YV Integrin Subunit - The Journal of Biological Chemistry

Val. 266, No. 28, Issue of October 5, pp. 18593-18599,1991 Printed in U. S.A.

THEJOURNALOF BIOLOGICAL CHEMISTRY (c)

1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Individual Embryonic Fibroblasts Express Multiple @ Chains in Association with the(YV Integrin Subunit LOSS OF 83EXPRESSIONWITHCELLCONFLUENCE* (Received for publication, February 4, 1991)

Richard C. Bates$, Lynne M. Rankin$, CarolynM. Lucas$, Judith L. Scott$, Geoffrey W. Krissansena, and Gordon F. Burns$T From the $Cancer Research Unit, Faculty of Medicine, The University of Newcastle, Newcastle, New South Wales 2300, Australia and the §Departmentof Molecular Medicine, School of Medicine, University of Auckland, Aucklund, New Zealand

The a chain of the vitronectin receptor, av, has been and seven p chains have been identified, yielding at least 15 found in association with the integrin subunits 81, B3, known heterodimeric complexes (l),and includedin this or 85 on different cell types. We show here that cul- family arereceptors forcollagen, fibronectin,vitronectin, turedembryonicfibroblastssimultaneouslydisplay laminin, and fibrinogen (reviewed in Refs. 2 and 3). ~ 8 3avB1, , and (YV in association with two other Initially the integrinswere classified into subfamilies based subunits, one of which is probably 85. Polymerase on thespecific @ subunits (2). Itwas appreciated thatindividchain reaction analysis of single cells isolated by mi- ual p chains could associate with multiple a subunits, and it cromanipulation identified mRNA for av, 81, 83, and was considered that the specific properties of the dimeric 85 in six of eight clones. Immunoprecipitation of iodi- complexes were provided by the associated a chain. However, nated cell surface proteins witha monoclonal antibody one of the subfamilies (that defined by p3) consisted of two to av indicated that the relative proportions of the different B chains in association with av varied, par- members, the platelet glycoprotein GPIIb-IIIa (aIIbp3) and ticularly between two different cell lines. The cyto- the vitronectin receptor (avP3), and both members are able to bind several matrix proteins (4, 5). More recently, it has kinesplatelet-derivedgrowthfactor,transforming growth factor 81, and tumor necrosis factora did not also become clear that thea chain of the vitronectin receptor, av,’ can associate with several different (3 subunits in addition appear to alter this ratio although tumor necrosis facbeen reported to associate tor a increased the surface expressionof the crv-asso- to p3 (6-12). Thus, this subunit has ciated integrins; but overnight culture in basic fibro- with the classical (31subunit (11,12) or with a variant of this blast growth factorcaused a lower expression of a v b l subunit, termed (3n (10). In addition, av has been found to and av85 with no reduction in av83 expression. When form acomplex with anovel p chain,initially described the cell cultures were grown to complete confluence, functionally and biochemically as (3s (7) or (3x (6); molecular surface expressionof 83 was abolished, and the exprescloning has shown these molecules to be identical and the sion of an unknown 8 chain (Bu) became more promi- novel p chain has been named p5 (13-15). It remains to be nent. This effect was not overcome by culturing con- determined whether or not another p chain, P3b, associated fluent cells with basic fibroblast growth factor. Affin- with av on macrophages (8) is related to @5 or perhaps to a ity column chromatography showed that avB5 bound series of tissue-specific integrin (3 subunits. Finally, there are to vitronectin buta v a l did not, whereas avB1 but not data to suggest that an alternatively spliced form of the p3 av85 bound to fibronectin. These results suggestthat, subunit (16) may also associate with av onsome cells (7). on individual cells, the subunits found in association The complexities introduced by these recent findings have with avmay vary according to the proliferative capac-led to the suggestion that the current integrin classification ity of the cell and that the promiscuous 83 subunit is progressively replaced by subunits of individual li- scheme needs revision (11).But they also raise several interesting questions. Specifically, can individual cells simultanegand specificity. ously express more than one p chain in association with av, and, given that several of the av-p combinations can bind the same ligand(s)(5-12), what are the conditions that determine which p chain is expressed? Previous studies of cell populaCell binding to the extracellular matrix provides informa- tions have demonstrated that on differentcell types, av can tionalsignalsthatgreatly influencebehavior patterns of be found to be associatedexclusively with pl (11, 12), exclumigration, proliferation, and differentiation. Among the spe- sively with p5 (6, 15), or in association with both D l and p3 cific receptors for extracellular matrix proteins isa family of (10, l l ) , although in the latter cases the proportions of pl to integral cell surface proteins, termed integrins. Each of the p3 varied considerably on the different cell types and it was integrin receptors comprises a n a and (3 subunit in noncova- not clear whether or not there were different subpopulations lent association, and different permutationsof a and p chains of cells. Also, there have been conflicting reports about the provide functionally discretereceptors. Currently 11 a chains ligand specificity of the cuv-associated receptor complexes (6, 7, 11, 12), in particular, whether avp1 functions aasreceptor * This research was supported by the National Health and Medical Research Council, TheNationalHeartFoundation,andthe New South Wales State Cancer Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate thisfact. 1To whom correspondence should be addressed.

The abbreviations used are: av, the a chain of the vitronectin receptor; FGFb, basic fibroblast growth factor;PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; PAGE, polyacryalmide gel electrophoresis; TGFpl, transforming growth factor pl; TNFa, tumor necrosis factor a; bp, base pair(s).

18593

18594

Integrin Multiple

for vitronectin (12) or for fibronectin ( l l ) , althoughsuch discrepancies may be a reflection of the different cell types used (17). We have addressed these questions by isolating the mRNA from individual embryonic fibroblast cells and have used the polymerase chain reaction (PCR) to show the simultaneous presence of av, Dl, p3, and p5 in six of the eight clones examined. Immunoprecipitationexperimentsdemonstrated that each of the p chains was in association with a v in cells grown to subconfluence, but that cells grown to complete confluence totally lost avp3 expression while retaining surface expression of avpl and avp5 and additionally displaying av in association with another, unidentified p subunit. The presence of both avp1 and avp5simultaneously on the same cell also enabled us to compare directly the ligand specificity of these integrins, and itwas found that avplbinds fibronectin but not vitronectin, whereas avp.5 binds vitronectin but not fibronectin.

,f3 Chains av5'

CACATTGGTTACCACTAATGTCAC 3' GACGTCAAAAATTCAATACGATGT(antisense)

Pl

AATGGGAACAACGAGGTCATGGTT

03 P5

CATAACGGGCACGTTTAGGGTGTT TGCTCATTGGCCTTGCCGCCCTGC ACTATTCGTCAGTAGGAGTCTAGT TCCTGGCTGTGGTCGGTAGCATCC ACAAAGGAAGAGGCTCCCCGACCT

Negative controls for the PCR consistedof (i) no template and (ii) genomic DNA (1pg of DNA/PCR reaction). Flow Cytometry-Indirect immunofluorescent staining withmonoclonal antibodies and affinity-purified sheep anti-mouse antibodies conjugated with fluorescein isothiocyanate was carried out as described (20). Flow cytometric analysis was performed with FACScan (Becton Dickinson) and 10,000 cells were analysed for forward and right angle light scatter and fluorescent intensity. The fluorescent intensity was set atlogarithmic gain. Antibodies-The preparation andspecificity of the affinity-purified rabbit anti-GPIIIa (03) antibodies has been described previously (8, 21). The monoclonal antibodies usedwere LM142 (22)and 13C2 (23), both with specificity for the a chain of the vitronectin receptor. EXPERIMENTAL PROCEDURES Antibodies to the avp3 complex were LM 609 (22) and 23C6 (23) Materials-Octyl-0-D-glucopyranoside and Nonidet P-40 were pur(LM 142 and LM 609 were kindly provided by Dr. David Cheresh chased from Boehringer Manheim, N a ' T from Australian Radioiso(Scripps Clinic, CA) and 13C2 and 23C6 by Dr. M. Horton (Imperial topes, x-ray film (Hyperfilm-MP) from Amersham Corp., the synSZ 21 (24) Cancer Research Fund, London, United Kingdom), and theticpeptideGly-Arg-Gly-Asp-Ser-Pro fromAuspep Proprietary and LM 534 (25) were the antibodies used to identify 63 and Pl Ltd., Melbourne, and fibronectin from Collaborative Research Inc. respectively. The molecular mass markers used were myosin (200 kDa), 0-galacat the cell surface by Immunoprecipitation-Cellswerelabeled tosidase (116 kDa), phosphorylase b (94 kDa),bovine serum albumin lactoperoxidase-catalyzed iodination essentially as described previ(67 kDa), and ovalbumin (45 kDa), and they and other electrophoretic ously (8,26). For32Pexperiments, the biosynthetic labeling with [3zP] reagents were obtained from Bio-Rad Laboratories. The cytokine, orthophosphate and phorbol myristate acetate stimulationwere carplatelet-derived growth factor was from Collaborative Research Inc., ried out exactly asdescribed by Freed et al. (7). The cells were then mM Tris-HC1, pH 7.4,150 mM sodium and tumor necrosis factor a from Immunex. Amplitaq DNA polym- lysed in 1% Nonidet P-40 in 10 erase was obtained from Cetus, andpoly(A)' RNA, Moloney murine chloride containing 20 mM iodoacetamide, 2 mM phenylmethylsulfoleukemia virus reverse transcriptase, and Sepharose beadswere from nyl fluoride, and 1 mg/ml bovine serum albumin (26) for 30 min, or Pharmacia LKB BiotechnologyInc. All otherreagents were pur- in an octyl glucoside lysis buffer (100 mM l-0-n-OCtyl-~-D-glUCOpyranoside, 10 mM Tris, 150 mM sodium chloride, 2 mM phenylmethylchased from Sigma and were of the highest grade available. Cells-The cells used were Flow 2000 embryonic fibroblasts (Flow sulfonyl fluoride, 20 mM iodoactamide, and 50 pg/ml soybean trypsin inhibitor) for 1 h. The lysate was centrifuged at 10,000 X g for 10 Laboratories, Sydney, Australia) and HEL, human embryonic fibromin,thenpre-clearedwithSepharose4B beadsfor 1 h at 4"C. blasts (Commonwealth Serum Laboratories, Melbourne, Australia). directly couThe cells were maintained in RPMI with 10% fetal calf serum and Immunoprecipitations were carried out using antibodies the Flow cells used between passagenumbers 19 and 29 and the HEL pled to Sepharose 4B and analyzed by SDS-PAGE and autoradiography as described (8, 26). cells between passage 17 and 19. Affinity Chromatography-Vitronectin was purified from human Single Cell Isolation and PCR Analysis-Individual Flow embryonic plasma by the method of Yatohgo et al. (27) using heparin affinity fibroblasts were harvested from subconfluent cultures with trypsin, diluted to low density, and single cells picked up with a drawn-out chromatography after activating the heparin-binding activity of the Pasteur pipette attached to a mouthpiece. The individual cells were vitronectin with 8 M urea. The purityof the vitronectin obtained and of commercial fibronectin was confirmed by SDS-PAGE and silver transferred into microtiter wells and checked microscopically before being used for PCR analysis essentially as described by Rappolee et staining analysis. The purified proteins were coupled to cyanogen al. (18).RNA was prepared by guanidium thiocyanate extraction (19) bromide-activated Sepharose 4B beads, packed into 1-ml columns and equilibrated with "complete" octyl glucoside buffer (50 mM 1-0and either used directly for PCR or storeda t -70 "C before use. 10 mM Tris, 150 mM sodium chloride, 2 Reverse transcription was performed in a 50-pl reaction volume n-octyl-P-D-glucopyranoside, for 1 h at 37 "C. Reverse transcription reaction mixture consistedof mM phenylmethylsulfonyl fluoride, 20 mM iodoacetamide, 50 pg/ml 5 pg of RNA (cell RNA and carrier tRNA), 50 mM Tris-HC1 (pH 8.3), soybean trypsin inhibitor, 1 mM calcium chloride, 1 mM magnesium chloride). Cell lysates in octyl glucoside buffer were allowed to bind 75 mM potassium chloride, 10 mM dithiothreitol, 3 mM magnesium 4 "C for 14-16 h and washed in 5-10 column chloride, 500 p~ each dATP, dTTP, dCTP, and dGTP (Pharmacia), to the columns at 500 pg/ml oligo(dT), and 10,000 units/ml Moloney murine leukemia volumes of complete octyl glucoside buffer. Elution was carried out virus reverse transcriptase. On completion of the reverse transcriptase by adding 1 ml of the peptide Gly-Arg-Gly-Asp-Ser-Pro a t 1 mg/ml reaction, 5-pl aliquots were used in the PCR reactions. PCR were in the samebuffer, leaving the column to equilibrate a t 4 "C for 2 h, carried out in 100-pl reaction volumes. The cycle protocolwas as and displacing the Arg-Gly-Asp peptide with 1 ml of the complete follows: cycles 1-5: 95 "C for 2 min, 55 "C for 1 min, and 72 "C for 1 octyl glucoside buffer containing 300 mM sodium chloride. The high min. Cycles 6-40: 95 "C for 1 min, 55 "C for 1 min, and 72 "C for 1 salt eluate was then physically displaced by positive pressure (with a 300 p1 of the eluate, and the min. The PCR reaction mixture consisted of 10 mM Tris-HC1 (pH pipette),thebeadsresuspendedin 8.3),50 mM potassium chloride, 1.5 mM magnesium chloride, 0.001% procedure repeated. The peptide and high salteluates were then gelatin (according to Perkin-Elmer Cetusprotocol for DNA amplifi- pooled and dialyzed overnight against octyl glucoside buffer prior to cation), 5 pl of cDNA, 1.25 mM dTTP, dATP, dCTP, and dGTP, 500 immunoprecipitation analysis. ng of primer 1, 500 ng of primer 2, and 0.5 pl of Amplitaq DNA RESULTS polymerase. On completion of the PCR reaction, products were examined on a 6.5% acrylamide gel, eluted from the gel, and cut with Individual Embryonic Fibroblasts Express Multiple Integrin appropriate restrictionenzymes in order to confirm that the predicted /3 Chainsin Association with au-Analysis of the surface DNA had been amplified. phenotype of embryonic fibroblasts by flow cytometry after Theprimers used were all 24-mersselected to encompassthe transmembrane and cytoplasmic domains to the stop codon and were indirect immunofluorescent staining with a panel of monoclonal antibodies indicated that these cells expressed the av constructed using a Pharmacia Gene Assembler Plus. The primers subunit in considerable excess over the p3 subunit, whether used were as follows.

Multiple Integrinp Chains measuredwith polyclonal (rabbit) antibody to 83 or by a monoclonal antibody to the avP3complex (Fig. L4). In addition, the profile of fluorescence obtained (Fig. L 4 ) indicated that the great majority of cells within the population exhibited this staining pattern, rather than there being overlapping subpopulations of cells each with a different phenotype. Immunoprecipitates of a v from cells surface labeled with ”‘iodine were examined by nonreducing-reducing SDSPAGE, and it was found that this a subunit was associated with a complex pattern of p chain polypeptides (Fig. 1B). To determine the nature of the different av-associated /3 chains, we performed a series of sequential immunoprecipitations with antibodies to different p subunits and analysed the results by one-dimensional SDS-PAGE. In these immunodepletion experiments (Fig. 2), precipitation with an authentic antibody toD l or top3 prior to precipitation with the

18595 A Mr

x 10-3

116-

94

I

66 I

B Mr

-

x 10-3 200

A

-

200

I 116 94

66

45

I

-

FIG.2. Sequential immunoprecipitation identified 81 and 83 subunits in association with the a chain of the vitronectin

1. I

CONTROL -‘ve

FLUORESCENCE

B M ~ - Non~ reduced

-

+ Reduced

XI0

200 116 94 66

45

I

receptor (av). A shows the autoradiographic results obtained from human embryonic lung fibroblastsused from passage 17, and B shows results from Flow 2000 embryonic fibroblasts from passage 26, but the procedures used werethe same in each experiment. Thecells were radioiodinated at the cell surface, lysed, and immunoprecipitated as described under “Experimental Procedures.” the In first precipitation (av) one-half of the lysate was precipitated with a monoclonal antibody (13‘22) to the a chain of the vitronectin receptor.The remaining lysate was then precipitated two sequential times with an antibody to Pl (LM534),two sequential times with an antibody (SZ21) to 83, then with the antibody to av. Each of the immunoprecipitates was then analyzed on a 7.5% SDS-polyacrylamide gel under nonreducing conditions, andthe autoradiogramsare illustrated. Relativemolecular masses (M,) are shown to the left.

t

i

FIG. 1. The av integrin subunit is expressed in excess over the 83 subunit andis associated with multiple B chains on the cell surface. A, the flow cytometric analysisof Flow 2000 embryonic fihroblastsafterindirectimmunofluorescent staining as described under “Experimental Procedures”is shown. The height of each peak is a measure of the number of cells, andthe abscissa shows the relative fluorescent intensity in arbitrary logarithmic units. In the bottom panel is shown the fluorescence obtainedwith a control (nonbinding) antibody mouse monoclonal antibody, andfor the experiment shown these were as follows: av, 13C2; p3, SZ21;avp3,23C6.The experiment was repeated three timeswith essentially identical results, and similar results were obtained when LM142 was substituted for 13C2, LM609 for 23C6, or when affinity-purified rabbit(polyclonal) anti-IIIa (p3) antibodies were used instead of SZ21. B shows reduced-nonreduced two-dimensional SDS-PAGE analysis obtainedwhen Flow 2000 embryonic fibroblasts were surface-labeled with ’”I and immunoprecipitated with an antibody (LM142)to av.

antibody to avremoved the p l and p3-like bands, respectively, that co-precipitated with the a subunit. These data indicate that one of the /3 chains associated with a v was p3, and another was Dl. However, after the depletion of both p3 and pl there remained an associated /3 chain which we had not identified, although the apparent molecular weight of this band indicated that it might be p5 (9). Wedid not have available a good precipitating antibody to p5 for this study, but Freedet al. (7) had shown that theps subunit, now known to be p5, was strongly phosphorylatedupon treatment of ‘*Ploaded osteosarcoma or adultfibroblast cells with thephorbol ester tetradecanoyl phorbol acetate. By following the same experimental protocol (7) with the embryonic fibroblasts, we found only one apparentp chain associated with av thatwas strongly phosphorylated under these conditions (Fig. 3). Further, the migration of this ”‘P-labeled band in SDS-PAGE gels was identical to thatof the unidentified band seen in the immunodepletion experiments(Fig. 3). Hence we deduce that this band represents thep5 subunit and that theav integrin of embryonic fibroblasts isassociated with pl, p3, and p5. To establish whether individual fibroblasts simultaneously expressed D l , p3, and p5 we performed PCR on single cells isolatedby micromanipulation. The mRNA was extracted from each of the cells, and sequences specific for av, pl, p3,

Multiple Integrinp Chains

18596

TABLE I PCR analysis of integrin subunits from individual clones

SEQUENTIAL 1 2 3 a V

aV

Eight singlecellsisolated by micromanipulation were analyzed. The specific primers used, the controls, and the cycles of amplification are as given under “Experimental Procedures.” Random samples of bands from individual clones were tested for confirmatory cleavage with appropriate restriction enzymes. Integrin subunit

No. ofcells that gave pos-a itive PCR result

nv

81

83

8

8

6

85 8

85’

8

mRNA. To datewe have found the additional PCR fragment in two different linesof embryonic fibroblasts (Flow 2000 and HEL)butnotinadult colonic fibroblasts whichexpress mRNA for /35 (CCD 18)*;it is possible that it represents an alternatively spliced form of p5 restricted to embryonic cells, 32 I25 as alternativelyspliced forms of other integrins,including p3, P I have been reported by others (16). If this is the case, and all FIG. 3. Sequential immunoprecipitation and 32Plabeling of the different mRNA are translated, these data suggest that identified 85 in association with av. Detergent extracts of surface-iodinated Flow embryonic fibroblasts were sequentially precipi- individual embryonic fibroblasts can simultaneously display tated three times with an antibody (23C6) to the avp3 heterodimeric Dl, p3, p5, and p5‘. complex (Sequential, tracks 1-3) then with an antibody (13C2) to the (r chain of the fitronectin receptor(Sequential, nu).The track labeled ( Y U and ““Pis the immunoprecipitate obtain’ed from the same cells biosynthetically labeled with :’)P, stimulated briefly with phorbol ester,andimmunoprecipitated with an antibody (13C2) to av as described under “ExperimentalProcedures.” The immunoprecipitates wereanalyzed by nonreducingSDS-PAGE on 7.5% gels, and the autoradiogramsare shown. The arrowheads indicatetherelative positions of the integrin subunits,av,61,and p5. bp

2804 : 404 331 242

190 147 110/111

67

I

= =

-

I

I

FIG.4. PCR analysis of integrin subunit mRNA f r o m two clones of Flow embryonic fibroblasts. Oligonucleotide primers spanning the cytoplasmic/transmembrane domains of the integrin subunits indicated were used to amplify cDNA prepared from mRNA isolated from two separate cellsfrom the Flow 2000 embryonic fibroblast line. The expected sizes of the mRNA amplified products are: (YV,250 bp; Dl, 300 bp; p3, 200 bp; p5, 250 bp. Molecular weight markers are shown in base pairs.

and 85 were expanded by PCR using primers specific foreach integrin subunit. The identity of the individual bands obtained with each pairof primers was confirmed by digestion with restriction enzymes and re-running the samples show to cleavage to fragments of the appropriate predicted size. Exclusion of genomic DNA as a source of the PCR fragments was made in control experiments usingisolated nuclear DNA (1 pg) treated with RNase. Eight individual cells were examined by PCR (Fig. 4 and Table I), and it was found that all expressedmRNAfor av, pl, and p5, and six had mRNA coding for p3. It is of interest that from all of the clones, the p5 primersyielded two bands by PCR (Fig. 4),the smaller of whichidentifiedmRNA of the size reported for p5 when tested by Northern blot analysis, and upon sequencing the PCR productwas identical to thepublished p5 sequence (data not shown). The larger band also illuminated this mRNA in Northern blots but identified in addition a larger species of

Regulation of the Surface Expression of Integrin Chains Associated with au-Repeated immunoprecipitation analysis of the Flow 2000 fibroblasts over a period of time sometimes showed a preponderance of avpl and avp5over avp3 on the cell surface, and on other occasions the major av-associated integrin was avB3 (data not shown). With continuous passage this line mainly displayed a-pl, p5, whereas another line of embryonic fibroblasts (HEL)expressed avp3 as itsmajor avassociated integrin, and despite thepresence of abundant pl integrin, very little pl was found in association with av (see Fig. 2 above). These data suggested to us that the relative proportions of the different p chains that associate with av might be regulated by different conditions of cell culture or by autocrines. T o determine whether the proportionsof the different avassociated p chains could be manipulated, cell cultures were treated witha range of cytokines known to modulate biological activity, then analyzed for their surfaceexpression of avassociated integrins. In short term assays (6 h of culture), platelet-derived growth factor and particularly tumor necrosis factor a (TNFa) up-regulated the surface expression of a v and all of the associated p chains, but there appeared to be no change in the relative proportions of the different p chains (Fig. 5), and transforming growth factor pl (TGF-Pl) appeared to have no effect over this short time period. Cells cultured overnight in thepresence of T N F a showed a slight increase inexpression of all of the integrin subunits (data not shown), and those cultured in basic fibroblast growth factor (FGFb) showed a decrease in 81 and p5 expression with no reduction in the amountof p3 associated withthe av subunit. Much more dramatic was the effect of the cultureconditions themselves. The foregoing experiments were carried out with cells grown to subconfluence. When the cells were enabled to grow to complete confluence, analysis of their surface phenotype showed atotal loss of p3 expression, although thecells continued to display avpl and avp5(Fig. 6). This absence of p3 expression was maintained when the confluent cells were cultured overnight in the presence of T N F a or FGFb; aswith the subconfluent cells, the levels of av-associated integrin expressed appeared to increase slightly with TNFa, but the presence of FGFb did not induce any 03 expression (Fig. 6). Immunoprecipitations from these confluent cultures also reL. M. Rankin and G. F. Burns, unpublished data.

- -

Multiple Integrin/3 Chains A av

3 p3

av

p3 p3 av

a v p3p3

18597

av

av "

"--

L

Untreated [Non-Reducedl UNTREATED

B

PDGF

TGF-p

TNF-a

Y

-.m

UNTREATE3

-

4

FGFb

FIG. 5. The effect of culture indifferent cytokinesupon avassociated integrin expression. Flow embyronic fibroblasts were cultured for 6 h ( A ) or 18 h ( R ) in the presence of the indicated cytokines. These were: platelet-derived growth factor (PDGF, 6 ng/ ml), TGFp (1 ng/ml), TNFn (10 units/ml), and FGFb (5 ng/ml). Detergent extracts of the surface labeled cells were split into two aliquots. One was directly immunoprecipitated with an antibody to the nv subunit (13C2); the other was sequentially precipitated with affinity-purified rabbit (polyclonal) antibody to 03 and then with anti-nv subunit, and the precipitates subjected to SDS-PAGE and autoradiographic analysis asdescribed in the legend to Fig. 2.

untreated [Reducedl

TNF-a [Reduced]

FGFb

FIG. 6. Embryonic fibroblasts from confluent cultures do not express avB3 on the cell surface but display a novel B subunit in association with av. Flow 2000 embryonic fibroblasts were enabled to grow to complete confluence before analysis, either untreated, or in the overnight presence of TNFn (10 units/ml), or basic FGFb ( 5 ng/ml). Detergent lysatesof the surface-iodinated cells were then sequentially precipitated, as described in the legend to Fig. 2, with antibodies to nv (13C2) or in sequential precipitations with affinity-purified rabbit anti-83 and thenwith 13C2. The resultsshow autoradiograms of the precipitates run on 7.5% SDS-PAGE in the absence (Non-reduced)or presence of 2-mercaptoethanol (Reduced). Arrowheads indicate the relative migrations of the nv, 81, and p5 subunits, and of an unknown subunit ( p u ) that displays the shift characteristic of integrin subunitsupon reduction.

confluence and treated overnight with TNFa before carrying out affinity chromatography and immunoprecipitation with the cell lysate. From the results (Fig. 7) it was apparent the avp5 bound to the vitronectin column whereas avpl could not be detected in the column eluate. As with the immunoprecipitation experiments described above, no avp3 was detectablefromtheseconfluent cells. Inexperiments using fibronectin as the affinity ligand it was found that avplbound to this column, but avp5did not bind in detectable amounts (data not shown). Thepu subunit was not seen in precipitations from either column (Fig. 7 and data notshown). DISCUSSION

It is now clear from a number of studies that the integrin p chains avsubunitcan formassociationswithmultiple vealed much more clearly the presence of a n additional av- including Dl, p3, p5, P3b (5-12), and probably other, as yet associated p chain (Fig. 6) seen only faintly or not a t all in uncharacterized /3 subunits (this report anddiscussed in Ref. the subconfluent cultures(Fig. 5). We have not yet identified 11).At least some of the receptors thus formed bind to the this unknown p chain (labeled pu in Fig. 6), but its relatively same matrix protein (5-8, 12), and the question arises as to greater migration in SDS-PAGE and its small shift in appar-why such apparent redundancy should occur. Since integrin p chains may mediate transmembranesignals (28,29) we have e n t molecular weight upon reduction together with its nonreactivity with polyclonal antibodies to p3 discriminates it suggested that theassociation of one a chain with multiple p chains would enable different signals to be transduced in from Dl, p3, and p5. aup.5 but Not auPl Binds to Vitronectin-The a v p l com- response to a single matrix protein (8).Certainly a number of bination has been described as a receptor for vitronectin (12) cell types preferentially orexclusively express a single p chain or fibronectin (11)on different cell types, and avp5 hasbeen in association with a v (6, 8, 10-12, 21). However, other cell shown to bind vitronectin alone (7, 9) or vitronectin and populations expressmultiple p chains that canassociate with fibronectin (6). Other integrins have been demonstrated to a v (8, 10, 11, 14), and if it could be shown that individual exhibit different ligand binding depending on their cell of cells within the population displayed multiple p chains then origin (17) and it ispossible that the different reports on the this proposal would be lessattractive. Here,we show that this case, since individualembryonicfibroblasts function of avpl reflect the different cell types used (11, 12). isindeedthe The fact that theembryonic fibroblasts expressed both avpl expressed mRNA for Dl, p3, and (35 as well as for NV. The results obtained by PCR could not be confirmed as and avp5 enabled us to compare directly the capacityof these integrins(fromthesame cell) tobindtovitronectin. T o protein data for single cells, since antibodies to p5 were not However, flow cytometry simplify the interpretation and to maximize the amount of availablefor thepresentstudy. cell surface receptor available, the fibroblasts were grown to indicated that the populationof fibroblasts under study ap-

Multiple Integrinp Chains

18598 EOUENT I AL

FT BD

Mr XIO-3

200

116 94

--

4 a ~

485

66

FIG. 7. Analysis of the av-associated integrins from Flow embryonic fibroblasts that bind vitronectin. Flow embryonic fibroblasts were grown tocomplete confluence andthentreated overnight with TNFn (10 units/ml). The cells weresurface-iodinated, lysed in “complete” octyl glucoside buffer (see “Experimental Procedures”) and applied to a 1-ml affinity column of vitronectin equilibrated in the same buffer. The column was washed and the hound proteins eluted with GRGDSP peptide and 300 mM sodium chloride as described under “Experimental Procedures.” The eluate was dialyzed overnight against “complete” octyl glucoside buffer, one-half immunoprecipitated with a monoclonal antibody to the nv subunit (13C2), and the other fraction sequentially immunoprecipitated two times with a monoclonal antibody to the83 subunit (SZ21), and then with the anti-nv antibody. The precipitates were run (nonreduced) on SDS-polyacrylamide gels (7.5%)and subjected to autoradiography. Also shown is a sample of the fraction that did not bindto the column (fall-through, FT, equivalent counts to precipitates) and a sample of the affinity beads boiled in SDS-PAGE sample buffer after elution of the integrin bands (bound,RD).

peared tobe fairly homogeneouswith all of the cells expressing levels of a v greatly in excess of p3 or of the avp3 complex (Fig. 1).Surface labeling and sequential immunoprecipitation studies revealed the presence of the D l and (33 subunits in association with av, together with another band that could be identified as p5 because it was rapidly and strongly phosphorylated in response to treatmentof the cells with phorbol ester (7). Also, other than platelets and their progenitors, neither 83 or P5 are known to associate with any a chain other than av (9). Hence it seems reasonable todeduce that individual cells are capable of coexpressing multiple /?chains in association with av on their cell surface. These cells may also be expressing additional /3 subunits, a t least oneof which is in association with a v (Fig. 6). In the results obtained by PCR we obtained a higher band (-350 bp) in addition to the band a t 250 bp expected with the65 primers used. This band appeared to be a fragment of a real product, sincewhen used in Northern blot analysis it hybridized with a band at 3.6 kilobases in additionto theP5 band a t 3.3 kilobases.‘ McLean et al. (14) carried out PCR reactions with p5 primers on a number of cell types and never detected an additional band, nor did they detect more than a single species of mRNA in hybridization experiments. These authors (14) did not specifically state the oligonucleotide primers that they used, but one was immediately following the termination codon, and theother was 5’ in the coding region encompassingthe transmembrane and/or cytoplasmic domains. Since the expected size of their amplified fragment was 250 bp (as ours) and encompassed the same regions as ours, it would appear that these differences are not due to different primersbeing used. We consistently identified the additional bandby PCR

from two different linesof embryonic fibroblasts but notfrom any of theother cell linesstudied including adult colonderived fibroblasts.‘ There have been described alternatively spliced forms of P3 and P4 (16,30), both contained within the cytoplasmic region, although the significance of these is not known. If it can be confirmed that the P5’ identified in the presentreport is analternatively spliced form of p5, its restricted tissue distribution may point to interestingbiological consequences. How this P5’ product relates to the additional P polypeptide (pu) associated with a v on thesurface of confluent cells (Fig. 6) is notknown, although the productof P5’ might be expected to be larger rather than smaller than P5. The presence of multiple @ chains in association with av on the same cells enabled us to examine possible regulators of integrin expression, seeking in particular identify to agents that altered the ratios of the different avp subsets. In studies of the regulation of integrin expression byTGF-Bl, Massague and colleagues (31, 32) demonstratedthat whereas cells treated with TGF-Pl generally increasedtheir level of integrin a chains expression, such treatmentdid not alter the different study. We shown to associatewith P l in the fibroblasts under tested a range of potential mediators, including TGF-P1, for their ability toinfluence the surface expression of av-associsome changes in the overall levels ated /?chains, and although of avp integrin were observed (inparticular asignificant increase upon treatment with TNF-a) only FGFb caused any change in the proportion of P chains that were expressed. Overnight culture with this growth factor caused the cells to exhibit predominantly avP3 because of an apparent loss of av-associated cell surface P l and p5. When the embryonic fibroblasts were grown to confluence, they totallylost expresavp integrins to sion of P3 but continued to express the other the samelevel, and avpu to an increased level. Freed et al. (7) discussed their impression that MG-63osteosarcoma cells expressed more ps (p5) and less p3 with time of passaging in tissue culture. We have come to a similar conclusion regarding the Flow embryonic fibroblasts used predominantly in the present report;over some 20 months of study, using different but progressively older subcultures, these cells have begun to exhibit relatively increased avpl and4 5 and less avP3 than we observed in early experiments. Certainlyisitquite striking to compare a young culture of human embryonic lung fibroblasts (passage 17) with the Flow cells in passage 26 (see Fig. 2) wherein the younger cells express predominantly av03. Therefore, it canbe postulated thatsenescence and a slowing of growth, perhaps caused by senescence or imposed by growth restrictions, accompany or induce p chain switching,with avp3 being expressedpredominantly by actively dividing cells. Other unidentified variables may also play a part, and our own data with a number of melanoma cell lines (21), many of which express only avP3, contrasts with reports of other cell types expressing only avp1 or avp5 (6, 11).In this regard it is interesting to note that the VLA (Dl)integrin subfamily appears tobehave in a similar manner,whereby serum depletion leading to cell quiescence in fibroblastsleads to switching of the proportions of the al, a2, and a3 subunits specifically associating with P l (33). There have been conflicting data on the ligand specificity of the avpl receptor complex, and this integrin has been reported to bind to either vitronectin(12) or fibronectin (10, 11).Different cell types were used by these investigators and this may be the reason for the discrepancy since Kirchhofer et al. (17) have shown that a2Pl isolated from platelets has a different ligandspecificityfrom that of the same integrin isolated from endothelial cells. We show here that avpl from

Multiple Integrin 0 Chains

18599

T. (1989) EMBO J . 8, 2955-2965 human embryonic fibroblasts does not bind to vitronectin, 8. Krissansen, G. W., Elliott, M. J., Lucas, C. M., Stomski, F. C., whereas avp5 from the same cells does so. Both ourown study Berndt, M. C., Cheresh, D. A., Lopez, A. F., and Burns, G. F. and thatof Vogel et al. (11)used column affinity chromatog(1990) J. Biol. Chem. 265,823-830 raphy to demonstrate receptor binding, whereas other studies 9. Smith, J. W., Vestal, D. J., Irwin, S. V., Burke, T. A., and Cheresh, had relied upon whole cell attachment assays and antibodyD. A. (1990) J. Biol. Chem. 265, 11008-11013 mediated inhibition (12). In this regard it is noteworthy that 10. Dedhar, S., and Gray, V. (1990) J. Cell Bid. 110, 2185-2193 11. Vogel, B. E.,Tarone, G., Giancotti, F. G., Gailit, J., and Ruoslahti, Cheresh et al. (6) initially provided data from wholecell E. (1990) J . Biol. Chem. 265,5934-5937 attachment assays suggesting that the 4 5 receptor bound 12. Bodary, S. C., and McLean, J. W. (1990) J. Biol. Chem. 265, t o both vitronectin andfibronectin, whereas subsequent stud5938-5941 ies by the same group using purified receptor protein indicated 13. Suzuki, S.,Huang, Z . 3 , and Tanihara, H. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 5354-5458 that avp5 bound only to vitronectin (9). It may be, therefore, that the intact cell is able to utilize individual receptors for 14. McLean, J. W., Vestal, D. J., Cheresh, D. A., and Bodary, S. C. (1990) J. Biol. Chem. 265, 17126-17131 different functions, perhaps in association with accessory Ramaswamy, H., and Hemler, M. (1990) EMBO J. 9,1561-1568 molecules not present in the purified protein. On the other 15. 16. van Kuppevelt, T. H. J. S. M., Languino, L. R., Gailit, J. O., hand, caution must be exercised when intact cells are emSuzuki, S., and Ruoslahti, E. (1989) Proc. Natl. Acad. Sci. U. ployed, since clearly there are other integrin and non-integrin S. A. 86,5415-5418 receptors for many of these matrix proteins, including fibro- 17. Kirchhofer, D., Languino, L. R., Ruoslahti, E., and Pierschbacher, M. D. (1990) J. Bid. Chem. 265, 615-618 nectin (34, 35). By whatever measurement, however, there is 18. Rappolee, D. A., Wang, A., Mark, D., and Werb, Z. (1989) J. Cell. general agreement that neither avpl nor avp5 bind to the Biochem. 39, 1-11 complete range of ligands recognizedby 4 3 ( 5 ) , and we 19. MacDonald, R. J., Swift, G. H., Przyhyla, A. E., and Chirgwin, J. could not detect avpubinding to either vitronectin (Fig. 7) or M. (1987) Methods Enzyrnol. 152, 219-227 fibronectin. Hence it appears that embryonic fibroblast a v - 20. Burns, G.F., Battye, F. L., and Goldstein, G. (1982) Cell. Immunol. 71, 12-26 associated integrin expression may progress from one general purpose complex (cuvp3) to more specific individual receptors. 21. Krissansen, G. W., Lucas, C. M., Stomski, F. C., Elliott, M. J., Berndt, M. C., Boyd, A. W., Horton, M. A., Cheresh, D.A., The presentstudyhasconcentrated upon the surface Vadas, M. A., and Burns, G. F. (1990) Int. Immunol. 2, 267expression of the av-associated integrin receptors. In thisway 277 we have been able to delineate the different p chains associ- 22. Cheresh, D. A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 64716475 ating with av, their ligand specificity, and conditions that influence their expression. An understanding of what regu- 23. Davies, J., Warwick, J., Totty, N., Philip, R., Helfrich, M., and Horton, M. (1989) J . Cell Bid. 109, 1817-1826 lates the assembly and expression of the different av-associ24. Ruan, C., Du, X., Xi, X., Costaldi, P. A., and Berndt,M. C. (1987) ated p subunits will require detailed study of the relative rates Blood 69,570-577 of transcription, protein synthesis, and subunit association, 25., .Bourdon, M., and Ruoslahti, E. (1989) J . Cell Biol. 108, 1149and in describing some of the conditions that influence the 1155 relative surface expression of the different subunits our results 26., .Krissansen, G. W., Owen, M. J., Verbi, W., and Crumpton, M. J. (1986) EMBO J . 5, 1799-1808 will provide a useful starting point for such studies. Acknowledgments-We thank Dr. Shintaro Suzuki for providing us with the sequence of /35 prior to its publication and Drs. Michael Horton, David Cheresh, and Michael Berndt for monoclonal and rabbit antibodiesused in thisstudy. We also thank Lyndie Barrkman for preparation of the manuscript. REFERENCES 1. Gani, J. S., and Burns, G. F. (1990) Life Sci. 2, 32-36 2. Hynes, R. 0. (1987) Cell 48,549-554 3. Ruoslahti, E., and Pierschbacher, M. D. (1987) Science 238,491496 4. Pytela, R., Pierschbacher, M. D., Ginsberg, M. H., Plow, E. F., and Ruoslahti, E. (1986) Science 231, 1559-1562 5. Cheresh, D. A. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 64716475 6. Cheresh, D. A,, Smith, J. W., Cooper, H. M., and Quaranta, V. (1989) Cell 57, 59-69 7. Freed, E., Gailit, J., van der Greer, P., Ruoslahti, E., and Hunter,

27. Yatohgo, T., Izumi, M., Kashiwagi, H., and Hayashi, M. (1988) Cell Struct. Funct. 13, 218-292 28. van Noesel, C., Miedema, F., Brouwer, M., de Rie, M. A., Aarden, L. A., and van Lier, R. A. W. (1988) Nature 333, 850-853 29. Dunn, S. M., Hillam, A. J., Stomski, F., Jin, B., Lucas, C. M., Boyd, A. W., Krissansen, G. W., and Burns, G. F. (1988) Transplant. Proc. 21, 31-34 30. Tamura, R. N., Rozzo, C., Starr, L., Chambers, J., Reichard, L. F., Cooper, H. M., and Quaranta, V. (1990) J. Cell Bid. 111, 1593-1604 31. Heino, J., Ignotz, R. A., Hemler, M. E., Crouse, C., and Massague, J. (1989) J. Biol. Chem. 264, 380-388 32. Ignotz, R. J., Heino, J., and Massague, J. (1989) J . Bid. Chem. 264,389-392 33. Fingerman, E., and Hemler, M. E. (1988) Erp. Cell Res. 177, 132-142 34. Charo, I. F., Nannizzi, L., Smith, J. W., and Cheresh, D. A. (1990) J. Cell Bid. 111, 2795-2800 35. Stamatoglou, S. C., Rui-Chang, G., Mills, G., Butters,T. D., Zaidi, F., and Hughes, R.C. (1990) J . Cell Biol. 111, 21172127