Biochemical and genetic studies have clearly demonstrated that phorbol ester binding occurs at a characteristic cysteine- rich domain in the conserved C1 ...
THEJOURNAL OF BIOLCCICAL CHEMISTRY
Vol. 269,No. 15,Issue of April 15,pp. 11590-11594, 1994 Printed in &SA.
Zinc Finger Domains and Phorbol Ester Pharmacophore ANALYSIS OF BINDING TO MUTATED FORM OF PROTEIN KINASE C C - ~ C PROTO-ONCOGENE Z~ PRODUCTS*
5 AND
THE uau AND
(Received for publication, October 18, 1993, and in revised form, January 14, 1994)
Marcel0 G. KazanietzS, Xos6 R. Bustelo§, Mariano Barbacid§, Walter Kolchx Harald Mischakfl, Gamy Won& George R. Pettit**,Jay D. BrunsS, and Peter M. Blumbergi: $$ From the $Molecular Mechanisms of mmor Promotion Section, Laboratory of Cellular Carcinogenesis and mmor Promotion, National Cancer Institute, Bethesda, Maryland 20892, the §Department of Molecular Biology, Bristol-Myers Squibb Pharmaceutical Research Institute, Princeton, New Jersey 08543-4000, the BInstitute for Clinical Molecular Biology and mmor Genetics, GSF: Haematologikum, 0-8000 Munich 70, Germany, the ILaboratory of Neuroscience, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892, and the **Cancer Research Institute, Arizona State University, Tempe, Arizona 85287-1604
The phorbol ester binding domain consists of a cys- teine; X, any other amino acid; n , 13 or 14), wheretwo Zn2+ions teine-rich region with a postulated consensus sequence coordinate the structure(zinc finger). This motif is duplicated for binding that includes 15 aminoacids(Ahmed, S., in tandem in all thePKC isozymes with the exception of PKC Kozma, R., Lee, J., Monfries, C., Harden, N., and Lim, L. 6. PKC &‘is the only isoform that lacks phorbol ester binding, (1991)Biochem. J. 280,233-241). In PKC 6, the only PKC and it possesses a single copy of this cysteine-rich motif. Howisoform lacking phorbol ester binding, this region difever, the fact that two newly identified proteins (n-chimaerin fers in a single residue from the consensus (proline in and unc-13) that also haveonly one copy of the domain can bind position 11 of the motif). Restorationof this proline by phorbol esters (9,lO) suggests that a single copy of this motif is site-directedmutagenesis ofPKC C doesnotrestore sufficient for binding.This conclusion has been directly verified binding of either [‘Hlphorbol 12,13-dibutyrate or of theusing recombinant single zinc finger domains from PKC. The ultrapotentligand[‘Hlbryostatin 1, suggestingthat proto-oncogene products Vav (11)and c-Raf (12) alsopossess a even a low affinity ligand interaction is absent. In addition, the vav and c-raf proto-oncogene products, pro- single copy of the cysteine-rich motif (where n = 13 and 9, respectively), but their ability to bind phorbol esters has not teins that possess cysteine-rich regions with high hobeen described. In addition, there is not direct evidence forthe mologyto PKC isozymesandotherphorbolester receptors, are unable to bind any of these ligands. In- presence of a zinc-dependent structure inVav, c-Raf, or PKC 5. Sequence alignment of the different cysteine-rich regions stead, all of these cysteine-rich regions bind zinc.Our results suggest that other amino acids besides thoseshows pos-that the 6 cysteines and 2 histidines are not the only consensussequencefor tulated for the consensus must be necessary for ligandresidues conserved intheputative binding and argue against direct modulation of PKC 6, phorbol ester binding. Rather, the consensus sequence postulated by Ahmed et al. (13)includes 15 amino acids, and of those Vav, and c-Raf by phorbolesters. residues only oneamino acid (proline at position 11of the motif) is not conserved in PKC 5. Divergence is slightly higher in the Identification of protein kinase C (PKC)’ as the primary re- vav and c-raf proto-oncogene products (2 and 4 amino acids, ceptor for phorbol esters and relatedcompounds represented a respectively). Therefore, it is still possible that these proteins major advance in cellular biochemistry (1-4). Since phorbol retain phorbol ester binding, although with a lower affinity esters bind to PKC in a fashion similar to diacylglycerol to than that described for the classical phorbol ester receptors. To commonly activate the enzyme ( 9 , the phorbol esters havebecome a pow- demonstrate suchlow affinity interactions using the erful tool to assess thebiological role of PKC in cellular signal used ligand [3H]PDBu is problematic because it would require transduction.Subsequent molecularcloning of mammalian extremely high concentrationsof the radioligand. For this reaPKCs revealed theexistence of a family of related isozymes (61, son we decided to use [3Hlbryostatinl, a compound related to phorbol esters that binds to PKC with picomolar rather than classified into two groups according to their calcium dependence (PKCa,p-1, p-2, and y ) or calcium independence (PKC6, nanomolar affinity (14). By using nanomolar concentrationsof [3H]bryostatin 1 and high concentrations of recombinant proE, 5, q, and 0). Biochemical and genetic studies have clearly demonstrated tein, we would expect a gain of several orders of magnitude in that phorbol ester binding occurs at a characteristic cysteine- sensitivity for detecting low affinity interactions. Our binding 1reveals that neither theVav and rich domain in the conserved C1 region of the PKC regulatory analysis with [3Hlbryostatin domain (7, 8). Analysis at the primary sequence level of the c-Raf proteins nor a mutant of PKC 5 with the postulatedconcysteine-rich regions of PKC isoforms reveals that they share sensus sequence restored by site-directed mutagenesis shows [3Hlbryostatin 1. We conclude the motif HX12CXzCX,CXzCX,HXzCX,C (H, histidine; C, cys- detectable binding even with that other amino acid residues besides those originally postu* The costs of publication of this article were defrayed inpart by the lated for the phorbol ester binding consensus (13) must be payment of page charges. This article must thereforebe hereby marked critical for protein-ligand interaction. “advertisement”in accordancewith18U.S.C.Section1734solely to indicate this fact. EXPERIMENTALPROCEDURES $$To whomcorrespondenceand reprint requests should be adM~terials-[~H]PDBu (17.5Ci/mmol),[y3*P1ATP (3000 Ci/mmol), dressed. Fax: 301-496-8709. The abbreviationsused are: PKC, protein kinase C; PDBu, phorbol and 65ZnCl(1.48 mCi/mg)were purchased from DuPontNEN. [3HlBryo12,13-dibutyrate;mutPKC l , mutated PKC 5; MBP, maltose-binding statin 1 (4.8 Ci/mmol) was prepared as we previously described for [3H]bryostatin4 (14). Phorbol 12-myristate 13-acetateand PDBu were protein.
11590
Cysteine-rich Regions and PhorbolBinding Ester
11591
PKC was measured using the polyethylene glycol precipitation assay, obtained from LC Services Corp. (Woburn, MA). Cell culture reagents and media as well as the PKC a-pseudosubstrate peptide were pur- developed in our laboratory (21), using 100 pg/ml phosphatidylserine chased from Life Technologies, Inc. Phosphatidylserine and phosphati- vesicles, 1II~MEGTA, and 20 m radioligand in a totalvolume of 250 pl. dylcholine wereobtained from Sigma.All other reagents andchemicals Fifty pl of Sf9 or E. coli lysatedtube were used. Binding of [3H]bryostatin1 was measured by a variant of the filtrawere of high quality. Cell CultureSpodoptera frugiperda (Sf9)insect cells werecultured tion assay described for[3Hlepibryostatin4 (22). Briefly, celllysates (50 in monolayers at 27“C using Grace’s medium containing 10% fetal pl), 0.1 m EGTA, 20 m Tris-C1, pH 7.4, 1mg/ml immunoglobulin G, 100 pg/ml phosphatidylserine, and 10 m [3Hlbryostatin 1 were incubovine serum, 3.3 gfliter lactalbumin hydrolysate, 3.3 gfliter yeastolate, bated for 5 min at 37 “C in a volume of 250 pl. The tubes were then 50 pg/ml gentamicin, and 2.5 pg/ml Fungizone. Construction of Baculouirus Dansfer Vectors-The full-length cDNA chilled on icefor 5 min, and two samples of 50 pl were applied t o 25-mm Whatman DE-81 ionexchange paper discs and allowed to absorb for 30 clones for the mouse PKC 5 and bovine PKC a were inserted into the pVL1393 expression vector (Invitrogen, San Diego, CA) as described s. The disks were then washed with 25 ml of an ice-cold washing solubefore (16). For constructing the c-raf baculovirus vector, an EcoRI-AuaI tion containing 55% (vh) methanol and 20 m Ms-C1, pH7.4. Two 2.1-kilobase fragment encompassingthe raf-1coding regionwas cut out additional aliquots of 50 pl were removed for determination of total from the p627 plasmid (12). This fragment lacks the codons for the 4 radioactivity. Aquasol (3 ml) was added both t o the filters (for the deC-terminal amino acids. An oligonucleotide encoding6 histidines and a termination of bound [3Hlbryostatin l) and to the 50-pl aliquots restop codon containing an AuaI overhang on the 5’-end and aBamHI site moved for determining total radioactivity. Radioactivitywas measured on the 3’-end, together with the 2.1-kilobase EcoRI-AuaIfragment, were in a LKB 1218 scintillation counter. Nonspecific binding was measured ligated into the EcoRI-BamHI sites of the baculovirus transfer vector in the absence of added lysate. Free [3Hlbryostatin 1 was calculated pVL 1392. Forthe uau baculovirus construct, the full-length mouse uau from the difference between total ligand and that bound to the filter. cDNA was liberated by partial digestion with EcoRI from pJCll plasWestern Blot Analysis-Proteins were resolved on 12% SDS-polyacmid (11)and ligated into the pVL1393 vector. rylamide gels, electrophoretically transferred tonitrocellulose, and Construction of Vectors for Bacterial Expression-Fragments encodprobed with specific antibodies using standard techniques. The following the cysteine-rich regions ofPKC a (first zinc finger), PKC 5, and ing antibodies were used: for PKC a, monoclonal antibody developed mutPKC were generated by polymerase chain reaction using the cor- against the catalytic region of this isozyme (Upstate Biotechnology, Inc., responding baculovirus transfer vectors as templates and thefollowing Lake Placid,N Y ) and for PKC 5, polyclonal antibody from Researchand oligonucleotides containing BamHI and EcoRI recognition sites Diagnostic Antibodies (Berkeley,CA). For Vav, a rabbit polyclonal an(underlined) for unidirectional subcloning: 5’TGAGGATCCACCGCT- tibody raised against a bacterial MBP fusion protein containing the TCATCGCGCGCT3‘ (5‘-PKC a), 5‘CTTGAAITCGTGC’ITGCTC- cysteine-rich region of mouse Vav described above wasused. For c-Raf, CTCGGGTC3’ (3’-PKC a), 5’CCAGGATCCACCTCTTCCAAGCCAA- monoclonal antibody PBB1 was used (23). Goat anti-mouse or antiGC3‘ (5’-PKC 5 and mutPKC 5). and S’G’ITGAAITCATCTACT- rabbit antiserum coupled to alkaline phosphatase was used as a secGGAGGCTCTTG3’ (3’-PKC6 and mutPKC 6). Polymerase chain reac- ondary antibody, and 5-bromo-4-chloro-3-indolyl phosphate and nition fragments were sequenced and subcloned into the pCR2000 vector troblue tetrazolium (Bio-Rad) wereused as color development reagents. using the TA cloning system (Invitrogen).The BamHI-EcoRI fragments 65ZnBinding in Nitrocellulose Filters-Bacterial pellets (from 1ml of were isolated and ligated in frame in pGEX expression vectors to get the cultures expressing the different constructs) were lysed and reglutathione S-transferase fusion proteins. A pGEX construct for the solved on 12%SDS-polyacrylamidegels. The gels wereincubated for 10 cysteine-rich region of c-Raf was generated by isolating a 0.8-kilobase min in 5% 2-mercaptoethanol and washed for 10 min in Western transfragment with NcoI and Sal1 from the full-length clone (in which an fer buffer. Proteins were electrophoretically transferred to nitrocelluNcoI site had been introduced a t the ATG codon) and subsequent sub- lose, and binding of 65Znto the filters was performed accordingto the cloning in frame in the pGEX-KG vector (17). The cysteine-rich region protocol described by Ahmed et al. (13). of mouse Vav protein (residues 461-6271 was polymerase chain reaction-amplified using the pJCll plasmid (11) as template and 5’RESULTS AND DISCUSSION (5’CCCGGGAGTACTGAGCGAGACAACAAGAAGTGG3’) and 3‘-amplimers (5’GGGCCCTCTAGATTAGAGCTCCACAATGTCCCCAGG3’) Fig. 1 shows the sequence alignment of the cysteine-rich containing ScaI and XbaI sites, respectively. The polymerase chain regions of PKC isozymes, n-chimaerin,unc-13, and the uau and reaction-amplified DNA fragment was digested, purified by agarose c-raf proto-oncogene products. The 6 cysteine and the 2 histielectrophoresis, and ligated into StuVXbaI linearized pMAL-c plasmid dine residues (presumably involved in zinc binding), as well as (New England Biolabs Inc., Beverly, MA). Site-directed Mutagenesis of PKC 5-Replacement of glycine by pro- 5 other amino acids, are conserved between those proteins and line in position 141 of the full-length mouse PKC cDNA subcloned in known phorbol ester receptors (PKC a, p, y, 6, E , q, and 8, pUC19 (18) was performed by using the “Double Take” system from n-chimaerin,and unc-13). Two copies of the motif are present in Stratagene (La Jolla, CA) according to the manufacturer’s protocol. The those PKC isozymes that bind phorbol esters. PKC ( i s the only oligonucleotide used to create the mutation was B’GCGCTITAACAGGmGCGTACTGCGGC3’. The point mutation was verified by se- isoform encoding a single copy of the motif, and it is the only one lacking both phorbol ester binding and phorbol ester-dequencing using the dideoxy chain termination method (19). Expression of Recombinant Proteins-Transfection of recombinant pendent kinase activity (18, 24-26). Sequence alignment of baculovirus vectors, isolation of plaques, and identification of the re- mouse PKC 4 ‘ with the consensus forphorbol ester binding combinant baculoviruses were performedusing standard techniques, as reveals that 12 of the 13 residues are present (13). The only described before(16). Infection of Sf9 cells with the recombinant viruses difference is the proline at position 11 of the motif that in the was donein 35-mm dishes at a multiplicity of infection of 5. After 72 h, mouse PKC 5 is replaced by glycine. We decided, therefore, to cells were lysed in 1 ml of lysis buffer (20 m Tris-C1, pH 7.4, 2 m EGTA, 50 p g / d phenylmethylsulfonylfluoride, and 250 p g / d leupep- replace that glycine in the cysteine-rich region with proline by tin) and sonicated for 20 s (setting 5) using a Heat Systems-Ultrasonics performing site-directed mutagenesis of the PKC 4 cDNA and sonicator (model W385). then to analyze binding activity of the expressed protein (“mutTo induce the expression of recombinant cysteine-rich regions, Es- PKC t;“). cherichia coli JMlOl cells containing the different expression plasmids To generate the proteins, we expressed the corresponding or the control plasmid were grown until an A of, 0.5,and fusion cDNAs in the baculovirus expression system, taking advantage proteins were induced by 0.5 m isopropylthiogalactosidefor 3-5 h. Cells were pelleted, resuspended in lysis buffer (1ml of lysis buffed20 of the high levels of biologically active recombinant proteins mlof bacterial culture), and disrupted by sonication. Purification of that could be obtained in insect cells (27). The levels of expresglutathione S-transferase fusion proteins was done with glutathione- sion that we usually get are approximately 1pg of recombinant Sepharose 4B accordingto the manufacturer’s instructions (Pharmacia protein/106 cells. Fig. 2A shows the expression of the recombiLKB Biotechnology Inc.). MBP fusion proteins were purified with the nant PKC a,PKC 6, and mutPKC ( in Sf9 cells as judged by amylose resin system from New England Biolabs Inc. Western blot analysis.’In all cases, high levels of phospholipidProtein Kinase C Assay-Protein kinase C activity was assayed by dependent kinase activity were detected in the cell lysates (Fig. measuring the incorporation of 3*P from [y-32P]ATP into PKC 2 B ) . The activity was dependent on phorbol esters only in the a-pseudosubstrate peptide, as described previously (16, 20). Binding of FHlPDBu and rHlBryostatin l-[3HlPDBu binding to case of PKC a (data not shown).
