence of the transfected wild-type WASP or the mutant WASP (Fig. 5B). The results demonstrated that WIP efficiently interacted with not only the wild-type WASP but also the mutant WASP. Therefore, the smaller WASP found in our patient can associate with WIP, which is required for stabilization of WASP and TCR-induced activation. FIGURE 4. Analysis of TCRb gene rearrangement. CDR size distributions of TCRVb subfamilies within CD4 1 (A) and CD81 (B) T cells. Each TCRVb fragment was ampli¢ed from cDNA with 1 out of 24 Vb-speci¢c primers. The size distribution of PCR products was determined by an automated sequencer and GeneScan software.
DISCUSSION Somatic revertant mosaicism resulting from back mutations or second-site mutations has been reported in growing numbers of genetic diseases [Ariga et al., 1998, 2001; Hirschhorn, 2003; Human Mutation DOI 10.1002/humu
374
HUMAN MUTATION 27(4), 370^375, 2006
Holzelova et al., 2004; Jin et al., 2004; Lutskiy et al., 2005; Wada et al., 2001, 2002, 2003]. The mechanisms responsible for somatic reversion of inherited disorders include intragenic recombination, mitotic gene conversion, second site compensating mutation, DNA slippage, and site-specific reversion of a mutated nucleotide to normal by an unknown mechanism [Hirschhorn, 2003]. Here we describe a unique second-site mutation in a WAS patient; we hypothesized that the second-site mutation in the initiation codon (ATG to TTG) resulted in alternative translation initiation from the second ATG that is located downstream of the original single nucleotide deletion (c.11delG) [Kozak, 1987; Sasahara et al., 2001]. The second-site mutation was observed in a fraction of the patient’s T and NK cells, leading to expression of a smaller WASP. Genomic DNA from his mother contained only the original mutation but not the second-site mutation. In addition, the second-site mutation was not detected in the patient’s PBMCs prior to the onset of Hodgkin disease [Sasahara et al., 2001, 2002]. Thus, we conclude that the lymphocytes carrying the second-site mutation originated de novo. Taken together, it was suggested that a precursor cell carrying the secondsite mutation acquired growth advantage over T and NK cells that did not express WASP, resulting in expansion of cells expressing the smaller WASP. In this context, it is noteworthy that CD4/CD8 ratio changed from 0.89 to 0.39 before and 3 years after the chemo- or radiotherapy, respectively, corresponding to CD81 cell numbers of from 500 to 600/ml to 1200–1400/ml. In contrast, CD4 1 and CD561 cells remained at similar levels of 500–700/ml and 200–300/ml, respectively. We speculate that the growth of CD81 cells carrying the second-site mutation is faster than that of the CD41 cells, resulting in a skewed CD4/8 ratio. The result is accordance with our observation that the mutant WASP was expressed by most of the CD81 cells, but by only half of CD41 cells. However, the patient’s use of the TCR Vb subfamilies was markedly skewed, similar to those of older WAS patients [Wada et al., 2005]. The oligoclonal pattern of TCRVb usage of the patient suggests that the smaller WASP expressed is not sufficient to reconstitute normal TCRb repertoire although it confers growth advantage over WASP negative T cells. Because the second-site mutation was detected only in samples after the chemo- or radiotherapies, it is possible that the mutation might be elicited by these therapies. Functional analysis of the smaller WASP demonstrated that it has a capacity to associate with WIP in vitro, which is responsible for WASP stability and for recruitment and activation of WASP in T cell signaling [Konno et al., 2004; Ramesh et al., 1997]. Our novel observation of somatic mosaicism suggests that WASP function is maintained even if a portion of Nterminal end of WASP is lacking. An earlier report described a mutation of the initiation codon that inactivates the first in-frame translation start site results in a mild form of disease with a residual protein suggesting a downstream ATG takes over and still produces a functional protein [Pittis et al., 2004]. This finding is compatible with our observation. Interestingly in our case, functional WASP is expressed both in T cells and NK cells. The result differs from previous studies, in which revertant WASP was expressed only in either T cells or NK cells [Konno et al., 2004; Lutskiy et al., 2005]. To our knowledge, this is the first report describing somatic mosaicism due to a second-site mutation in the initiation codon of inherited disorders. ACKNOWLEDGMENT We thank Ms. Ikuko Hakozaki for her help with sequencing analysis of the patient’s sample. Human Mutation DOI 10.1002/humu
REFERENCES Aldrich RA, Steinburg AG, Campbell DC. 1954. Pedigree demonstrating a sex-linked recessive condition characterized by draining ears, eczematoid dermatitis and bloody diarrhea. Pediatrics 13:133–139. Ariga T, Yamada M, Sakiyama Y, Tatsuzawa O. 1998. A case of Wiskott-Aldrich syndrome with dual mutations in Exon 10 of the WASP gene: An additional de novo one-base insertion, which restores frame shift due to an inherent one-base deletion, detected in the major population of the patient’s peripheral blood lymphocytes. Blood 92:699–701. Ariga T, Kondoh T, Yamaguchi K, Yamada M, Sasaki S, Nelson DL, Ikeda H, Kobayashi K, Moriuchi H, Sakiyama Y. 2001. Spontaneous in vivo reversion of an inherited mutation in the Wiskott-Aldrich syndrome. J Immunol 166:5245–5249. Badour K, Zhang J, Siminovitch KA. 2004. Involvement of the Wiskott-Aldrich syndrome protein and other actin regulatory adaptors in T cell activation. Semin Immunol 16:395–407. Derry JM, Ochs HD, Francke U. 1994. Isolation of a novel gene mutated in Wiskott-Aldrich syndrome. Cell 78:635–644. Hirschhorn R, Yang DR, Puck JM, Huie ML, Jiang CK, Kurlandsky LE. 1996. Spontaneous in vivo reversion to normal of an inherited mutation in a patient with adenosine deaminase deficiency. Nat Genet 13:290–295. Hirschhorn R. 2003. In vivo reversion to normal of inherited mutations in humans. J Med Genet 40:721–728. Holzelova E, Vonarbourg C, Stolzenberg MC, Arkwright PD, Selz F, Prieur AM, Blanche S, Bartunkova J, Vilmer E, Fischer A, Le Deist F, Rieux-Laucat F. 2004. Autoimmune lymphoproliferative syndrome with somatic Fas mutations. N Engl J Med 351: 1409–1418. Jin Y, Mazza C, Christie JR, Giliani S, Fiorini M, Mella P, Gandellini F, Stewart DM, Zhu Q, Nelson DL, Notarangelo LD, Ochs HD. 2004. Mutations of the Wiskott-Aldrich syndrome Protein (WASP): hotspots, effect on transcription, and translation and phenotype/genotype correlation. Blood 104: 4010–4019. Kawai S, Minegishi M, Ohashi Y, Sasahara Y, Kumaki S, Konno T, Miki H, Derry J, Nonoyama S, Miyawaki T, Horibe K, Tachibana N, Kudoh E, Yoshimura Y, Izumikawa Y, Sako M, Tsuchiya S. 2002. Flow cytometric determination of intracytoplasmic Wiskott-Aldrich syndrome protein in peripheral blood lymphocyte subpopulations. J Immunol Methods 260:195–205. Konno A, Wada T, Schurman SH, Garabedian EK, Kirby M, Anderson SM, Candotti F. 2004. Differential contribution of Wiskott-Aldrich syndrome protein to selective advantage in T- and B-cell lineages. Blood 15:676–678. Kozak M. 1987. An analysis of 50 -noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 20: 8125–8148. Kumaki S, Villa A, Asada H, Kawai S, Ohashi Y, Takahashi M, Hakozaki I, Nitanai E, Minegishi M, Tsuchiya S. 2001. Identification of anti-herpes simplex virus antibody-producing B cells in a patient with an atypical RAG1 immunodeficiency. Blood 98:1464–1468. Lutskiy MI, Beardsley DS, Rosen FS, Remold-O’Donnell E. 2005. Mosaicism of NK cells in a patient with Wiskott-Aldrich syndrome. Blood 106:2815–2817. Pittis MG, Ricci V, Guerci VI, Marcais C, Ciana G, Dardis A, Gerin F, Stroppiano M, Vanier MT, Filocamo M, Bembi B. 2004. Acid sphingomyelinase: identification of nine novel mutations among Italian Niemann Pick type B patients and characterization
HUMAN MUTATION 27(4), 370^375, 2006
of in vivo functional in-frame start codon. Hum Mutat 24: 186–187. Ramesh N, Anton IM, Hartwig JH, Geha RS. 1997. WIP, a protein associated with Wiskott-Aldrich syndrome protein, induces actin polymerization and redistribution in lymphoid cells. Proc Natl Acad Sci USA 94:14671–14676. Sasahara Y, Kawai S, Kumaki S, Ohashi Y, Minegishi M, Tsuchiya S. 2000. Novel mutations, no detectable mRNA and familial genetic analysis of the Wiskott-Aldrich syndrome protein gene in six Japanese patients with Wiskott-Aldrich syndrome. Eur J Pediatr 159:23–30. Sasahara Y, Fujie H, Kumaki S, Ohashi Y, Minegishi M, Tsuchiya S. 2001. Epstein-Barr virus-associated Hodgkin’s disease in a patient with Wiskott-Aldrich syndrome. Acta Pediatr 90:1348–1351. Sasahara Y, Rachid R, Byrne M, de la Fuente MA, Abraham RT, Ramesh N, Geha RS. 2002. Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol Cell 10:1269–1281. Stephan V, Wahn V, Le Deist F, Dirksen U, Broker B, MullerFleckenstein I, Horneff G, Schroten H, Fisher A, de Saint Basile G. 1996. A typical X-linked severe combined immunodeficiency due to possible spontaneous reversion of the genetic defect in T cells. N Engl J Med 335:1563–1567.
375
Wada T, Schurman SH, Otsu M, Garabedian EK, Ochs HD, Nelson DL, Candotti F. 2001. Somatic mosaicism in Wiskott– Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism. Proc Natl Acad Sci USA 98:8697–8702. Wada T, Jagadeesh GJ, Nelson DL, Candotti F. 2002. Retrovirusmediated WASP gene transfer corrects Wiskott-Aldrich syndrome T-cell dysfunction. Hum Gene Ther 13:1039–1046. Wada T, Konno A, Schurman SH, Garabedian EK, Anderson SM, Kirby M, Nelson DL, Candotti F. 2003. Second-site mutation in the Wiskott-Aldrich syndrome (WAS) protein gene causes somatic mosaicism in two WAS siblings. J Clin Invest 111: 1389–1397. Wada T, Schurman SH, Garabedian EK, Yachie A, Candotti F. 2005. Analysis of T-cell repertoire diversity in Wiskott-Aldrich syndrome. Blood 106:3895–3897. Wengler G, Gorlin JB, Williamson JM, Rosen FS, Bing DH. 1995. Nonrandom inactivation of the X chromosome in early lineage hematopoietic cells in carriers of Wiskott-Aldrich syndrome. Blood 85:2471–2477. Zhu Q, Zhang M, Blaese RM, Derry JM, Junker A, Francke U, Chen SH, Ochs HD. 1995. The Wiskott-Aldrich syndrome and X-linked congenital thrombocytopenia are caused by mutations of the same gene. Blood 86:3797–3804.
Human Mutation DOI 10.1002/humu
