TAIR7 Annotations (green=protein-coding gene, red=pseudogene/transposon, others=various RNA types). Log_2 Ratio Columbia
A. thaliana Jan. 2004 chr3:7,249,614-7,249,727 (114 bp) Window Position chr3: 7249630 7249640 7249650 7249660 7249670 7249680 7249690 7249700 7249710 7249720 ---> AATATCACACAT TGGAACCGGGTATCT TAATAGAACATCTGAAGCTCCCTGCAAACCACAAAAAGT TCAACTGTAAATATATGTGATGAAATGAATGAT TATGT TGTGT T TGGA Q I S H I G T G Y L N R T S E A P C K P Q K V Q L * I Y V M K * M I M L C L E K Y H T L E P G I L I E H L K L P A N H K K F N C K Y M * * N E * L C C V W S N I T H W N R V S * * N I * S S L Q T T K S S T V N I C D E M N D Y V V F G TAIR7 Annotations (green=protein-coding gene, red=pseudogene/transposon, others=various RNA types) D C M P V P Y R L L V D S A G AT3G20740.1 I 7_ Log_2 Ratio Columbia WT PolII/WTA PM Unique (TAS 1.1.02 bpmapNewer tpmap.mT.3) Lg(PolII/WTA)
0-7 _ 0.219628 _
Mononucleosomes: Ratio Frag. Len. (empir. from paired-ends) Smeared Uniq. Unistrand Dens. to 1x Uniform Theory
0.134829 _ 0.0225 _
Nucleosome Prediction Probabilities via Segal, et al. (based only on genomic sequence)
Histone H3K4 Monomethylation to H3 -> TileMap HMM Histone H3K4 Dimethylation to H3 -> TileMap HMM Histone H3K4 Trimethylation to H3 -> TileMap HMM Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via MNase Digestion Z-Scores of NimbleGen Log Ratios Histone H3K9 Dimethylation to H3 via Crosslinking Histone H3 Lysine K27 Trimethylation Original Unique HMM BPmap
H3K27-triMeth
LHP1 DamID HMM
LHP1 DamID HMM
LHP1 GATC Merged Low Nucleosome Density HMM
LowNucDensHMM
Methylation in Wild Type (Columbia->mCIP->bkgndCorr->uniqueProbes->TileMap pV)
Col.mCIP:buTMap
Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->uniqueProbes->TileMap pV)
ddc.mCIP:buTMap met1.mCIP:buTMap Col.HMBD:buTMap
Methylation in Single Mutant (met1->mCIP->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->uniqueProbes->TileMap pV) Methylation in Wild Type (Columbia->mCIP->bkgndCorr->remapProbes->TileMap pV)
Col.mCIP:brTMap
Methylation in Triple Mutant (ddc->mCIP->bkgndCorr->remapProbes->TileMap pV)
ddc.mCIP:brTMap met1.mCIP:brTMap
Methylation in Single Mutant (met1->mCIP->bkgndCorr->remapProbes->TileMap pV) Methylation in Wild Type (Columbia->HMBD->bkgndCorr->remapProbes->TileMap pV)
