Zinc Finger Protein 191 (ZNF191/Zfp191) Is ... - Wiley Online Library

TISSUE-SPECIFIC STEM CELLS Zinc Finger Protein 191 (ZNF191/Zfp191) Is Necessary to Maintain Neural Cells As Cycling Progenitors OLFA KHALFALLAH, PHILIPPE RAVASSARD, CHE SERGUERA LAGACHE, CEĆILE FLIGNY, ANGE´LINE SERRE, ELISA BAYARD, NICOLE FAUCON-BIGUET, JACQUES MALLET, ROLANDO MELONI, JEANNETTE NARDELLI CRICM UPMC/Inserm UMR_S 975;CNRS UMR 7225, Biotechnology and Biotherapy Laboratory F-75005, Paris, France Key Words. ZNF/Zfp191 • Neural progenitors • Proliferation • Differentiation

ABSTRACT The identification of the factors that allow better monitoring of stem cell renewal and differentiation is of paramount importance for the implementation of new regenerative therapies, especially with regard to the nervous and hematopoietic systems. In this article, we present new information on the function of zinc finger protein 191 (ZNF/Zfp191), a factor isolated in hematopoietic cell lines, within progenitors of the central nervous system (CNS). ZNF/Zfp191 has been found to be principally expressed in progenitors of the developing CNS of humans and mice. Such an overlap of the expression patterns in addition to the high homology of the protein in mammals suggested that ZNF/Zfp191 exerts a conserved function within such progenitors. Indeed, ZNF191 knockdown in human neural

progenitors inhibits proliferation and leads to the exit of the cell cycle. Conversely, ZNF191 misexpression maintains progenitors in cycle and exerts negative control on the Notch pathway, which prevents them from differentiating. The present data, together with the fact that the inactivation of Zfp191 leads to embryonic lethality, confirm ZNF191 as an essential factor acting for the promotion of the cell cycle and thus maintenance in the progenitor stage. On the bases of expression data, such a function can be extended to progenitor cells of other tissues such as the hematopoietic system, which emphasizes the important issue of further understanding the molecular events controlled by ZNF/Zfp191. STEM CELLS 2009;27:1643–1653

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION The identification of the factors that allow better monitoring of stem cell renewal and differentiation is of paramount importance for the implementation of new regenerative therapies, especially with regard to the nervous and hematopoietic systems. In this perspective, we relate new information on the function of the zinc finger protein 191 (ZNF/ Zfp191), a factor isolated in hematopoietic cell lines, within neural progenitors. ZNF/Zfp191 belongs to the SCAN domain subfamily of Kru¨ppel-like zinc finger transcription factors. Whereas Kru¨ppel-like zinc fingers bind to DNA-specific sequences and are widely represented in all species [1], the SCAN domain participates in protein-protein interactions and has to date only been found in vertebrates [2, 3] with a remarked absence in birds. We became interested in ZNF191 initially because of its capacity to bind in vitro the HUMTH01 microsatellite, a TCAT repeated sequence located in the first intron of the human tyrosine hydroxylase (TH) gene [4]. ZNF191 can function as a regulator of transcription [4, 5]. Albeit ZNF191 con-

trol on transcription appears not to be restricted to genes that contain the TCAT repeated sequence, other transcriptional targets have not been identified yet. On the basis of expression data, ZNF191 was supposed to play a role during hematopoiesis [5], but precise information on the biological function of ZNF/Zfp191 is still lacking. In the mouse, this factor is required during early developmental stages, because mutant embryos do not survive beyond embryonic day (E) 7.5 without any clear cause of lethality [6], whereas its misexpression does not result in any remarkable phenotype [7]. However, we have recently shown that, in the developing central nervous system (CNS), Zfp191 is expressed principally in proliferative areas, which suggests a possible role of this transcription factor in the control of the proliferation and/ or the maintenance of the undifferentiated state of neural progenitors [8]. Therefore, we further investigated the implication of ZNF/Zfp191 in the control of the differentiation of neural progenitor cells. Precise spatiotemporal control of the transition from proliferation to differentiation is particularly critical for the progressive elaboration of the CNS because precocious or delayed onset of differentiation results in abnormal

Author contributions: O.K.: collection and assembly of data, data analysis and interpretation, manuscript writing; P.R., C.S.L., C.F., and E.B.: collection of data; A.S.: provision of study material; P.R., N.F.-B., J.M., and R.M.: conception and design; J.N.: conception and design, collection and assembly of data, data analysis and interpretation, manuscript writing. Correspondence: Jacques Mallet, Ph.D., CNRS UMR 7225, Biotechnology and Biotherapy Laboratory, baˆtiment C.E.R.V.I. Hoˆpital de la pitie´-Salpeˆtrie´re 83, Boulevard de I’Hoˆpital, 75,013 Paris, France. Telephone: 331 42 17 75 32; Fax: 331 42 17 75 33; e-mail: mallet@ chups.jussieu.fr Received October 13, 2008; accepted for publication March 30, 2009; first published online in STEM CELLS EXPRESS C AlphaMed Press 1066-5099/2009/$30.00/0 doi: 10.1002/stem.88 April 9, 2009. V

STEM CELLS 2009;27:1643–1653 www.StemCells.com

ZNF191 Necessary to Maintain Neural Cells

1644

development of neuronal populations [9–12]. At early developmental stages, neural progenitors expand through a series of proliferative divisions (self-renewal). Later on, the onset of neurogenesis is accompanied by a switch from neuroepithelial cells to radial glial cells and a switch from symmetric, proliferative divisions to asymmetric or eventually to symmetric neurogenic divisions (for review [13–15]). Asymmetric division and lateral inhibition are key processes to coordinate proliferation and withdrawal from the cell cycle to maintain a pool of progenitors. It has been largely documented that these processes are dependent on the Notch pathway, which underlies the occurrence of diverse binary cell decisions, such as division versus differentiation [16, 17]. Importantly, several reports have also correlated the outcome of asymmetric division to the length of the cell cycle, especially of the G1 phase [18–20], which most probably implies changes in the nature or the concentration of the factors intervening during this phase, such as cyclins D during neurogenesis in the telencephalon [21] and the spinal cord [22]. Interestingly, cell cycle regulators may also be involved in determining neuronal fate [23–25], and, conversely, neuron specification factors [26–28] including extrinsic signaling factors [29–32] can participate in the control of the cell cycle. However, despite recent valuable progress in these different aspects, the precise mechanisms that link Notch signaling to the cell cycle machinery or that consolidate either proliferation or commitment into differentiation are far from being understood. Here, we present functional data obtained by knockdown experiments and gain of function studies, supporting the participation of ZNF191 in the maintenance of neural cells in a cycling progenitor status by preventing them from leaving the cell cycle and being committed into a differentiation pathway.

MATERIALS

AND

METHODS

Tissue Preparation SWISS mice were mated, and midday when the vaginal plug was detected was designated as E0.5. Embryos were fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS). Postnatal day 2 mice were perfused with 4% PFA, and the brain was dissected and further postfixed in 4% PFA for at least 1 night. Electroporated chick embryos were fixed 1 hour for immunohistochemistry or at least 1 night for in situ hybridization. 5- to 9- and 12-week-old human embryos were obtained immediately after abortion, according to French legislation, with patient’s agreement and ethics approval obtained from the Agence de Biomedecine. Warm ischemia lasted less than 30 minutes. Embryos were conserved in hibernation medium (30 mM KCl, 5 mM glucose, 0.24 mM MgCl26H2O, 10.95 mM NaH2PO4H2O, and 5 mM Na2HPO42H2O) before being fixed with 4% PFA. All tissues were equilibrated in 15% sucrose, embedded in 7% gelatin-15% sucrose, frozen, and cryosectioned at 12 or 14 lm.

Cell Proliferation Analysis Pregnant female mice were injected intraperitoneally with 2 mg of 5-bromo-20 -deoxyuridine (BrdU), and embryos were collected 2 hours after injection. Chick embryos were injected with BrdU in the umbilical vein 30 minutes before dissection. For incorporation into human embryonic neuroepithelial cells, 20 lg/ml BrdU was added to the medium 1 hour before fixation.

DNA Constructs To generate the pAdRSV-ZNF191-hemaglutinin (HA) expression plasmid, the entire human sequence encoding ZNF191 was ampli-

fied by polymerase chain reaction (PCR) so as to introduce a NcoI site at the 50 end, one copy of the HA epitope, and an EcoRV site at the 30 end of the cDNA, fully verified by sequencing and cloned into the pAd-RSV-SP plasmid [33]. To monitor the efficiency of the seven short hairpin (sh) RNAs tested, the full-length cDNA for ZNF191 was transferred into the penhanced green fluorescent protein (EGFP)-C1 plasmid (Invitrogen, Carlsbad, CA, http://www.invitrogen.com) in-frame with the EGFP reporter gene. Potential small interfering RNA sequences of 19 nucleotides were selected to match specifically the human ZNF191 mRNA sequence (GenBank accession number NM_006965). DNA templates of 64 base pairs were then designed to produce shRNA as described previously [34] and were introduced into the pSuper vector [35]. The selected shRNA sequence (shZF191-3) was 50 GATCCCCGCATTCAGCCGAAGTTCCATTCAAGAGATGGA ACTTCGGCTGAATGCTTTTTGGAAA30 (forward) and 50 AGCTTTTCCAAAAAGCATTCAGCCGAAGTTCCATCTCTT GAATGGAACTTCGGCTGAATGCGGG30 (reverse). A plasmid was also generated with a control scrambled sequence (shCT), which does not match any gene (50 TCGTCATAGCGTGCATAGG 30 ) [35]. To produce shZF191-3 and shCT from lentiviral vectors, complete shRNA expression cassettes were excised from the corresponding recombinant pSuper plasmids by ClaI and BamHI digestion and transferred into the pLV-TH vector [36].

Cell Culture, Transfection, and Transduction HEK293T cells and mouse neuroblastoma rat glioma hybrid NG9108 cells were maintained as described [35]. Human neural progenitors were obtained from telencephalic vesicles, as described previously [37]. Cells were grown as neurospheres in a serum-free defined medium containing 10 ng/ml basic fibroblast growth factor (bFGF) and epidermal growth factor. Twenty-four hours before transfection by the calcium phosphate method, HEK293T cells were seeded at a density of 3 106 cells/100 mm dish. The transfection medium was replaced by fresh medium on the next day. NG9108 transfections were performed with polyethylenimine (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich.com) as described [35]. Cells were then grown in standard medium and harvested 24, 48, 72, and 96 h later. Silencing efficiency was monitored by quantification of EGFP by flow cytometry (see below). For lentiviral transduction, human cells were plated at 105 cells/well in 24-well plates coated with gelatin (0.25% w/v; Merck, Darmstadt, Germany, NY, http://www.merck.com) and laminin (10 lg/ml; Roche Diagnostics, Basel, Switzerland, http:// www.roche-applied-science.com) in serum-free defined medium containing only 10 ng/ml bFGF (Roche Diagnostics), and incubated with the viral preparation in 300 ll of culture medium, which was replaced by fresh medium on the next day. Cells were harvested 4 and 8 days later.

Lentiviral Vector Production Lentivirus vector particles were produced by calcium phosphate transient cotransfection of HEK293T cells by the vector plasmid, an encapsidation plasmid (p8.7) and a vesicular stomatitis virus expression plasmid (pHCMV-VSV-G) as described previously [38]. Supernatants were treated with DNase I (Roche Diagnostics) before ultracentrifugation. Pellets were resuspended in PBS, aliquoted, and frozen at 80 C until use. The transduction efficiency of each vector stock was determined by fluorescence-activated cell sorter (FACS) analysis on transduced HEK293T cells as described previously [39]. For both LVshZF191-3 and LVshCT, the titer was 109 transducing units/ml. Before transduction the viral stocks were centrifuged for 5 minutes at 2000g. For our knockdown experiments, a transduction curve was then performed in human neuroepithelial cells to define the minimum multiplicity of infection (MOI) yielding the highest transduction

Khalfallah, Ravassard, Lagache et al.

rate without toxicity. This curve was established with MOI ranging from 2 to 20. We thus selected an MOI value of 5, at which 100% transduction yield was obtained without apparent cytotoxicity, whereas a MOI of 2 resulted in 80% transduction and an MOI of 10 induced cytotoxicity.

In Ovo Electroporation Assays Fertilized eggs from Gallus gallus domesticus hens were incubated at 38 C in a humidified oven. The plasmid pAdRSVZNF191-HA was used at a concentration of 2 lg/ll and was injected into the neural tube of Hamburger stage [40] HH12 to HH15 chick embryos as described previously [41]. Embryos were collected 24 or 48 hours later.

In Situ Hybridization Complete ZNF191 and Zfp191 cDNAs were isolated, respectively, from HEK293T cells and from mouse adult heart by reverse transcriptase (RT)-PCR and were introduced into the pGEM-T Easy vector (Promega, Madison, WI, http://www.promega.com). Primer sequences are available as supporting information data. Chick probes were described previously [41]. Antisense RNA probes were synthesized with digoxigeninUTP (Roche Diagnostics), and in situ hybridizations were performed as described previously [42]. Sections were then either dehydrated and mounted in Entellan (Merck) or processed for further immunostaining.

Immunostaining Slides were saturated for 1 hour with PBS-0.1% Triton X-10010% goat serum and then were incubated with primary antibodies diluted in PBS-0.1% Triton-5% goat serum. Antibodies used in our studies are listed in the supporting information data. In chick embryos misexpressing ZNF191-HA, all of the nuclei and the BrdU- and p27-positive nuclei were counted using Metamorph software on the electroporated and control sides on two sections in three different embryos. BrdU-positive nuclei were counted among 1,287 cells and p27-positive nuclei among 1,011 cells on the electroporated side. Stainings were analyzed with a BX60 Olympus epifluorescence microscope, and pictures were taken with a black and white Cool Snap camera (Ropper Scientific, Inc., Tucson, AZ, http://www.roperscientific.com) and false-colored in Photoshop (Adobe Systems, Mountain View, CA, http://www.adobe.com). Confocal analysis was performed with a Leica TCS SP1 confocal microscope.

Flow Cytometry In brief, transfected or transduced cells were fixed in 2% PFA, and EGFP levels were analyzed on a Becton Dickinson (Franklin Lakes, NJ, http://www.bd.com) FACS apparatus with excitation/ emission filters at 488/507 nm.

RT-PCR and Quantitative RT-PCR Reactions Experimental procedures and primer sequences are available in the supporting information data.

RESULTS Zfp191 Is Expressed in Neural Progenitors The first indications of the ZNF/Zfp191 function in the CNS arose from the analysis of its expression pattern. In the mouse embryonic CNS, Zfp191 is expressed in the ventricular zone of the brain and spinal cord and is downregulated as cells migrate outward toward the marginal zone and then differentiate [8] www.StemCells.com

1645

(Fig. 1A–1D). In the adult brain, Zfp191 is detected in areas associated with neurogenesis [8]. These observations indicate that this factor is expressed in areas where neural progenitors reside. To ascertain whether Zfp191 expression is restricted to neural progenitors and excluded from cells engaged in differentiation, we assessed the colocalization of this factor with several molecular markers associated either with cycling progenitors or with postmitotic differentiating cells. We first performed short-pulse BrdU incorporations, which allow labeling of cells in the S phase. BrdU staining appeared to be fully associated with Zfp191 expression in the brains of embryos at E9.5 (Fig. 1E, 1F), E13.5 (Fig. 1H, 1I), and E15.5 (Fig. 1K–1N) and in the spinal cord at E9.5 and E13.5 (Fig. 1G, 1J, respectively). However, this expression was observed in almost all ventricular cells and not solely in cells that had incorporated BrdU. In addition, in the spinal cord as well as in the brain (supporting information Fig. S1A–S1D), Zfp191 transcripts were detected with similar levels throughout the ventricular zone, except at the apical border of the ventricle, where the in situ signal appeared to be stronger (supporting information Fig. S1A–S1D) and, notably, nonhomogeneously distributed in the cytoplasm. Hence, transcripts appeared to accumulate at the apical side of neuroepithelial cells, which lie at the border of the ventricle. This mRNA distribution was not observed for other genes, such as Hes5 whose mRNA was found to be homogeneously distributed throughout the cytoplasm of neural progenitors in the spinal cord and in the brain (supporting information Fig. S1E–S1H). Such an unequal repartition of Zfp191 transcripts was also evident in other epithelial polarized tissues, such as intestine epithelium or lung vacuole epithelium (data not shown). At E15.5 only a few Zfp191-positive cells were present in the spinal cord, and the level of expression was much lower and could hardly be detected in BrdU-labeled cells. Consistently, stainings for Zfp191 mRNA and for the neuronal marker bIII-tubulin were mutually exclusive in the spinal cord (Fig. 1O–1S) as well as in the lateral ventricles of the brain at E12.5 (Fig. 1T–1X) and at all of the developmental stages examined (data not shown). In the newborn brain, we analyzed the proliferative status of neural cells by performing immunostainings for Ki67, a marker identifying cells that have not exited the cell cycle regardless of their dividing state [43]. At this stage, the level of Zfp191 expression and the number of cells expressing Zfp191 are very low compared with those in the embryonic brain (Fig. 2A–2D), and cells positive for Ki67 are very scarce (Fig. 2A0 , 2B0 ). Indeed, we found cells expressing Zfp191 principally in the lateral ventricle and in the rostral migratory stream (Fig. 2A, 2C), as well as in the hippocampus (Fig. 2B, 2D). These cells appeared to be positive for Ki67 (Fig. 2A00 , 2B00 ), indicating that at this stage, expression of Zfp191 is still associated with progenitors. Furthermore we observed that Zfp191 and RC2, a marker of radial glial cells [13, 44], were also co-expressed in the same areas in the 2day postnatal brain (Fig. 2C–2C00 , 2D–2D00 ). Altogether, these results indicate that the expression of Zfp191 is confined to progenitor cells in the embryonic and newborn CNS and is strongly decreased as progenitor cells leave the cell cycle and start to express postmitotic markers. This finding supports the hypothesis that Zfp191 function is related to the maintenance of the undifferentiated state of the neural progenitor, whether or not in association with a control on proliferation. Then, to gain a better insight into ZNF/Zfp191 function we compared the DNA and protein sequences between different species and extended the investigation of its expression patterns to humans.

1646

Zfp191 Expression Pattern Is Conserved in the Human Developing CNS We found, by searching in sequence databases, that ZNF/ Zfp191 exists only in mammals with a highly conserved amino


acid and nucleotide sequence (supporting information Figs. S2, S3; supporting information Table S1). Indeed, the human protein shares 94.8% identity with its mouse counterpart (supporting information Fig. S2; supporting information Table S1). Moreover, the 50 and 30 untranslated (UTR) regions of the human and mouse cDNA share, respectively, 64.8% and 58.8% identity, and even increases up to 75.8%, when only the first 140 nucleotides after the stop codon, in the mouse, rat, and human sequence are taken into account (supporting information Fig. S3; supporting information Table S1). Altogether, these analyses reveal a very high sequence conservation under evolutionary pressure, which is a hallmark of a conserved function. Therefore, to assess whether the sequence similarity between mice and humans is also reflected by a similar distribution, indicative of a conserved function, we analyzed the expression pattern of ZNF191 in the human developing CNS. We performed in situ hybridizations on sections of 5-, 7-, 9-, and 12-week-old human embryos. At 5-7 and 9 weeks, human ZNF191 mRNA was again detected in the ventricular zone of the spinal cord and of the telencephalon, the diencephalon, and the hindbrain (Fig. 3, middle panels and data not shown), which correspond to regions where mouse Zfp191 transcripts are also present at an equivalent stage of the CNS development (Fig. 3, right panels). At 12 weeks, ZNF191 mRNA was detected around the central canal of hindbrain (Fig. 4A) and in the ventricular zone of the lateral, third, and fourth ventricles (Fig. 4A–4E). Moreover, in the lateral ventricles, a second layer of expression was detected at the pial side (Fig. 4B, 4E). As expected, the ventricular cells producing ZNF191 mRNA co-expressed progenitor markers, such as nestin (Fig. 4F–4H) and Ki67 (Fig. 4I– 4K), but no differentiation markers, such as bIII-tubulin for neurons (Fig. 4L–4N) or glial fibrillary acidic protein for astrocytes (Fig. 4O–4Q) and Olig2 for oligodendrocytes (Fig. 4R– 4T). Thus, ZNF191 presents fully overlapping expression patterns in the ventricular zone of the brain and spinal cord of mice and humans, with a notable exception in the expression domain at the pial side of the human lateral ventricle, where only this factor was found to be expressed and none of the other studied markers could be detected (Fig. 4H, 4K, 4N, 4Q, 4T). Moreover, the expression of ZNF191 decreases in similar fashion in both species during neuronal differentiation, in all developing regions of the CNS at comparable developmental stages. Therefore, the sequence and expression data similarities further strengthen the hypothesis that ZNF/Zfp191 exerts a highly conserved function in progenitors of the mammalian CNS. Then, to evaluate more precisely the role of ZNF191 in

Figure 1. Zfp191 is expressed in neural progenitors in the mouse embryonic central nervous system. (A–N): Transverse section of the brain of E9.5 (A, B, E, F), E13.5 (C, D, H, I), and E15.5 (K–N) and spinal cord of E9.5 (G) and E13.5 (J) mouse embryos injected with 5-bromo-20 -deoxyuridine (BrdU). Hybridization with Zfp191 antisense RNA probe (blue) was followed by BrdU immunostaining (brown). (B, D, F, I, L, N): Higher magnification of the area delineated in (A, C, E, H, K, M), respectively. (O–X): Transverse section of the spinal cord (O–S) and of the lateral ventricle (T–X) of an E12.5 mouse embryo, first hybridized with Zfp191 antisense RNA probe (gray) then stained with antibodies against bIII-tubulin (green). (Q–S, V–X): Higher magnifications of the area included in the rectangle in (O–P) and (T–U), respectively. (S, X): Overlay of (Q–R) and (V–W), respectively. Scale bar ¼ 500 lm (C, H, J, K, M), 200 lm (G), 100 lm (A, B, D, E, O, P, T, U), 50 lm (F, I, L, N, Q–S, V–X). Abbreviation: 3v, third ventricle; 4v, fourth ventricle; E, embryonic day; lv, lateral ventricle; ne, neuroepithelium; sc, spinal cord; ZNF191/ Zfp191, zinc finger protein 191.


1647

ZNF191 mRNA by 80% compared with that in cells transduced with LVshCT or noninfected cells (data not shown). Importantly, 8 days after transduction, the knockdown of this factor had a profound impact on the proliferation of these cells. BrdU labeling indeed showed that dividing cells were less represented in cells transduced with LVshZF191-3 (6.5%, p < .005) (Fig. 5A, 5C) than in nontransduced cells (10.3%) and in cells transduced with LVshCT (11.0%). Because the decrease in the number of BrdU-labeled cells could be a consequence of either the lengthening of the cell cycle or the exit from the cell cycle, we analyzed the expression of Ki67 and p27. Ki67 is expressed in all cell cycle phases, except G0, whereas p27, an inhibitor of cyclin-dependent kinase-cyclin D complexes [45], drives neuronal precursor cells out of cycle and into differentiation [23, 24]. The number of Ki67-labeled cells was significantly (p < .0006) reduced in cells transduced with LVshZF191-3 (38.9%) compared with the number in nontransduced cells or in cells transduced with LVshCT (68.1% and 59.8% respectively) (Fig. 5C; supporting information Fig. S5). Conversely, as shown in Figure 5B and 5C, LVshZF191-3 caused an increase in the number of p27expressing cells (p < .004; 41.1%) compared with nontransduced cells (22.0%) or cells transduced with LVshCT (21.5%). Therefore, ZNF191 knockdown in neural progenitors results in the significant inhibition of proliferation by inducing cell cycle arrest. This finding prompted us to determine whether ZNF191 exerts a similar function in vivo, and we thus analyzed the effects of ZNF191 misexpression in vivo.

Figure 2. Zfp191 is expressed in neural progenitors in the mouse postnatal brain. Transverse sections of 2-day postnatal mouse brain showing the lateral ventricle (A–A00 , C–C00 ) and hippocampus (B–B00 , D–D00 ). Zfp191 was detected by in situ hybridization with Zfp191 antisense RNA probe (gray) (A, B, C, D), and then Ki67 (A0 , B0 ) or RC2 (C0 , D0 ) immunostaining was performed (green). (A00 , B00 , C00 , D00 ): Overlay of (A–A0 , B–B0 , C–C0 , D–D0 ), respectively. Scale bars ¼ 100 lm. Abbreviation: ZNF191/Zfp191, zinc finger protein 191.

CNS progenitors, we performed loss-of-function experiments by RNA interference.

ZNF191 Loss-of-Function Induces Premature Cell Cycle Exit and Differentiation of Neural Progenitors To establish whether the role of ZNF191 is related to the maintenance of the undifferentiated state of neural progenitors, in association or not with a control of the cell cycle, we investigated the effect of the ZNF191 inactivation on the proliferation of human neural cells. Preliminary investigations established that human neural cells isolated from the lateral ventricles of 7- and 9-week-old fetal brains maintained ZNF191 expression in culture (supporting information Fig. S4A). We then selected two shRNA sequences, one specific (shZF191-3) for targeting ZNF191 expression, and one scrambled (shCT), inefficient with respect to ZNF191 expression (supporting information Fig. S4B). The shZF191-3 and shCT shRNAs were introduced into a lentiviral vector coexpressing green fluorescent protein yielding, respectively, the LVshZF191-3 and LVshCT constructs, which were used to transduce human neural progenitor cells in culture. The capacity of LVshZF191-3 to inhibit ZNF191 expression was assessed by quantitative RT-PCR, in cells analyzed 4 days after transduction (100% transduction yield), with either LVshZF191-3 or LVshCT. We found that shZF191-3 reduced www.StemCells.com

Misexpression of ZNF191 Maintains the Proliferation of Neural Progenitors and Impedes Neuronal Differentiation In Vivo The knock out of Zfp191 induces embryonic lethality as early as E7.5 [6], which makes this approach unsuitable for the analysis of ZNF191 function in the developing CNS. On the other hand, mice carrying a transgene that induces misexpression of the human zinc finger protein 191 gene have been generated with no consequences observed on the different analyzed tissues, suggesting that compensatory mechanisms may take place at early stages of development to counteract ZNF191 misexpression [7]. Therefore, to avoid these pitfalls and to further characterize ZNF191 function by overexpression experiments, we carried out electroporation experiments in the chick embryo in ovo. The rational for this approach is based on the fact that the ZNF191 homologue does not exist in the chick, but, because ZNF191 plays an important and conserved role in mammalian neural precursors, it should have also an effect on chick development. Moreover, electroporation in the chick neural tube allows for the abrupt disruption of the embryonic genetic program [46]. pAdRSV-ZNF191-HA was electroporated in the spinal cord of chick embryos at stage HH12-15 [40] and electroporated embryos were collected 24 and 48 hours later. To assess the effect of ZNF191 misexpression on proliferation, short pulses of BrdU incorporation were performed [1/2] hour before collection of the embryos. We found a significant increase in the number of cells in the S phase in the electroporated versus the nonelectroporated side of embryonic spinal cords 48 hours after electroporation (48% compared with 35%) (Fig. 6A–6A00 ). Moreover, it is noteworthy that this increase was associated with a lower representation and a restriction of the marginal zone, which normally contains differentiated and postmitotic cells, suggesting that overexpression of ZNF191HA prevented the cells from exiting the cell cycle. To confirm the progenitor status of the cells overexpressing ZNF191, we analyzed the expression of the HMG-box transcription factor Sox2, a pan marker of the neural progenitor stage that is

1648


Figure 3. Zinc finger protein 191 (ZNF/Zfp191) expression is conserved in the central nervous system (CNS) of human and mice. (A–C): The plan and level of each section are indicated on the mouse embryo scheme (A), and the observed region is indicated in relation to the section (B, C). (D–F): ZNF191 expression was detected with ZNF191 antisense RNA probe in the spinal cord (D) and brain (E, F) of a 5-week-old human embryo. (G–I): Zfp191 was detected using Zfp191 antisense RNA in the spinal cord (G) and brain (H, I) of an embryonic day 12.5 mouse embryo, which corresponds to the same development stage of the CNS. Scale bar ¼ 100 lm. Abbreviations: 3v, third ventricle; 4v, fourth ventricle; D, dorsal; L, left; lv, lateral ventricle; R, right; sc, spinal cord; V, ventral.

downregulated by precursors as they exit the cell cycle and differentiate [47]. Overexpression of ZNF191-HA resulted in ectopic persistence of Sox2 expression at the margin of the spinal cord (Fig. 6B–6B00 ). Moreover, consistent with BrdU stainings, the marginal zone was very thin whereas Sox2 expression was extended within the marginal zone in the electroporated side (Fig. 6B0 , 6B00 , black arrows), indicating that cells expressing ZNF191-HA were maintained undifferentiated. These results suggest that ZNF191-HA forced expression keeps neural cells in a progenitor state and prevents them from leaving the cell cycle. This hypothesis is further strengthened by a clear decrease, after ZNF191-HA overexpression, in the number of cells expressing the protein p27 in the electroporated compared with the nonelectroporated side of the neural tube (6% compared with 10%) (Fig. 6C–6C00 ). In addition, the majority of ZNF191-HA-labeled cells did not express the p27 postmitotic marker (Fig. 6C00 ). Altogether and in accordance with the results obtained in ZNF191 knockdown experiments in human neural progenitors, these data indicate that ZNF191-HA forced expression stimulates cell proliferation and impedes cell cycle exit. Then, we further investigated this effect on proliferation to determine whether it could interfere with commitment into differentiation, either by acting on early specification or on panneuronal differentiation. Indeed, recent data have shown that in the chick embryonic spinal cord neuronal specification pathways could take place along with forced proliferation and be uncoupled from adequate neuronal differentiation [48]. We used genes of the LIM family as markers of neuronal specification to assess how ZNF191 could interfere with either aspect. LIM proteins have been shown to participate in neuronal specification pathways in the spinal cord, such as Isl1 in the ventral domain of motor neuron precursors or Lhx1/5 in precursors of several populations of interneurons. Misexpression of ZNF191HA induced a clear decrease in the number of cells expressing

Lhx1/5 (Fig. 6D–6D00 ) or Isl1 (supporting information Fig. S6). Consistently, cells expressing the early neuronal marker bIIItubulin were less represented in the electroporated side, and this marker was never found to be expressed in ZNF191-HA labeled cells (Fig. 6E–6E00 ). These data confirmed that ZNF191 can block the onset of neuronal differentiation from the initial step of specification. Because Notch signaling plays a major role in neural differentiation, we then assessed whether overexpression of ZNF191 interferes with this pathway.

ZNF191 Interferes with the Notch Signaling To test whether the ZNF191 capacity to block neuronal differentiation of neural progenitors was correlated to misregulation of the Notch pathway, we analyzed the effect of ZNF191 forced expression on the expression of effectors of the Notch pathway such as Dll1, Hes5, and two proneural genes, Cash1 and Ngn2. As shown in Figure 7A and 7A0 , we observed a reduction in the number of cells expressing Cash1 in the electroporated side of the spinal cord. The same was observed for Ngn2 (Fig. 7B, 7B0 ). This reduction was accompanied by a repression of Delta1 expression in cells producing ZNF191HA protein (Fig. 7C, 7C0 ) and by the repression of Hes5 (Fig. 7D, 7D0 ). These results indicate that ZNF191 exerts a negative control on the Notch pathway, even if the level of Notch1 mRNA was globally unchanged in the electroporated side (Fig. 7E, 7E0 ) and further support the role of ZNF191 in the inhibition of neural progenitor differentiation.

DISCUSSION Zinc finger proteins represent the largest family of transcription factors, because of their large representation within all


Figure 4. Characterization of cells expressing ZNF191 in the human embryonic brain. (A–B): Expression pattern of ZNF191 visualized by in situ hybridization on transverse sections of a 12-week-old human embryonic brain. Adjacent sections were first hybridized with a ZNF191 antisense RNA probe (A–E) and then stained with antibodies against nestin for neural progenitors (F–H), Ki67 for cycling cells (I– K), bIII-tubulin for neurons (L–N), GFAP for astrocytes (O–Q), and Olig2 for oligodendrocytes (R–T). (C-T): Higher magnifications of the area included in the rectangles in (A) and (B). Scale bars ¼ 500 lm (A, B), 100 lm (C–T). Abbreviations: 3v, third ventricle; 4v, fourth ventricle; GFAP, glial fibrillary acidic protein; hind, central canal of the hindbrain; lv, lateral ventricle; ZNF191/Zfp191, zinc finger protein 191.

species, their implication in a wide range of functions, and their association with other functional domains, such as homeodomains or KRAB or SCAN domains. ZNF191 has been isolated from a screening for Kru¨ppel-like zinc finger proteins www.StemCells.com

1649

Figure 5. ZNF191 knock-down alters the proliferation of human neural progenitors. (A–B): Noninfected cells and cells infected with the shCT or shZF191-3 expressing lentivirus immunostained with antibodies against BrdU (A) or the nuclear protein p27 (B). Nuclei were counterstained with Hoechst reagent. Transduced cells express GFP (C). Quantification of the percentage of cells expressing the proliferation markers BrdU, Ki67, and p27 for cells expressing shCT (red), shZF191-3 (yellow), or noninfected cells (blue). *, p < .004; **; p < .005; ***, p < .0006. Scale bar ¼ 50 lm. Abbreviations: BrdU, 5-bromo-20 -deoxyuridine; GFP, green fluorescent protein; NI, noninfected; sh, short hairpin; ZNF191/Zfp191, zinc finger protein 191.

1650


Figure 6. ZNF191-HA misexpression maintains proliferation and impedes neuronal differentiation of neural progenitors in vivo. (A–C00 ): Confocal analysis of spinal cord sections of chick embryos 48 hours after electroporation with the pAdRSV-ZNF191-HA plasmid, double stained with anti-HA antibody (A, B, C) and either with BrdU (A0 ) or p27 (C0 ) antibodies or chick Sox2 antisense RNA probe (B0 ). Arrows show the enlargement of the Sox2 expression domain on the electroporated side (left) compared with the nonelectroporated side (right). (A00 , B00 , C00 ): Overlay of (A–A0 , B–B0 , C–C0 ), respectively. (D–E00 ): Transverse sections of the spinal cord of chick embryos 24 hours after electroporation, stained with anti-HA (D, E) and either Lhx1/5 (D0 ) or bIII-tubulin (E0 ) antibodies. (D00 , E00 ): Overlay of (D–D0 ) and (E–E0 ), respectively. Scale bar ¼ 50 lm. Abbreviations: BrdU, 5-bromo-20 -deoxyuridine; HA, hemagglutinin; ZNF191/Zfp191, zinc finger protein 191.

expressed in hematopoietic cells [5]. This protein also contains a SCAN domain and is able to act as a repressor of transcription [5], but its function in hematopoietic cells has not been clarified. More recently, gene targeting provided the first

evidence that Zfp191 has important functions, because the null mutation caused early embryonic lethality in mice. Our laboratory implicated this factor as playing a role in the CNS because ZNF191 can bind in vitro to the TCAT repeated


1651

sequence of the TH gene [4]. Moreover, we have previously gathered expression data strongly suggesting that Zfp191 function is related to neural progenitors [8], thus prompting us to further characterize this function during neural development.

Zinc Finger Protein 191 Is Expressed in Neural Progenitors of the CNS of Mammals Neural progenitors can be defined as cells capable of proliferation, self-maintenance, and production of cells other than themselves. These cells are almost exclusively located in the ventricular/subventricular zones of the developing CNS. Our previous [8] and present data have together established that Zfp191 is systematically expressed in the ventricular zone of the developing neural tube, with no restriction according to the anteroposterior or dorsoventral axis, indicating that this expression is not modulated by region-specific genetic pathways. Here we have shown that this exclusively mammalian gene presents high sequence homology between mouse and human. Furthermore we provided evidence that the characteristic expression pattern in the CNS can be extended to humans, implying that the gene is regulated in the same way and probably exerts very similar functions in different species. Characterization of the cells expressing the zinc finger protein 191 in human or mouse embryonic brain and spinal cord revealed that these cells are able to proliferate, as established by BrdU incorporation and, conversely, do not express markers of differentiated cells. This finding confirmed that ZNF191 and its murine homolog Zfp191 are expressed in neural progenitors during embryogenesis. This association was not observed on the pial side of the presumptive cortical plate of the 12-week human fetus, which expressed ZNF191 but not the proliferation or differentiation markers studied. This feature was not observed in the mouse and could probably characterize the subplate, which is much more developed as a special feature of humans and primates [49]. Notably, the expression in progenitors occurs at all stages, from the earliest stages of neurogenesis up to the newborn. This result indicates that ZNF/Zfp191 expression is not restricted to any developmental stage and seems to accompany the different types of precursors that have been described during neurogenesis and are associated with either symmetric or asymmetric divisions.

Expression in Neural Progenitors Promotes Proliferation and Impedes Cell Commitment

Figure 7. Notch signaling is blocked by ZNF191-HA overexpression in vivo. Spinal cord sections of chick embryos 24 hours after electroporation with the pAdRSV-ZNF191-HA plasmid, hybridized with chick Cash1 (A0 ), Ngn2 (B0 ), Dll-1 (C0 ), Hes5 (D0 ), and Notch1 (E0 ) antisense RNA probes and then immunostained with anti-HA antibodies (A, B, C, D, E). Arrows in (B) and (B0 ) show the repression of Ngn2 expression (B0 ) in the electroporated cells (B). Scale bars ¼ 50 lm. Abbreviations: HA, hemagglutinin; ZNF191/Zfp191, zinc finger protein 191.

www.StemCells.com

Several lines of evidence gathered with the expression pattern data suggest that the function of ZNF/Zfp191 could be modulated according to the type of cell division underway in proliferating cells. Indeed, expression of Zfp191 appeared to be more pronounced at early embryonic stages when symmetric divisions occur at high frequency and at the apical side of the ventricular zone, where polarized progenitors, which are supposed to give rise principally to symmetric division, reside [13, 15]. Thus, a high level of ZNF/Zfp191 expression could be associated with self-renewal, whereas lower expression could suffice to maintain the progenitor stage and be permissive for asymmetric divisions. Furthermore, Zfp191 mRNA appeared to concentrate at the apical side. Unequal cytoplasmic RNA repartition has been described in Drosophila neural cells and in vertebrate gastrointestinal cells and is supposed to rely on 30 untranslated sequences [50, 51]. Hence, the highly conserved 140 nucleotides in the 30 UTR region could be involved in this local addressing. Further experiments will be necessary to explore the molecular basis of this phenomenon and its eventual functional significance, which may be related to still unknown ZNF/Zfp191 properties. However, as


1652

expected for a transcription factor, the ZNF191-HA protein appeared to be mostly addressed in the nucleus. Both knockdown and gain-of-function studies support an active role of ZNF/Zfp191 in the maintenance of the proliferative state, at the expense of differentiation. Interestingly, the finding that ZNF191 misexpression impeded not only neuronal differentiation but also the prior emergence of specification pathways, which have been shown to be activated before cell cycle exit, such as motoneuron and interneuron pathways in the spinal cord, suggests that ZNF191 acts as a potent inhibitor of cell differentiation. This effect is clearly mediated by the maintenance of Sox2, which has been shown to be a strong repressor of proneural genes [47], in association with a negative control on the Notch pathway, which is also required for the onset of neurogenesis [52]. The repression of neuronal differentiation requires high paraphysiological levels of ZNF191 expression, which were easily achieved by electroporation. However, high levels of ZNF191 expression may be required also during the early stages of normal brain development and may subsequently decrease, allowing for neural differentiation. Indeed, the decrease in the level of expression we observed at later stages of development, when neurogenesis is very active, and in the adult brain may be more permissive with neuronal specification and engagement into a differentiation pathway. A similar functional dependence on the expression level was previously reported for ZNF38, a transcription factor whose zinc fingers exhibit the highest homology with ZNF/Zfp191 and that is expressed in neural progenitors of the cerebellum and the dentate gyrus [53]. Interestingly, transgenic misexpression of ZNF38 in mice did not result in any phenotypic abnormality but showed the occurrence of a slight overproliferation of these progenitors that was dependent on the copy number of the transgene [54]. Similarly, the same approach with ZNF191 did not result in any remarkable phenotype; however, the number of transgene copies and the level of ZNF191 expression were not reported in this case [7].

ZNF191 Function Is Not Redundant and May Participate in the Control of Genes Essential for the Promotion of Cell Proliferation The fact that Zfp191 inactivation leads to very early embryonic lethality proves that its function is unique and cannot be assumed by other proteins containing highly homologous domains, either zinc fingers, such as ZNF38, or a SCAN domain. In fact, our data suggest that ZNF/Zfp191 function relies principally on the zinc finger domain and that the

REFERENCES 1 2 3 4 5

6 7

Klug A, Schwabe JW. Protein motifs 5: zinc fingers FASEB J 1995;9: 597–604. Nam K, Honer C, Schumacher C. Structural components of SCAN-domain dimerizations. Proteins 2004;56:685–692. Schumacher C, Wang H, Honer C et al. The SCAN domain mediates selective oligomerization. J Biol Chem 2000;275:17173–17179. Albane`se V, Biguet NF, Kiefer H et al. Quantitative effects on gene silencing by allelic variation at a tetranucleotide microsatellite. Hum Mol Genet 2001;10:1785–1792. Han ZG, Zhang QH, Ye M et al. Molecular cloning of six novel Kruppel-like zinc finger genes from hematopoietic cells and identification of a novel transregulatory domain KRNB. J Biol Chem 1999;274: 35741–35748. Li J, Chen X, Yang H et al. The zinc finger transcription factor 191 is required for early embryonic development and cell proliferation. Exp Cell Res 2006;312:3990–3998. Li JZ, Chen X, Yang H et al. Establishment of transgenic mice carrying gene encoding human zinc finger protein 191. World J Gastroenterol 2004;10:264–267.

SCAN domain may be dispensable. Indeed, this domain does not exist in avian species and therefore cannot account for any aspect of the results obtained by overexpression in the chick, which were fully consistent with the findings resulting from knockdown experiments in human neural progenitors. Accordingly, we propose that ZNF/Zfp191 zinc fingers participate in a very specific manner to the positive control of the expression of genes involved in the promotion of the cell cycle and/or in the repression of genes implicated in cell fate commitment or neuronal differentiation. Moreover, Zfp191null embryos die at E7.5, before the onset of neurogenesis [6], and the gene is also expressed in proliferative regions not restricted to the nervous system, suggesting that ZNF/Zfp191 function is related to basic aspects of cell cycle control and/or maintenance of a progenitor state. Therefore, the characterization of the genes targeted and of the genetic pathways controlled by ZNF/Zfp191 is of paramount interest, particularly for the possible interaction with chromatin modifiers, which have been shown to selectively participate in either the maintenance of the cell cycle, such as Sox genes, or in the consolidation of the differentiation process.

ACKNOWLEDGMENTS We are grateful to Ce´dric Francius for his assistance in the electroporation of chick embryos, to E. Lalli for critical reading of the manuscript, and to F. Brau for assistance with confocal microscopy. We thank Professor Oury and colleagues from Hoˆpital Robert Debre´ for provision of study material and P. Gilardi, F. Guillemot, and D. Anderson for plasmids. This work was supported by the Centre National de la Recherche Scientifique, Universite´ Pierre et Marie Curie, Fondation pour la Recherche Me´dicale, Association pour la Recherche contre le Cancer, the Institut pour la Recherche sur la Moelle Epinie`re, and the Association Française contre les Myopathies. O.K. is currently affiliated with the Institut de Pharmacologie Molećulaire et Cellulaire, Centre National de la Recherche Scientifique, UMR 6097, 660 route des Lucioles, Sophia Antipolis, 06560 Valbonne, France.

DISCLOSURE

OF OF

POTENTIAL CONFLICTS INTEREST

The authors indicate no potential conflicts of interest. 8 9 10 11 12 13 14 15 16 17

Khalfallah O, Faucon-Biguet N, Nardelli J et al. Expression of the transcription factor Zfp191 during embryonic development in the mouse. Gene Expr Patterns 2008;8:148–154. Ohnuma S, Hopper S, Wang KC et al. Co-ordinating retinal histogenesis: early cell cycle exit enhances early cell fate determination in the Xenopus retina. Development 2002;129:2435–2446. Cremisi F, Philpott A, Ohnuma S. Cell cycle and cell fate interactions in neural development. Curr Opin Neurobiol 2003;13:26–33. Galderisi U, Jori FP, Giordano A. Cell cycle regulation and neural differentiation. Oncogene 2003;22:5208–5219. Ohnuma S, Harris WA. Neurogenesis and the cell cycle. Neuron 2003;40:199–208. Hartfuss E, Galli R, Heins N et al. Characterization of CNS precursor subtypes and radial glia. Dev Biol 2001;229:15–30. Huttner WB, Kosodo Y. Symmetric versus asymmetric cell division during neurogenesis in the developing vertebrate central nervous system. Curr Opin Cell Biol 2005;17:648–657. Go¨tz M, Huttner WB. The cell biology of neurogenesis. Nat Rev Mol Cell Biol 2005;6:777–788. Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999;284:770–776. Louvi A, Artavanis-Tsakonas S. Notch signalling in vertebrate neural development. Nat Rev Neurosci 2006;7:93–102.


18 Takahashi T, Nowakowski RS, Caviness VS Jr. The cell cycle of the pseudostratified ventricular epithelium of the embryonic murine cerebral wall. J Neurosci 1995;15:6046–6057. 19 Calegari F, Haubensak W, Haffner C et al. Selective lengthening of the cell cycle in the neurogenic subpopulation of neural progenitor cells during mouse brain development. J Neurosci 2005;25: 6533–6538. 20 Lukaszewicz A, Savatier P, Cortay V et al. G1 phase regulation, areaspecific cell cycle control, and cytoarchitectonics in the primate cortex. Neuron 2005;47:353–364. 21 Glickstein SB, Alexander S, Ross ME. Differences in cyclin D2 and D1 protein expression distinguish forebrain progenitor subsets. Cereb Cortex 2007;17:632–642. 22 Lobjois V, Benazeraf B, Bertrand N et al. Specific regulation of cyclins D1 and D2 by FGF and Shh signaling coordinates cell cycle progression, patterning, and differentiation during early steps of spinal cord development. Dev Biol 2004;273:195–209. 23 Livesey FJ, Cepko CL. Vertebrate neural cell-fate determination: lessons from the retina. Nat Rev Neurosci 2001;2:109–118. 24 Dyer MA, Cepko CL. p27Kip1 and p57Kip2 regulate proliferation in distinct retinal progenitor cell populations. J Neurosci 2001;21: 4259–4271. 25 Joseph B, Wallen-Mackenzie A, Benoit G et al. p57(Kip2) cooperates with Nurr1 in developing dopamine cells. Proc Natl Acad Sci U|S|A 2003;100:15619–15624. 26 Dubreuil V, Hirsch MR, Pattyn A et al. The Phox2b transcription factor coordinately regulates neuronal cell cycle exit and identity. Development 2000;127:5191–5201. 27 Novitch BG, Chen AI, Jessell TM. Coordinate regulation of motor neuron subtype identity and pan-neuronal properties by the bHLH repressor Olig2. Neuron 2001;31:773–789. 28 Quinn JC, Molinek M, Martynoga BS et al. Pax6 controls cerebral cortical cell number by regulating exit from the cell cycle and specifies cortical cell identity by a cell autonomous mechanism. Dev Biol 2007;302:50–65. 29 Ille F, Atanasoski S, Falk S et al. Wnt/BMP signal integration regulates the balance between proliferation and differentiation of neuroepithelial cells in the dorsal spinal cord. Dev Biol 2007;304:394–408. 30 Kenney AM, Widlund HR, Rowitch DH. Hedgehog and PI-3 kinase signaling converge on Nmyc1 to promote cell cycle progression in cerebellar neuronal precursors. Development 2004;131:217–228. 31 Megason SG, McMahon AP. A mitogen gradient of dorsal midline Wnts organizes growth in the CNS. Development 2002;129:2087–2098. 32 Edlund T, Jessell TM. Progression from extrinsic to intrinsic signaling in cell fate specification: a view from the nervous system. Cell 1999; 96:211–224. 33 Giudicelli F, Taillebourg E, Charnay P et al. Krox-20 patterns the hindbrain through both cell-autonomous and non cell-autonomous mechanisms. Genes Dev 2001;15:567–580. 34 Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science 2002;296: 550–553. 35 Santamaria J, Khalfallah O, Sauty C et al. Silencing of choline acetyltransferase expression by lentivirus-mediated RNA interference in cultured cells and in the adult rodent brain. J Neurosci Res 2009;87: 532–544.

1653

36 Wiznerowicz M, Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol 2003;77:8957–8961. 37 Buc-Caron MH. Neuroepithelial progenitor cells explanted from human fetal brain proliferate and differentiate in vitro. Neurobiol Dis 1995;2:37–47. 38 Zennou V, Serguera C, Sarkis C et al. The HIV-1 DNA flap stimulates HIV vector-mediated cell transduction in the brain. Nat Biotechnol 2001;19:446–450. 39 Castaing M, Guerci A, Mallet J et al. Efficient restricted gene expression in b cells by lentivirus-mediated gene transfer into pancreatic stem/progenitor cells. Diabetologia 2005;48:709–719. 40 Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. 1951. Dev Dyn 1992;195:231–272. 41 El Wakil A, Francius C, Wolff A et al. The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors. Development 2006;133:2155–2165. 42 Ravassard P, Chatail F, Mallet J et al. Relax, a novel rat bHLH transcriptional regulator transiently expressed in the ventricular proliferating zone of the developing central nervous system. J Neurosci Res 1997;48:146–158. 43 Kee N, Sivalingam S, Boonstra R et al. The utility of Ki-67 and BrdU as proliferative markers of adult neurogenesis. J Neurosci Methods 2002;115:97–105. 44 Misson JP, Edwards MA, Yamamoto M et al. Identification of radial glial cells within the developing murine central nervous system: studies based upon a new immunohistochemical marker. Brain Res Dev Brain Res 1988;44:95–108. 45 Cunningham JJ, Roussel MF. Cyclin-dependent kinase inhibitors in the development of the central nervous system. Cell Growth Differ 2001;12:387–396. 46 Itasaki N, Bel-Vialar S, Krumlauf R. ‘Shocking’ developments in chick embryology: electroporation and in ovo gene expression. Nat Cell Biol 1999;1:E203–207. 47 Bylund M, Andersson E, Novitch BG et al. Vertebrate neurogenesis is counteracted by Sox1–3 activity. Nat Neurosci 2003;6:1162–1168. 48 Lobjois V, Bel-Vialar S, Trousse F et al. Forcing neural progenitor cells to cycle is insufficient to alter cell-fate decision and timing of neuronal differentiation in the spinal cord. Neural Dev 2008;3:4. 49 Bystron I, Blakemore C, Rakic P. Development of the human cerebral cortex: Boulder Committee revisited. Nat Rev Neurosci 2008;9: 110–122. 50 Simmonds AJ, dosSantos G, Livne-Bar I et al. Apical localization of wingless transcripts is required for wingless signaling. Cell 2001;105: 197–207. 51 Houle VM, Li W, Montgomery RK et al. mRNA localization in polarized intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 2003;284:G722–G727. 52 Bertrand N, Castro DS, Guillemot F. Proneural genes and the specification of neural cell types. Nat Rev Neurosci 2002;3:517–530. 53 Yang XW, Zhong R, Heintz N. Granule cell specification in the developing mouse brain as defined by expression of the zinc finger transcription factor RU49. Development 1996;122:555–566. 54 Yang XW, Wynder C, Doughty ML et al. BAC-mediated gene-dosage analysis reveals a role for Zipro1 (Ru49/Zfp38) in progenitor cell proliferation in cerebellum and skin. Nature Genetics 1999;22:327–335.

See www.StemCells.com for supporting information available online.