Wnt3a gradient converts radial to bilateral feather symmetry via topological arrangement of epithelia Zhicao Yue, Ting-Xin Jiang, Randall Bruce Widelitz, and Cheng-Ming Chuong* Department of Pathology, Keck School of Medicine, University of Southern California, Los Angeles, CA 90033 Edited by Jeremy Nathans, The Johns Hopkins University School of Medicine, Baltimore, MD, and approved November 28, 2005 (received for review August 9, 2005)
axis determination 兩 dermal papilla 兩 evo-devo (evolution and development) 兩 morphogenesis 兩 skin appendages
A
s the genomics of different organisms are gradually revealed, we need to learn more about how these 1D molecular codes are transformed to form a variety of biological forms, as described by D’Arcy Thompson (1). Although the basic information is genetically determined, the organization of cells and their collectives appears to operate at a different level and follow rules we do not fully understand. Here we use feather follicles, one of the most complex epithelial organs, to decipher the architectural principles of how cells are arranged in place and time to build the functional forms in the context of ‘‘topobiology’’ (2). The origin and evolution of feathers have been of great interest (3, 4), particularly with the recent discoveries of feathered dinosaurs in Northern China (5, 6). From the many intermediate feather forms, we learned that feathers evolved through stepwise evolutionary novelties to produce diverse morphology with new functions (7, 8). Today’s birds have evolved region-specific feather forms, ranging from radially symmetric downy feathers to bilaterally symmetric flight feathers (Fig. 1a). We must look further into the molecular and developmental mechanisms that make these processes possible. The feather has a follicular structure with the dermal papilla (DP) at its base (9–11). The feather filament is a cylindrical structure with mesenchymal pulp inside (Fig. 1b). Moving up the feather shaft from the proximal to the distal end, there are the collar (where cells actively proliferate), the ramogenic zone
www.pnas.org兾cgi兾doi兾10.1073兾pnas.0506894103
(where barb ridges start to form), and maturing feather branches (where barb ridges form the ramus and barbule plates that keratinize to become barbs). In downy feathers (radially symmetric), all barb ridges are parallel to the long follicular axis. In flight feathers (remiges), bilaterally symmetric barb ridges converge obliquely toward the anterior follicle, leading to fusion and the creation of the rachis (Figs. 1c and 5). Although remiges located in the more distal wing become bilaterally (left–right) asymmetric (3), this will not be studied here. Results Molecular and Cellular Differences of Downy and Flight Feathers. We
first analyzed the difference among embryonic downy (radial), adult downy (more radial), and adult flight (bilateral) feathers (Fig. 1a). Sonic hedgehog (Shh) expressing marginal plates were used to delineate the orientation of barb ridges in developing embryonic feather buds (20, 21). Here we use opened adult feather follicle preparations (Fig. 1a⬘) to further analyze barbridge organization in mature follicles (Fig. 1c). In radially symmetric embryonic downy feathers, barb ridges originate simultaneously early in development or at random positions around the feather germ (22). In flight feathers, the rachis forms in the anterior, whereas new barbs are continuously generated from the posterior barb generative zone (9, 19). Through helical barb-ridge organization, barbs reach the rachis with an angle (ref. 23; we use ‘‘helical organization’’ instead of ‘‘helical growth,’’ because this event involves only cell rearrangement, but ‘‘growth’’ usually implies the involvement of cell proliferation in the context of cell biology). The angle of helical organization is bigger in flight-feather follicles, smaller in adult downy feather follicles, and 0° in embryonic downy feathers (Fig. 1c). The final barb-to-rachis angle in mature feathers results from this angle of helical barb-ridge organization and the expansion angle of the barb at the emergence of mature feathers (23). How are newly generated epithelial cells guided to form their specific barb patterns? It was proposed that new cells may have a tendency to move toward the rachis, and there may be a one barb–one clone lineage relationship (ref. 17; Fig. 1d, i), or that cells may be deposited along the vertical axis of feather follicles independent of barb organization (ref. 23; Fig. 1d, ii). To differentiate these possibilities, we injected the follicle base with 1,1⬘-dioctadecyl-3,3,3⬘,3⬘-tetramethylindocarbocyanine (DiI). Forty-eight hours later, the follicles were opened and photographed, then superimposed with the image of Shh in situ hybridization (Fig. 1e). The labeled cells left a straight track. Therefore, the experiments favored the second possibility, uncoupling cell lineage from cell arrangement events during barbConflict of interest statement: No conflicts declared. This paper was submitted directly (Track II) to the PNAS office. Abbreviations: DP, dermal papilla; Dkk1, Dickkopf1; RCAS, replication-competent avian sarcoma virus; BMP, bone morphogenetic protein; DiI, 1,1⬘-dioctadecyl-3,3,3⬘,3⬘-tetramethylindocarbocyanine; PE, papillar ectoderm; Wnt, Wingless int; Shh, Sonic hedgehog. *To whom correspondence should be addressed. E-mail:
[email protected]. © 2006 by The National Academy of Sciences of the USA
PNAS 兩 January 24, 2006 兩 vol. 103 兩 no. 4 兩 951–955
DEVELOPMENTAL BIOLOGY
The evolution of bilaterally symmetric feathers is a fundamental process leading toward flight. One major unsolved mystery is how the feathers of a single bird can form radially symmetric downy feathers and bilaterally symmetric flight feathers. In developing downy feather follicles, barb ridges are organized parallel to the long axis of the feather follicle. In developing flight-feather follicles, the barb ridges are organized helically toward the anterior region, leading to the fusion and creation of a rachis. Here we discover an anterior–posterior molecular gradient of wingless int (Wnt3)a in flight but not downy feathers. Global inhibition of the Wnt gradient transforms bilaterally symmetric feathers into radially symmetric feathers. Production of an ectopic local Wnt3a gradient reoriented barb ridges toward the source and created an ectopic rachis. We further show that the orientation of the Wnt3a gradient is dictated by the dermal papilla (DP). Swapping DPs between wing covert and breast downy feathers demonstrates that both feather symmetry and molecular gradients are in accord with the origin of the DP. Thus the fates of feather epidermal cells are not predetermined through some molecular codes but can be modulated. Together, our data suggest feathers are shaped by a DP3 Wnt gradient3helical barb ridge organization3creation of rachis3bilateral symmetry sequence. We speculate diverse feather forms can be achieved by adjusting the orientation and slope of molecular gradients, which then shape the topological arrangements of feather epithelia, thus linking molecular activities to organ forms and novel functions.
Fig. 1. Cells arrange into diverse feather forms with bilateral or radial symmetry. (a) Gross morphology of feather from a single chicken. On the left, more bilateral symmetry; on the right, more radial symmetry. (a⬘) Open follicle preparation. (b) Schematic feather follicle drawing. (c) Barb ridge orientation in radially and bilaterally symmetric feather follicles. Whole-mount Shh in situ hybridizations reveal that barb ridges insert into the rachidial ridge (rr) with the helical insertion angle, . (d and e) Uncoupling cell lineage from barb ridge organization. (d) Open follicle preparations stained by Shh in situ hybridization. rr (yellow arrow), barb generative zone (bg, green arrowhead), and the possibilities of barb-ridge organization (i and ii). The green arrow represents each possibility. A, anterior; P, posterior. (e) DiI (red)-labeled cells were displaced along a straight track. The photograph was superimposed with the Shh-stained follicle. Arrowhead, initial injection site. ( f and g) A–P molecular gradient. ( f) Longitudinal (A–P) feather sections with Wnt3a in situ hybridization. Similar distributions and levels were observed in downy feathers, but an A–P gradient exists in flight feathers. Red blocks, schematic representation of Wnt3a gradient. (g) Feather-follicle dissection diagram. Semiquantitative RT-PCR from anterior (A), middle (M), and posterior (P) regions of a bilaterally symmetric feather shows an A–P gradient. [Scale bars: (a) 1 cm, (b) 100 m, (c–f ) 0.5 mm.]
ridge organization. The end result is helical organization of barb ridges toward the rachis. What molecular mechanism, then, causes barb ridges to organize with a slanted angle? We analyzed cellular and molecular asymmetries at the ramogenic zone. The liver cell adhesion molecule was homogenously expressed throughout the feather follicle epithelium (ref. 19; not shown). Interestingly, several Wingless int (Wnt) family members (Wnt3a, Wnt 5a, Wnt8c, and Wnt11) showed higher expression in the anterior兾rachis side but none or lower expression in the posterior barb generative zone (Wnt3a is shown as an example in Fig. 1f; Wnt 5a is shown in Fig. 6, which is published as supporting information on the PNAS web site). To show that these asymmetric expressions constitute a gradient distribution, the follicle was dissected, and the ramogenic segment was removed as a horizontal disk. The disk was further divided into three portions and analyzed with semiquan952 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0506894103
Fig. 2. Perturbation of the Wnt gradient changes feather forms. (a) Conversion of feather vanes from bilateral (b) to radial symmetry (r). Some feathers are chimeric, with bilateral symmetry in the distal vane and radial symmetry in the proximal vane. RCAS genes used (Dkk1 and Wnt3a) are shown in yellow. Gradual alteration of barb-to-rachis angle (blue blank arrow and arrow) is shown in Dkk1 specimens. (a⬘) Line tracings. (b) Cross sections at the ramogenic zone are stained with antibody to virus GAG protein. The nearly homogeneous staining suggests a high and even expression level, flattening the endogenous gradient. The result is a radial symmetric feather. Some disorganized barb ridges can also be seen. This affects barb-ridge differentiation but not their orientation and will not be pursued here. (c) Localized RCAS-Wnt3a-transduced follicles. Serial sections are reconstructed in 3D to help visualize the spatial configuration. A new rachis (yellow) is located at the side of high viral transduction (purple). Blue, the original rachis. [Scale bars: (a) 1 cm, (b) 1 mm.]
titative RT-PCR (Fig. 1g). The expression of Wnt 3a showed graded levels along the A–P axis. Although in the rest of this work, we refer to this graded distribution as a Wnt gradient to facilitate discussions, we appreciate that these are transcript gradients, and it would be ideal to determine a Wnt protein or activity gradient in the future. Global Perturbation of Wnt Gradient. To determine the role of the endogenous Wnt gradient, we perturbed the gradient using plucking兾regeneration兾transgenic misexpression techniques (15). The Wnt antagonist Dickkopf1 (Dkk1) is a secreted factor that inhibits Wnt signaling (24, 25). We used retrovirus replication-competent avian sarcoma virus (RCAS) to overexpress Dkk1 and observed a chimeric feather with gradual conversion from the bilateral symmetric feather vane to the more radially symmetrically arranged barbs (Fig. 2 a and a⬘; 75%, n ⫽ 25). An example (green box) illustrates the gradual alteration of the barb-to-rachis angle from ⬇40° to a much sharper 15° (Fig. 2a, arrows). For the mature feather, because cells are dead, we Yue et al.
cannot detect their viral expression directly. The transition of morphology in the middle of the vane is most likely, because viral transduction became widespread halfway through the growth of this feather. We also tested the effect of ectopic Wnt gene expression. Depending on the distribution, two categories of phenotypes were observed. When high levels of RCAS-Wnt3a were expressed in the whole follicle, it flattened the endogenous Wnt gradient, and the feathers became more radially symmetric (Fig. 2a). The nearly homogenous expression of viral GAG protein is shown in Fig. 2b, and with this protocol, most expression is in the epidermis. Depending on the time and level of viral expression, the feathers may show a reduced rachis size or, in some cases, no rachis at all, producing fewer A–P-polarized feathers (Fig. 2 a and a⬘). Controls using RCAS–LacZ show typical bilateral symmetric vanes. These phenotypes are specific to the Wnt pathway, because RCAS–bone morphogenetic protein (BMP), –noggin, –Shh, and several other genes do not produce these types of changes (ref. 15 and not shown). When localized viral genes were expressed (judged by a localized region of viral misexpression), we observed an ectopic rachis was induced (Fig. 2c). The relationship between the new rachis position and the site of high viral transduction is best appreciated in 3D reconstruction (Fig. 2c). Interestingly, the site of the new rachis was at the site of highest RCAS–Wnt3a virus levels. All together, in RCAS–Wnt3a feathers (n ⫽ 37), 41% showed regions of radial symmetry, and 54% showed new rachis positions. Local Perturbation of the Wnt Gradient. To further analyze the
effect of the Wnt3a gradient in this process, we implanted beads soaked with Wnt3a in the developing feather follicle in vivo and allowed it to grow for another 48 h. Open-feather follicles were prepared (Fig. 1a⬘), and Shh was used to reveal the orientation of barb ridges. In flight feathers, barb ridges meet the rachidial ridge (Fig. 3a, yellow arrow) with the helical angle (Fig. 3a). Opposite to the rachis is the barb generative zone, which forms Yue et al.
Fig. 4. The DP can alter the Wnt3a gradient and determine feather symmetry. (a) Wing covert (Wi) and breast downy (Br) feathers were used to represent bilaterally and radially symmetric feathers. DPs were swapped between these two follicle types. Regenerated feather forms are in accordance with the origin of the DPs. (b) Longitudinal sections (along the A–P plane) of control and chimeric follicles were processed for Wnt3a in situ hybridization. A–P gradients were observed in follicles with wing covert DP. Red blocks, schematic representation of Wnt3a gradient.
a triangle and is designated as the posterior side (refs. 9, 21; Fig. 3a, green arrowhead). When a Wnt3a-coated bead was placed near the original rachis, it induced a new rachis and redirected barb ridges to curve toward the bead. This is particularly obvious for barb ridges located between the original and ectopic rachis (Fig. 3 b and b⬘). When the bead was placed sufficiently away from the original rachis, a new ‘‘posterior triangle’’ (i.e., barb generative zone) was induced together with a new rachis. The barb ridges are now reoriented to form mirror image-duplicated axes, A-P-P-A, compared with the original A–P organization (Fig. 3 c and c⬘). Control beads with BSA have no effect. Thus, the Wnt pathway exerts a direct effect on barb-ridge organization, whereas their involvement in the formation of the expansion angle remains to be determined. The Wnt pathway is versatile (26), and the downstream cellular mechanism of Wnt3a may be determined in future studies. In comparison, TGF1 inhibits barb ridge formation but has no effect on the orientation of adjacent barb ridges (Fig. 3 d and d⬘). EGF or FGF10 also have no such effects (not shown). Epithelial–Mesenchymal Recombination Between Downy and Flight Feathers. How was the Wnt3a gradient established? Classical
experiments showed that the DP controls the morphology of regenerated feathers, although in some earlier studies, the papillar ectoderm (PE) was not removed from the DP (17, 18, 27). Here we developed a way to remove the PE from the DP (see Materials and Methods). We swapped DPs between wing covert and breast downy feathers. Wing covert feathers are used here to represent bilaterally symmetric feathers, because DP swapping must be done by using similarly sized follicles; flight-feather DPs are too big to be accommodated by breast downy feather follicles. The chimeric feathers showed their symmetric forms are in accordance with the origin of the DPs (Fig. 4a; 100%, n ⫽ 25). The presence and absence of a Wnt3a gradient were also in accord with the origin of the DPs (Figs. 1f and 4b). Mock DP transplant controls did not show changes (not shown). These results are consistent with the embryonic recombination study showing that downy兾bilateral feather symmetry is based on epithelial–mesenchymal interactions (dictated by the DP), whereas barb morphology is determined by an intraepithelial event (28). Together, these studies suggest that barb-ridge organization is via cell rearrangement, not proliferation, which is in response to local molecular gradients dictated by the DP PNAS 兩 January 24, 2006 兩 vol. 103 兩 no. 4 兩 953
DEVELOPMENTAL BIOLOGY
Fig. 3. Local perturbation of the Wnt3a gradient reorients barb ridges. (a and a⬘) Control beads (BSA) have no effect on barb ridge organization. , angle of helical organization. (b and b⬘) Wnt3a beads (blue) placed near the original rachis induced an ectopic rachidial ridge (err, small yellow arrow). The original rachidial ridge is indicated by the large yellow arrow. The direction of barb ridges, particularly those between the original rachis and ectopic rachis, are reoriented. (c and c⬘) Wnt3a beads (blue) placed away from the original rachis (large yellow arrow) induced an ectopic rachidial ridge (small yellow arrow) and a new ectopic barb generating zone (ebg, green arrowhead). Because the barb ridges were reorientated, duplicated A–P axes were created. (d and d⬘) TGF1 beads led to a patch of inhibited barb ridge formation but did not change the orientation of barb ridges or the symmetric form of the feather. The effect was similar to that induced by BMPs. (Insets) Individual expected gradients (solid red) and their sum (broken red line). (Scale bars: 1 mm.)
Fig. 5. A model linking feather-symmetric forms and molecular gradients. The basic design of feathers allows variations of feather shape and symmetry to occur by varying just a few parameters (23). Barb ridges are oriented in parallel to the feather follicles in radially symmetric feathers ( ⫽ 0) but form an angle of helical organization with the rachidial ridge (rr). The barb ridges slant obliquely, because they are composed of a vertical component and a horizontal component. The vertical displacement is caused by feather growth, shown as vector AB. The force to have barb ridges oriented horizontally to the anterior side is shown as vector AC, to which the Wnt3a gradient has contributed. There are likely to be other molecules involved, but Wnt3a is illustrated here as an example, and this model provides a conceptual framework. The sum of vectors AB and AC is vector AD, leading to the helical organization of barb ridges toward the rachis. In radially symmetric feathers, there is only a vertical component AB. A gradual increase of the component AC may lead to feather morphologies ranging from more radial to more bilateral symmetry (Fig. 1 A).
(Fig. 5). The symmetry is without regard to the epidermal cell origin, and their fates are not predetermined. Discussion The feather is unique in its complex architecture and seemingly endless variation of forms (7, 9, 29). We propose the following events during the morphogenesis of feather follicles (Fig. 5). (i) Although embryonic feathers are known to form A–P asymmetry (21, 30), molecules do not form gradients in radially symmetric feathers, but they form gradient peaks toward the anterior in flight feathers [A–P gradient, e.g., Wnt3a, Wnt 5a, and Keratin A (data not shown)]. These molecular gradients help establish asymmetric arrangements of cells in the collar region and ramogenic zone. (ii) In bilaterally symmetric feathers, barb ridges are aligned toward the anterior end and eventually merge into the rachis with an angle of helical organization . In radially symmetric feathers, barb ridges form parallel to the long axis of feather follicles, and ⫽ 0. Feather keratinocyte precursors are 954 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0506894103
flexible; they can be organized into different forms during different molting cycles (9) or through regeneration after plucking. Here we show an ectopic Wnt gradient can reorient the topological arrangements of barb-ridge keratinocytes. Wnt3a attracts barb ridges to bend toward sources of higher Wnt3a concentrations, leading to the formation of the rachis. Tuning each process at each step can lead to different 3D configurations of feather branches, thus giving rise to the large diversity of feather forms (23). As demonstrated in the example here, the identification of the molecular bases for these processes is now possible. In our previous work, we showed that BMP caused the formation of an enlarged rachis, whereas noggin led to the production of multiple small rachides in the original rachis location (15). The fusion and creation of new barb ridges involve Shh兾Bmp2 signaling in the marginal plate epithelium (20, 21). This differs from the results here, in that a localized peak of Wnt signaling can specify the location of the rachis, and a homogenous level of Wnt eliminates A–P polarity and rachis formation. On the other hand, ectopic expression of BMP or noggin does not alter the rachis position or A–P axis. In addition to helical organization, bilaterally symmetrical feathers are characterized by the localization of new barb-ridge creation posteriorly and fusion of barb ridges anteriorly to create the rachis (21). Our results indicate that the A–P Wnt gradient plays a role in the polarized localization of these processes to either the anterior or posterior end of the feather follicle. How does the event downstream of the Wnt gradient influence the helical organization of barb ridges in the feather-filament epithelial cylinder? It does not appear to be mediated by -catenin, because -catenin nuclear staining does not appear until keratinocytes are in the differentiating barbule plates above the ramogenic zone (not shown). The Wnt noncanonical pathway has been shown to modulate cell shape and movement within an epithelial sheet and will have to be evaluated in the future (26, 31). After this work was submitted, an activator–inhibitor model of embryonic feather branching was proposed (32). In this model, activators and inhibitors can transform the smooth circumference of feather cylindrical epithelia into discrete numbers of barb ridges by the formation of periodically arranged Shh兾 BMP2-positive marginal plates; thus, a radial symmetric downy feather will form. The downy feather also shows occasional random bifurcation, fusion, and initiation of stripes due to instability in this space-filling patterning process (21, 32). When an additional dorsal兾ventral polarity (or anterior兾posterior in the terminology here) is imposed on top of this local activator– inhibitor mechanism, there is less inhibitor activity in the anterior rachis region but more activator activity in the posterior region. Thus, there is extinction of activator stripes as barb ridges approach the anterior midline but emergence of additional activator stripes in the posterior end. Through this mechanism, the radial symmetric feather is transformed into a bilaterally symmetric feather. The Wnt3a gradient we observed here fit the criteria of this global anterior–posterior polarity well. Indeed, elimination of this gradient leads to the transformation of bilateral symmetric feathers to become radially symmetric (Fig. 2). In open adult feather-follicle preparation, the Shh-positive stripes vividly illustrate the helical organization, emergence, and extinction of these barb ridges (Fig. 3; compare with figure 2 of ref. 32). How the global Wnt gradient and local Shh兾BMP2 signaling or other unidentified factors are coupled remains to be determined. What set up the global anterior–posterior Wnt gradient? Here, we show that swapping DP and epithelial follicles leads to newly regenerated feathers with symmetry in accordance with that of the origin of the DPs (Fig. 4). Recently, we showed that feather epidermal stem cells are in a ring-configured niche, horizontally placed in the radial symmetric feathers but tilted Yue et al.
anteriorly– posteriorly in bilateral symmetric feathers (11). Thus, these epidermal stem cells are true stem cells that can be modulated into distinct symmetric forms by the different microenvironments created by the DP. Furthermore, an A–P Wnt gradient is involved in the property of this microenvironmental niche (Fig. 5). In summary, we report a mechanism nature uses to convert organ radial symmetry to bilateral symmetry, a simple molecular gradient. Distinct feather forms provide a unique opportunity to visualize how dialogues between cells and molecules are cast into feather morphologies, linking molecular activities to organ forms, and allowing the evolution of novel feather functions.
Retrovirus Production and Misexpression. RCAS viruses were cultured and harvested as described (13). RCAS-LacZ, RCASWnt3a, and RCAS-Dkk1 were used in this study. Dkk1 is a gift from S. Millar (University of Pennsylvania, Philadelphia) and A. Lassar (Harvard University, Boston), which we subcloned into RCAS-Bryant polymerase envelope protein A (14). Remiges of ⬇1-mo-old chicks were plucked, transduced with retrovirus, and allowed to regenerate for up to 2 mo (15). Different levels of viral transduction can be adjusted by using different viral titers or changing the number of injection sites. The extent of viral infection was visualized with GAG immunostaining (Hybridoma Bank, University of Iowa, Iowa City).
Materials and Methods
3D Reconstructions of Serial Sections. Eight-micrometer feather
DiI Labeling and Bead Implantation. DiI (Molecular Probes) and
follicle sections were digitized by using IGL TRACE software (Boston University, Boston). These images were aligned and rendered as a 3D view of the feather follicle by using RHINOCEROS software (16).
RT-PCR Analysis. Total RNA was isolated according to the man-
ufacturer’s guide (Qiagen, Valencia, CA, RNAeasy kit). PCR was carried out by using the annealing temperature 60°C. Primers used were: Wnt3a (GAAGCTGGAAGGACCTCTAT and GGTCACAACCGTCAATCCC) (35 cycles), GAPDH (GGCGAGATGGTGAAAGTCG and CAGTTGGTGGTGCACGATG) (28 cycles). Immunostaining and in Situ Hybridization. Immunostaining and in
situ hybridization were processed as described with an automated Discovery system (Ventana, Tucson, AZ) (12). RNA probes included in this study involve Shh and Wnt3a (from A. McMahon, Harvard University, Boston). Open-feather follicles were prepared by making a cut between the rachis and the barb generation zone. The follicles were opened and laid flat on a dish. 1. Thompson, D. (1917) On Growth and Form, reprinted (1992) (Dover, New York). 2. Edelman, G. M. (1988) Topobiology: An Introduction to Molecular Biology (Basic Books, New York). 3. Feduccia, A. (1999) The Origin and Evolution of Birds (Yale Univ. Press, New Haven, CT), 2nd Ed. 4. Prum, R. O. & Brush, A. H. (2002) Q. Rev. Biol. 77, 261–295. 5. Zhou, Z., Barrett, P. M. & Hilton, J. (2003) Nature 421, 807–814. 6. Xu, X., Norell, M. A., Kuang, X., Wang, X., Zhao, Q. & Jia, C. (2004) Nature 431, 680–684. 7. Prum, R. O. (1999) J. Exp. Zool. 285, 291–306. 8. Chuong, C.-M., Wu, P., Zhang, F. C., Xu, X., Yu, M., Widelitz, R. B., Jiang, T. X. & Hou, L. (2003) J. Exp. Zool. B. 298, 42–56. 9. Lucas, A. M. & Stettenheim, P. R., eds. (1972) Avian Anatomy: Integument. Agriculture Handbook 362 (U.S. Dept. of Agriculture, Washington, DC). 10. Yu, M., Yue, Z., Wu, P., Wu, D.-Y., Mayer, J. A., Medina, M., Widelitz, R. B., Jiang, T.-X. & Chuong, C.-M. (2004) Int. J. Dev. Biol. 48, 181–191. 11. Yue, Z. C., Jiang, T.-X., Widelitz, R. B. & Chuong, C. M. (2005) Nature 438, 1026–1029. 12. Jiang, T.-X., Jung, H.-S., Widelitz, R. B. & Chuong, C.-M. (1999) Development (Cambridge, U.K.) 126, 4997–5009. 13. Widelitz, R. B., Jiang, T.-X., Lu, J.-F. & Chuong, C. M. (2000) Dev. Biol. 219, 98–114. 14. Suksaweang S., Lin, C. M., Jiang, T.-X., Widelitz, R. B. & Chuong, C. M. (2004) Dev. Biol. 266, 109–122.
Yue et al.
Surgery and DP Operations. Three-month-old chickens were anesthetized with ketamine and xylocaine (2:1, 10 mg兾kg). DP兾PE operations were done after Lillie and Wang (17, 18). The DP兾PE complex is immersed in trypsin兾EDTA in vitro for 10 min at 37°C. PE are then stripped from the DP. DP was then washed in DMEM containing 10% serum and transplanted back into an empty follicle. The complete removal of epithelium from the DP was verified with antibody to LCAM (19). All animal care was in accordance with institutional guidelines. We thank Drs. Richard Prum (Yale University, New Haven, CT), Gerald Edelman (The Scripps Research Institute, La Jolla, CA), and George Cotsarelis (University of Pennsylvania) for helpful input. We are grateful to Drs. C. Tabin (Harvard University) (for Shh and RCAS-Wnt3a), A. Lassar (Harvard University) (for Dkk1), S. Millar (University of Pennsylvania) (for Dkk1), and A. McMahon (Harvard University) (for Wnt3a) for providing reagents. We thank all Chuong lab members for discussion. This work is supported by National Institute of Arthritis and Musculoskeletal and Skin Diseases Grants AR 42177 and AR47364 (to C.-M.C.) and National Cancer Institute Grant 83716 (to R.B.W.). 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32.
Yu, M., Wu, P., Widelitz, R. B. & Chuong, C. M. (2002) Nature 420, 308–312. Fiala, J. C. & Harris, K. M. (2002) Microsc. Anal. 52, 5–7. Lillie, F. R. & Wang, H. (1941) Physiol. Zool. XIV, 103–133. Lillie F. R. & Wang, H. (1944) Physiol. Zool. 17, 1–32. Chuong, C. M. & Edelman, G. M. (1985) J. Cell Biol. 101, 1027–1043. Ting-Berreth, S. A. & Chuong, C. M. (1996) Dev. Dyn. 207, 157–170. Harris, M. P., Fallon, J. F. & Prum, R. O. (2002) J. Exp. Zool. 294, 160–176. Chuong, C. M. & Edelman, G. M. (1985) J. Cell Biol. 101, 1009–1026. Prum, R. O. & Williamson, S. (2001) J. Exp. Zool. 291, 30–57. Glinka, A., Wu, W., Delius, H., Monaghan, A. P., Blumenstock, C. & Niehrs, C. (1998) Nature 391, 357–362. Andl, T., Reddy, S. T., Gaddapara, T. & Millar S. E. (2002) Dev. Cell 2, 643–653. Veeman, M. T., Axelrod, J. D. & Moon, R. T. (2003) Dev. Cell 5, 367–377. Cohen, J. & Espinasse, P. G. (1961) J. Embryol. Exp. Morphol. 9, 223–251. Sengel, P. (1976) in Morphogenesis of Skin (Cambridge Univ. Press, London). p. 188. Chuong, C.-M., Chodankar, R., Widelitz, R. B. & Jiang, T. X. (2000) Curr. Opin. Genet. Dev. 10, 449–456. Chen, C. W., Jung, H. S., Jiang, T. X. & Chuong, C. M. (1997) Dev. Biol. 188, 181–187. Moon, R. T., Bowerman, B., Boutros, M. & Perrimon, N. (2002) Science 296, 1644–1646. Harris, M. P., Williamson, S., Fallon, J. F., Meinhardt, H. & Prum, R. O. (2005) Proc. Natl. Acad. Sci. USA 102, 11734–11739.
PNAS 兩 January 24, 2006 兩 vol. 103 兩 no. 4 兩 955
DEVELOPMENTAL BIOLOGY
beads (Wnt3a, TGF1: R & D Systems) were prepared as described (12). Three-month-old chickens were anesthetized with ketamine and xylocaine (2:1, 10 mg兾kg). DiI and beads were injected through the follicle wall. Follicles were collected at desired times and photographed or processed for whole-mount in situ hybridization.
