Zootaxa, New species of Microhyla from Sarawak: Old ...

Zootaxa 2571: 37–52 (2010) www.mapress.com / zootaxa/

ISSN 1175-5326 (print edition)

Article

Copyright © 2010 · Magnolia Press

ZOOTAXA ISSN 1175-5334 (online edition)

New species of Microhyla from Sarawak: Old World’s smallest frogs crawl out of miniature pitcher plants on Borneo (Amphibia: Anura: Microhylidae) INDRANEIL DAS1, 3 & ALEXANDER HAAS2 1

Institute of Biodiversity and Environmental Conservation, Universiti Malaysia Sarawak, 94300, Kota Samarahan, Sarawak, Malaysia. E-mail: [email protected] 2 Biozentrum Grindel und Zoologisches Museum, Martin-Luther-King-Platz 3, 20146 Hamburg, Germany. E-mail: [email protected] 3 Corresponding author

Abstract A new diminutive species of microhylid frog (genus Microhyla) is described from the Matang Range, Sarawak, Malaysian Borneo. The new species is an obligate of the pitcher plant, Nepenthes ampullaria, breeding in senescent or mature pitchers, and is Old World’s smallest frog and one of the world's tiniest: adult males range between SVL 10.6– 12.8 mm (n = 8). The new species is diagnosable from congeners in showing dorsum with low tubercles that are relatively more distinct on flanks; a weak, broken, mid-vertebral ridge, starting from forehead and continuing along body; no dermal fold across forehead; tympanic membrane and tympanic annulus absent; Finger I reduced to a nub proximal to Finger II in males; toe tips weakly dilated; phalanges with longitudinal grooves, forming two scale-like structures; webbing on toe IV basal; toes with narrow dermal fringes; inner and outer metatarsal tubercles present; and dorsum brown with an hour-glass shaped mark on scapular region. Miniaturization and reduced webbing may be the result of navigation on the slippery zone of pitchers, situated below the peristome. Key words: Microhyla nepenthicola sp. nov., Microhylidae, Kubah National Park, Sarawak, Borneo

Introduction A number of amphibian species that are under 15 mm have been termed 'diminutive', 'minute', or 'miniature' (Estrada and Hedges 1996; Biju et al. 2007; Duellman and Hedges 2008). The smallest amphibian species known belong to the genera Eleutherodactylus (fide Estrada and Hedges 1996), Brachycephalus (fide Frost et al. 2006), Noblella (fide Lehr and Catenazzi 2009), and Stumpffia (fide Vences and Glaw 1991). Among Old World frogs, the smallest member of the microhylid genus Stumpffia of Madagascar, S. pygmaea, has an adult SVL range 10.9–12.0 mm (Vences and Glaw 1991). Lehr and Catenazzi (2009) discussed the potential problems with the use of the term “smallest” for anuran amphibian adults, including the necessity of large series of specimens to understand body size variation, and some reports may suffer from sex-based sampling bias. Nonetheless, miniaturization itself is a biologically intriguing phenomenon and offer substantial opportunities for further biological investigations into development and ontogenetic aspects, field biology and other aspects. The genus Microhyla Tschudi, 1838 (Anura: Microhylidae) is a relatively speciose, with 30 species currently recognized (Frost 2009), its members known from the Indian subcontinent, Indo-Malaya and IndoChina (Frost 1985; Iskandar and Colijn 2000; Matsui et al. 2005). Five nominal species have been reported from Borneo: Microhyla berdmorei (Blyth 1856); M. borneensis Parker 1928; M. maculifera Inger 1989; M. perparva Inger and Frogner 1979, and M. petrigena Inger and Frogner 1979. During studies of amphibians, focused on identification of their larval forms to parent species using genetic barcoding, we collected a series of Microhyla from Kubah National Park, Matang Range, Sarawak, Malaysia (western Borneo; Fig. 1), which do not fit the description of a known species. Accepted by M. Vences: 23 Jul. 2010; published: 19 Aug. 2010

37

FIGURE 1. Relief map of Borneo, showing the type locality of Microhyla nepenthicola sp. nov. at Kubah National Park (inset), within the Matang Range, Sarawak, Malaysia.

Material and methods Field collection and preparation: Given the small size of the new species, especially of males, collection of specimens proved to be a challenge, although male choruses are heard all times of the year (except on the driest of nights). All males collected were tracked down by their calls, and only two females were collected, one taken in amplexus. Specimens were photographed prior to euthanasia, fixed in formalin ca. 4 h after collection and subsequently washed in water and transferred to 70% ethanol within a week of collection. Sex was determined on the presence of vocal sacs in combination with calling behavior. Genetic analysis: Genetic matching of tadpoles with adults was based on the partial mitochondrial 16S rRNA gene. DNA was extracted from macerated liver or muscle tissue according to standard methods (Hillis et al. 1996) and was stored at -20°C. DNA amplification of partial 16S rRNA gene sequences was done with peqGOLD PCR-Master-Mix Y (Peqlab) according to the manufacturer‘s guidelines. The sense primer (16SC) 5'- GTRGGCCTAAAAGCAGCCAC - 3' and the anti-sense primer (16SD) 5'- CTCCGGTCTGAACTCAGATCACGTAG - 3' were chosen (Evans et al. 2003). They amplified an up to 850 bp long 16S rRNA fragment that overlaps broadly with 16S DNA sequences obtained from other primer pairs (e.g., Vences et al. 2005). The cycling conditions for the amplification were: denaturation at 94°C for 2 min; 35 cycles at 94°C for 0:30 min, 48.2°C

38

· Zootaxa 2571 © 2010 Magnolia Press

DAS & HAAS

for 0:30 min, and 72°C for 1:00 min; then one extension cycle at 72°C for 5:00 min, stop at 4°C. The PCR products were purified using a Quiagen gel extraction kit. Single strand sequencing was done by a contractor (Agowa Berlin; www.agowa.de) with the 16SC primer. The DNA sequences obtained were aligned automatically using Clustal W (implemented at http://align.genome.jp/) and then checked visually. Genetic sequences that where generated in the present study, including taxa for comparison, where deposited at GenBank under accession numbers GU154879–GU154889. Collected at the same locality at Kubah National Park, an adult and a larval 16S single-strand sequences had an overlap of 809 bp with difference in only 5 positions (99.38% match). We take that as sufficient proof that the larvae found belong to the adults from the same locality. In order to assess of the phylogenetic position and closest relatives of the new species, we compiled a data set representing microhyline genera that occur in south-east Asia. We chose two rhacophorids, Rhacophorus pardalis and Nyctixalus pictus, as outgroup taxa. The original data consisted of partial 16S sequences of 35 taxa. Ribosomal RNA sequences form stable secondary structures, therefore we used RNAsalsa (Stocsits et al. 2009) to align sequences. This software package aligns rRNA sequences according to structure and primary sequence information. We used default parameter settings of RNAsalsa and a structure constraint derived from the orthologous Saccharomyces rRNA sequence. The primary sequence alignment extended over 1093 aligned positions. However, for the majority of taxa available sequences were much shorter. We used Aliscore (Misof and Misof 2009) with default parameter settings to mask the sequence alignment to an alignment section in which the majority of taxa were present and sections of putative ambiguous alignment were excluded. This masked alignment spanned 568 aligned positions. Aliscore has been shown to remove sequences that are not significantly different from random sequences, i.e., non-informative, and increased node support in simulation studies (Misof and Misof 2009). We performed parsimony analyses using Paup 4.beta (Swofford 2002) using heuristic search strategies with random addition of sequences and 1000 replications. These heuristic searches were executed three times independently, to make sure that all shortest trees had been found. The analyses resulted in six shortest trees. To calculate Bremer support indices we used AutoDecay (Eriksson 2003) and Paup under identical search settings. The tree was visualized using Dendroscope (Huson et al. 2007). A second analysis was done with the same taxon sample (except for the exclusion of one outgroup taxon, Rhacophorus pardalis). Alignment was performed with MAFFT (Katoh et al. 2002) and models of evolution were optimized using Modeltest 3.4 (Posada and Crandall 1998). Phylogenetic Bayesian Inference analysis was performed using MrBayes 3.1.2 (Huelsenbeck and Ronquist 2001; Ronquist and Huelsenbeck 2003). We assumed a GTR+I+G model with uninformative priors (prset revmatpr=dirichlet(1,1,1,1,1,1)). Metropoliscoupled Markov chain Monte Carlo (MCMCMC) sampling was performed with one cold and three heated chains that were run for 1,000,000 generations each. Starting trees were random and trees were sampled every 100th generation. Two independent runs were performed in parallel and were continued until the runs had converged. Posterior probabilities were estimated on the final 8,000 trees (burnin = 2000). Measurements: The following measurements were taken with Mitutoyo TM dial vernier callipers (to the nearest 0.1 mm), ca. 8 weeks after collection: snout-vent length (SVL, from tip of snout to vent); tibia length (TBL, distance between surface of knee and surface of heel, with both tibia and tarsus flexed); head length (HL, distance between angle of jaws and snout-tip); head width (HW, measured at angle of jaws); head depth (HD, greatest transverse depth of head, taken posterior of the orbital region); eye diameter (ED, horizontal diameter of the eyes); interorbital distance (IO, least distance between upper eyelids); internarial distance (IN, distance between nostrils); eye to snout distance (E-S, distance between anterior-most point of eyes and tip of snout); eye to nostril distance (E-N, distance between anterior-most point of eyes and nostrils); axilla to groin distance (A-G, distance between posterior edge of forelimb at its insertion to body to anterior edge of hind limb at its insertion to body); and body width (BW, greatest width of body). In addition, we measured the length of digits on the left limbs from the base to tip. Acoustic methods: Calls were recorded using a Marantz PMD670 portable solid state recorder and a K6 Sennheiser, shot-gun type microphone. Call recordings were visualized and edited with Audacity® 1.3.7 software on a Apple iMac computer.

NEW MICROHYLA FROM BORNEO

Zootaxa 2571 © 2010 Magnolia Press ·

39

Photography: Colour notes on the holotype were taken from Fujichrome Velvia 100 ASA 35 mm slide transparency film, and compared with color swatches of Smithe (1975; 1981). Metamorphs and larval stages were photographed with either a Nikon D70 or a D100 body and a 105 mm lens, using a SB800 flash. Data sources: Sources of data on character states and distribution of congeneric species of Microhyla and its sister lineage, Micryletta, include the specimens examined (see Appendix I) as well as the following works: Bain and Truong (2004); Berry (1975), Das et al. (2007), Dutta and Ray (2000), Fernando and Siriwardhane (1996), Inger (1966; 1989), Inger and Frogner (1980); Inger and Stuebing (1997), Manthey and Grossmann (1997), Nieden (1923), Parker (1926; 1934), Pillai (1977), Taylor (1962), van Kampen (1923), Wu et al. (1987), and Yang (1991). Museum abbreviations (after Leviton et al. 1985, where available, except ZRC for USDZ) include: DWNP = Zoological Museum of the Department of Wildlife and National Parks, Kuala Lumpur, Malaysia, FMNH = Field Museum of Natural History, Chicago, USA, FRIM = Forest Research Institute Malaysia, Kepong, Malaysia, LSUHC = La Sierra University Herpetological Collection, La Sierra University, Riverside, USA, RMNH = Naturalis, Leiden, The Netherlands, SBC = Sarawak Biodiversity Centre, Kuching, Sarawak, Malaysia, UBD = Zoological Museum of the Department of Biology, Universiti Brunei Darussalam, Bandar Seri Begawan, Brunei Darussalam, WHT = Wildlife Heritage Trust of Sri Lanka, Colombo, Sri Lanka (currently accessioned with the National Museum, Colombo, Sri Lanka) and ZSI = Zoological Survey of India, Kolkata, India. In addition, ZRC is the abbreviation used for the Raffles Museum of Biodiversity Research, National University of Singapore, Singapore (the abbreviation used in Leviton et al. 1985, is USDZ). In addition, ID refers to the first author’s field series, which will be deposited at SBC and ZRC.

Microhyla nepenthicola sp. nov. (Figs. 2–4) Holotype: ZRC A.12431, adult male, from near 1,000 feet marker, Summit Trail, Gunung Serapi (01º36’24”N, 110º11’24”E [WGS84]), Kubah National Park, Matang Range, Sarawak, East Malaysia (Borneo); altitude ca. 300 m asl. I. Das and A. Haas, 4 September 2004. Paratypes: ZRC A.12432-34, paratopotypes, other data as for holotype, adult males; ZRC A.12435-36, paratopotypes, adult females, I. Das and A. Jankowski, respectively, 11 May 2005 and 29 October 2005, respectively; ZRC A.12437–40; paratopotype, adult males other data as for holotype, A. Jankowski, 13 September 2005, 29 November 2005, 7 December 2005 and 28 January 2006, respectively. Diagnosis: We allocate these specimens to Microhyla for showing the following characters diagnostic for the genus (Parker 1934; Inger 1966; Malkmus et al. 2002): narrow head; body flattened; eyes reduced; maxillary and vomerine teeth absent; reduction of Finger I; toes with reduced webbing; pupil circular; tongue large, oval and entire; an inner metatarsal tubercle under each foot; larvae lacking keratinized beaks; terminal mouth and laterally-positioned eyes and vent embedded medially in lower tail fin. A small (SVL 10.6–12.8 mm in eight males; SVL 17.9 and 18.8 mm in the two females) species of Microhyla, diagnosable from congeneric species in showing the following combination of characters: dorsum with low tubercles that are relatively more distinct on flanks; a weak, broken, mid-vertebral ridge, starting from forehead and continuing along body; no dermal fold across forehead; tympanic membrane and tympanic annulus absent; Finger I reduced to a nub proximal to Finger II in males; toe tips weakly dilated; phalanges with longitudinal grooves, forming two scale-like structures; webbing on toe IV basal; toes with narrow dermal fringes; inner and outer metatarsal tubercles present; and dorsum brown with an hour-glass shaped mark on scapular region. Description of holotype: Adult male, SVL 11.8 mm; body subtriangular, depressed; body width 6.0 mm; axilla to groin distance 4.8 mm; head length 3.4 mm; head width 3.4 mm; head as wide as long (HW/HL ratio 1.00); head depth 2.7 mm; snout obtusely pointed when viewed dorsally and especially laterally; projecting well beyond mandible, but not tapering in dorsal view; nostrils laterally positioned, nearer tip of snout than to eye, eye to snout distance 1.7 mm; eye to nostril distance 1.1 mm (E-N/E-S ratio 0.64); internarial distance (1.4 mm) greater than distance from anterior margin of eye to nostril (IN/E-N ratio 1.27); eye small (diameter

40


DAS & HAAS

1.3 mm); smaller than half of head length (ED/HL ratio 0.39); its diameter slightly greater than eye to nostril distance (ED/E-N ratio 1.18); interorbital width (2.7 mm) greater than upper eyelid width (1.0 mm) (IO/UE ratio 2.70); canthus rostralis obtuse; loreal region vertical; a weak ‘W’- shaped notch (= symphysial knob) on anterior edge of mandible; mouth extends to posterior corner of eye; choanae located against anterior of palate visible when viewed from below; teeth absent on maxilla and vomerine regions; no dermal ridges across palate; tongue oval, smooth, rounded apically, free for approximately half its length; pupil rounded; tympanic membrane and tympanic annulus not visible externally; weak fold across supratympanic region extends from posterior corner of orbit to before insertion of forelimbs; cloacal opening at mid-level; median subgular vocal sac.

FIGURE 2. Holotype of Microhyla nepenthicola sp. nov. (ZRC A.12431), adult male, in life, showing A. dorsolateral aspect and B. ventral aspect.

FIGURE 3. A. Manus and B. Pes of right hand and leg of holotype of Microhyla nepenthicola sp. nov. (ZRC A.12431), adult male. Scale marker = 1 mm.



41

FIGURE 4. Early stages in Microhyla nepenthicola sp. nov. A. Stage 36 larva in lateral (a) and dorsal (b) views; also, an oral (c) view (ZMH A 10015). B. A group of late-stage larvae of Microhyla nepenthicola sp. nov. (unpreserved), within a pitcher of Nepenthes ampullaria. C. A live metamorph of Microhyla nepenthicola sp. nov. (unpreserved) on a scale bar.

Fore limbs short; fingers free of web or skin fringes; relative length of fingers (measurements in parentheses, in mm): 3 (1.6) > 2 (1.1) > 4 (0.7) > 1 (0.4); finger tips weakly swollen but not dilated, lacking dermal fringe; dorsal surface of all fingers with longitudinal grooves forming a two-scaled structure; Finger I reduced to a nub or a tuberculate structure, located proximally to Finger II; subarticular tubercles prominent on Fingers II–IV (absent on Finger I), rounded, numbering one on second finger, two on third and fourth fingers; fleshy palmar tubercles; nuptial pads absent on fingers; no enlarged glands on lower arm.

42


DAS & HAAS

Hind limbs short; tibia length 7.5 mm; dorsal surfaces of thigh and tibia nearly smooth; dorsal surface of all toes with longitudinal grooves forming a two-scaled structure; toes basally webbed- webbing on Toe 1 basal; on Toe II basal (inner) and level between subarticular tubercle and distal swelling (outer); Toe III basal subarticular tubercles (inner) and distal subarticular tubercle (outer); Toe IV basal subarticular tubercle (inner); relative length of toes (measurements in parentheses, in mm): 4 (5.1) > 3 (3.5) > 2 (2.2) > 5 (1.7) > 1 (0.5); toe tip weakly dilated; subarticular tubercles prominent, rounded, numbering one on first and second toes; two on third and fourth toes; a large, pale, elongate compressed outer metatarsal tubercle, that is not shovel-shaped, and a slightly smaller, darker, inner metatarsal tubercle. Dorsum with low tubercles that are relatively more distinct on flanks; a weak midvertebral dermal fold that extends from postorbital region to above vent; eyelids and upper surfaces of limbs smooth; a weak and narrow supratympanic fold extends from posterior corner of orbit of eye to axilla; abdomen and inner side of thighs smooth. Colour: In life, dorsum Orange-Rufous (Color #132C), with scattered Peach Red (Color #94) patches on upper surfaces of body and limbs; snout region Vinaceous (Color #3); a Raw Umber (Color #223) hour-glass pattern with a somewhat irregular outline, whose anterior edge lies across interorbital region, covering the anterior third of dorsum, its edges most distinctly indicated; Robin Rufous (Color #340) paired subtriangular patches on either sides of midbody; snout-tip with two coalesced Sepia (Color #119) ovoid blotches; upper lips with two Sepia (Color #119) patches; a Pale Horn (Color #92) stripe, half eye diameter in thickness, runs obliquely on temporal region, corresponding to the dermal fold behind the angle of the jaws; a Jet Black (Color #89) stripe, with a Peach Red (Color #94) dorsal edge, on scapular region, that extends from level of junction of fore arm, and curves slightly ventrally, terminating past midlevel of body, the dorsal border of stripe is well defined, ventral border wavy and interrupted; ground colour of flanks slightly paler than that of dorsum; thigh, shank and lower arm Orange-Rufous (Color #132C), with narrow Dark Brownish Olive (Color #129) bands; phalange similarly coloured; anterior edge of thighs with an elongated Sepia (Color #119) patch close to the level of the knees; a short Dusky Brown (Color #19) bar across anal region; gular region Pale Pinkish Buff (Color #121D) with Walnut Brown (Color #221B) mottling; pectoral and abdominal regions unpatterned cream; undersurfaces of fore and hind limbs Raw Umber (Color #223). Pupil black, iris BuffYellow (Color #53), within which area extensive areas with dark reticulation; iris with a golden sheen, especially around the pupil, on each side of pupil, Salmon Color (Color #106). Measurements (in mm): Male holotype and paratypes; n = 8, range (mean, SE): SVL 10.6–12.8 (11.7, 0.28); HL 2.3–3.9 (3.0, 0.18); HW 2.4–3.7 (3.3, 0.15); HD 2.2–2.9 (2.45, 0.09); BW 3.6–6.6 (5.41, 0.39); TBL 6.4–8.4 (7.50, 0.23); ED 1.2–1.7 (1.45, 0.06); UE 0.0–1.2 (1.03, 0.03); IN 1.1–1.5 (1.31, 0.04); IO 2.2– 2.7 (2.53, 0.06); E-S 1.5–2.2 (1.83, 0.09); E-N 1.5–2.2 (1.83, 0.09); and A-G 4.2–5.3 (4.9, 0.16); Female paratypes; n = 2: SVL 17.9 and 18.8; HL 4.6 and 4.0; HW 4.8 and 5.4; HD 3.3 and 2.6; BW 9.2 and 10.0; TBL 11.4 and 12.2; ED 1.5 and 1.7; UE 1.1 and 1.2; IN 1.8 and 1.8; IO 3.6 and 3.2; E-S 2.8 and 2.9; E-N 1.7 and 1.6; and A-G 7.8 and 7.9. Variation: The sample reveals sexual size dimorphism in the new species, with the two females exceeding the eight males in size (U-test, p < 0.05). Within the sample, the dorsal pattern was obscured or lost, or show two fused hour-glasses pattern that nearly reach the anal region. Females show greater development of Finger 1, with one phalange clearly visible. The reduction of elements on Finger I in the diminutive males is possibly an effect of a smaller body size. In preservative (70% ethanol), the dorsum is smooth, tubercles being indistinct. Additionally, the saddle-shaped mark and pale snout are noticeably less distinct. Larvae: Larval voucher specimens: ZMH A10014–10020; ZMH A10044; ZMH A10048; ZMH A10177– 78; illustration based on ZMH A 10015, stage 36. External morphological features (Figs. 4Aa–b): Larvae reach a total length of 9–11.3 mm; tail length 70% and head-body length 30% of total length; body contour in dorsal view parallel sided, as broad at eye level as at mid-body level; body approximately as wide as deep; a slight constriction of body contour behind level of eye; snout short; eyes lateral in position and relatively large; no external narial opening in pre-metamorphic stages; spiracle lies ventrally in mid-sagittal plane, approximately in mid-belly region (Fig. 4Aa); spiracular orifice is a caudad directed opening with a straight but slightly irregular rim (ventral view); gut arranged in a short coil, often with only three bends in lateral



43

view; gut visible through the skin; lungs functional, serving as buoyancy organs, and shine through dorsal skin as silvery, dorsal trunk structures. Tail fins start at trunk-tail junction (Fig. 4Ab); ventral tail fin higher than dorsal tail fin; tail fin edges of upper and lower fin approximately parallel in orientation, except at distal quarter of tail, where they converge with convex outlines towards tip; shortly before tip, tail edges become convex, forming a short acuminate to flagellar tip; vent embedded and opening medially in lower tail fin. Due to the transparent appearance, lateral line neuromasts are not readily visible in living specimens. Oral orifice terminal on snout and directed forward; oral disk highly reduced: upper jaw with very shallow lip flap (bulge; Fig4Ac); flap on lower jaw much reduced but present and separated from a chin-like bulge below by a fold; two knob-like papillae form the corners of lower lip; between these papillae, the lower labium is highly reduced and has a undulating contour indicating three vestigial papillae; labial ridges and keratodonts absent; jaws without keratinized beaks. Larvae show scattered pigment cells, making them appear moderately dark color when viewed with the naked eye. Under magnification, flanks, dorsum, dorsal head, and sides of tail show scattered melanocytes. Epidermal melanocytes small and irregular, often stelliform in general shape, fringed with irregular cytoplasmatic processes. Dorsum and forehead with a slight greenish hue underlying scattered melanocytes; ventral and lower lateral sides of head, and lateral gill region unpigmented; yellowish gut coils visible through abominal wall in ventral and lateral views; iris dusted with dense bronze pigmentation on a black background; scleral part of eyeball covered with reflecting iridocytes, and depending on direction and intensity of light, iridocytes may appear silvery to golden; iridocytes also present along dorsal edge of muscular part of tail in mid-tail region; iridocyte and melanocyte densities on tail low and tail myosepta visible; tail fins clear. Metamorphs average 3.5 mm, and are near translucent under natural light, when viewed by the naked eye, and digital images reveal a pale pink dorsum. Color in preservation is different from that in life: silvery iridocytes are not visible in preservation and melanocytes bleach easily. Preserved tadpoles are thus mainly cream-colored, with translucent components (such as the tail fins and belly). The iris and sclera are black. Call. Males of the new species commence calling at dusk, choruses peaking during the early hours of the evening (ca. 1845–2100 h). Males form calling aggregations within and around patches of pitcher plants, Nepenthes ampullaria. A few minutes of intense group choruses may be followed by periods of silence, or with only occasional single males calling briefly. The call can be described as a series of harsh rasping notes. The structure of a call is depicted in Fig. 5. Parameters of the shown call are: in aroused males, the call consists of a rapid sequence of notes. A note consists of two short (1–2) and one larger (5–9) pulse groups (Fig. 5: A, B, C, respectively). The pause between pulse groups within a note was 125–154 ms; breaks between notes were 192–330 ms. Repetition frequency of notes (i.e., duration of pauses in a series) depends on the level of agitation in a calling congregation. Notes have a duration of 696–736 ms. Spectrum analysis of the notes in Fig. 5 show that frequencies in the range of 3,000–5,500 Hz contribute most to the measured sound pressure level.

FIGURE 5. Call structure of a Microhyla nepenthicola sp. nov. Notes are composed of two short (A and B) and one longer (C) pulse series.

44


DAS & HAAS

Etymology: Latin for inhabitant of Nepenthes, or pitcher plants (Fig. 6). Used as a noun in apposition. Comparisons: The preliminary phylogenetic analysis (Fig. 7A) shows that the sympatric Microhyla borneensis Parker 1928 shares a sister-relationship with M. nepenthicola sp. nov., but is clearly separated genetically by a divergence of 5.1% (syntopic ZRC 1.11939 [GU154887] and ZRC 1.12432 [GU154885]). Females of the new species are indeed rather similar morphologically to the more widespread M. borneensis (which is not reproductively syntopic at the type locality of the new species, breeding in large, permanent bodies of water, such as ponds). The latter species, however, is substantially larger, borneensis males reaching 18 mm (vs. 12.8 mm), females 23 mm (vs. 18.8 mm), and are further separated by the possession of a weak supratympanic fold (vs. absent); Finger I reduced, but projecting from margin of carpal margin (vs. reduced to a tubercle); tubercles forming a low ridge on flanks (vs. absent) and a light-edge to the dark pattern on dorsum (vs. absent). The larval stages of the two species are also substantially different, tadpoles of M. borneensis attaining 22.4 mm (as opposed to 11.3 mm in the new species), The new species from Kubah is compared here with all congeners, plus the sister lineage, Micryletta, considered by some authors to be synonymous with, or a subgenus of Microhyla (Frost 2009). The new species differs from Microhyla, maculifera Inger 1989, in showing a distinct outer metatarsal tubercle, dorsal grooves on toes, and first finger reduced to a tuberculate structure in males (vs. half length of Finger IV); from M. berdmorei (Blyth 1856), M. perparva Inger and Frogner 1979, and M. petrigena Inger and Frogner 1979, by reduced webbing on toes that fail to reach the disks on Toes III and V. Among the remaining species of the genus, the following lack the median longitudinal grooves on disks: Microhyla chakrapanii Pillai 1977; M. fissipes Boulenger 1884; M. fowleri Taylor 1934; M. mixtura Liu and Hu in Hu, Zhao, and Liu 1966; M. okinavensis Stejneger 1901; M. ornata (Duméril and Bibron 1841); M. palmipes Boulenger 1897; M. picta Schenkel 1901; M. pulchra (Hallowell 1861); M. superciliaris Parker 1928, and M. zeylanica Parker and Osman-Hill 1949. Broad webbing to disks of toes separate the following congeners from the new species: M. annamensis Smith 1923; M. marmorata Bain and Nguyen 2004; M. nanapollexa Bain and Nguyen 2004; and M. pulverata Bain and Nguyen 2004. Lack of webbing and of median grooves on toes separates Micryletta inornata (Boulenger 1890) and M. stejnegeri (Boulenger 1909), which are sometimes placed in the genus Microhyla). Distinct disks on fingers separate M. achatina Tschudi 1838; M. annectens Boulenger 1900; M. butleri Boulenger 1900; M. erythropoda Tarkhnishvili 1994; M. fusca Andersson 1942 (only on Finger III); M. heymonsi Vogt 1911; M. mantheyi Das, Yaakob and Sukumaran 2007; and M. sholigari Dutta and Ray 2000. Its shovel-shaped inner metatarsal tubercle separates M. rubra (Jerdon 1854) from the new species. Finally, M. karunaratnei Fernando and Siriwardhane 1996 differs from the new species in showing extensive dark patches on its venter, more extensive webbing on toes that reach antepenultimate and proximal subarticular tubercle of Toe IV; and outer metacarpal tubercle completely divided. Preliminary hypothesis of relationships: Results of preliminary phylogenetic assessment are summarized in Figs. 7A–7B. The two adult (ZRC 1.12441, GU154886]; ZRC 1.12432, GU154885) and one larval (ZMH A 10019, GU154881) 16S RNA gene DNA samples from the type locality form a clade. The new species is nested within a more inclusive clade comprising Microhyla borneensis and M. heymonsi as closest relatives among the known Bornean species, both in MP and BI analyses. The phylogenetic position is in accordance with the morphological evidence: the new species is most similar to Microhyla borneensis in body shape and colour pattern, albeit at significantly smaller maximum body size. The two samples of M. borneensis (ZRC 1.11939, GU154887; ZMH A 10027, GU154879) from the type locality of M. nepenthicola sp. nov. are monophyletic in the analysis and genetically distinct from the new species (5.1%). Interestingly, the 16S RNA gene sequence EF017951 obtained from GenBank and deposited as “Microhyla borneenis” appeared as sister-taxon to the newly described species. We contacted the collector and found out that EF017951 was from a population of very small individuals, not larger than 12 mm, from Bako National Park, ca. 25 km NE of Kubah National park. The size of the frog and the present analysis, however, suggest, that EF017951 belongs to the new species (differences with M. nepenthicola, ZMH A 10019 [GU154881], in the overlapping 495 bp). Distribution and ecological notes: The adults from the type series were collected at the verge of the road leading to the summit of Gunung Serapi, at ca. 300 m asl. The locality lies within a section of kerangas



45

(Bornean heath) forest, and the undergrowth has patchy by dense aggregations of the pitcher plant, Nepenthes ampullaria (Fig. 6). A total of at least 56 species of anuran amphibians and two caecilians occur in the Matang Range (Das et al. 2007; Haas, unpubl., Matsui 2009), including one congener (Microhyla borneensis).

FIGURE 6. Microhabitat of Microhyla nepenthicola sp. nov. showing patch of Nepenthes ampullaria used for breeding by the frog species.

Larvae of Microhyla nepenthicola sp. nov. are endotrophic. We collected pitchers with fresh eggs, deposited on the sides of the pitchers, and observed that larval metamorphosis is completed within about two weeks after oviposition. We found up to 14 larvae in a single pitcher, showing different developmental stages, and indicating multiple egg deposition in one pitcher. In histological sections, we found large amounts of yolk platelets in the gut tissue (Fig. 8) even in specimens with advanced limb development (Gosner 1960: Stages 28–36). The hyobranchial apparatus was reduced in all sectioned specimens (ZMH A10044; ZMH A10048; ZMH A10177–78). We collected the tadpoles from Nepenthes ampullaria pitchers next to calling males of the species. Adults and larvae were matched by DNA barcoding. Tadpoles hover in the pitcher’s liquid almost motionless; characteristically the body axis is oriented at an angle of ca. 30° with the head oriented up from level of body, and movement is facilitated by constant beating of tail tip. When disturbed, they are capable of rapid movement, trying to burrow into the debris accumulated at the bottom of pitchers. Due to their small size, pale coloration, behavioral crypsis via tendency for reduced activity, and large amount of debris (typically partially digested arthropod body parts) in the pitcher, tadpoles can be difficult to sight in situ. Phylotelm-breeding amphibians have been reviewed by Lehtinen et al. (2004). In breeding in pitcher plants (Nepenthes sp.), the new species is rather unusual, as only a few anurans have been recorded breeding in pitchers. Dover (1928), the first author to report breeding by anurans in Nepenthes ampullaria, identified the species as a bufonid, and possible Duttaphrynus melanostictus. Given the known size of larvae- a Stage 47 individual in the size range 7.9–9.3 mm (Leong and Chou 1999: Table 3; see also Ye et al. 1986), it is unlikely to be this species. Other anuran amphibian species known to breed or at least reside in pitchers include both free-swimming ones, such as Kalophrynus pleurostigma (fide Lim and Ng 1991: Nepenthes ampullaria),

46


DAS & HAAS

Kalophrynus cf. heterochirus (fide Phillipps et al. 2008: from Nepenthes stenophylla), and those showing direct development, including Philautus aurifasciatus (fide Yong et al. 1988: from Nepenthes sanguinea); unspecified species of Philautus (fide Kiew 1987: from Nepenthes ampullaria; also Clarke 1997: from Nepenthes bicalcarata; Phillipps et al. 2008: from Nepenthes hurrelliana); Philautus mjobergi (Smith 1925: from unspecified Nepenthes; Philipps and Lamb 1988: from Nepenthes villosa), Philautus kerangae (Dring 1987: from Nepenthes bicalcarata) and Philautus saueri (Malkmus et al. 2002: from Nepenthes villosa). One additional record- that of Microhyla borneensis (fide Parker 1934) is in doubt, given the known reproductive habits of this species mentioned above. We suspect Parker's (1934) material, which was taken from "Kuching" (presently ca. 30 km S of the type locality) by John Hewitt (1880–1961), a Curator of the Sarawak Museum, Kuching between 1905–1908, refer to the species being described as new herein. Hewitt apparently did no field work locally (see Das and Leh 2005), and the museum ledger records collections (SM catalogue numbers D.a.2.4.2.a–k) made by his predecessor, Robert Shelford (1872–1912), who collected 11 specimens of Microhyla, allocated to M. achatina (now considered an endemic of the Malay Peninsula), seven of which were from the Matang Range, and some of these are suspected to be the source of Parker's (1934) material. More recently, a North American frog, Pseudacris crucifer has been suggested to be an associate of the North American pitcher plants, Sarracenia purpurea (see Russell 2008).

FIGURE 7. A. Preliminary assessment of the phylogenetic relationships of Microhyla nepenthicola sp. nov., using 16S rRNA sequences. Strict consensus tree of six most parsimonious trees. Maximum parsimony analysis using PAUP 4.beta. Numbers at nodes represent Bremer support indices. Terminals in the tree represent the samples examined with GenBank accession numbers. B. Phylogenetic tree of South-east Asian species of Microhylidae resulting from Bayesian Inference Analysis. Branch lengths represent genetic distances. Support values from 1 million simulations are given at each node. All samples assigned to the new species are monophyletic with high support values. A sister-group relation of Microhyla borneensis with the new species is highly supported, together being sister-group to Microhyla heymonsi. The BI analysis suggests higher resolution than the more conservative MP analysis, however, some nodes, distant to the taxon in question, have low bootstrap values. Note that two distant samples, both labeled Microhyla ornata from Genbank did not group in the analysis.



47

FIGURE 8. Histological section of gut tissue in Microhyla nepenthicola sp. nov. (Stage 35; ZMH A10044), showing yolk platelets along with advanced stage of forelimb development.

Discussion: The tadpoles of Microhyla nepenthicola sp. nov. exhibit an endotrophic mode of development, presumably exploiting the relatively stable (in terms of year-round availability of liquid contained therein) microhabitat provided by pitchers of Nepenthes ampullaria. They display the typical generalized microhylid (Orton 1957: type II larvae) apomorphic features, such as non-perforated nostrils, terminal mouth, reduced oral disk, and midventral opening of the spiracle (Haas 2003). However, endotrophy has presumably lead to noticeable morphological changes in this species, including relatively small size at metamorphosis, reduction of gill filter apparatus in terms of size and complexity (microhylids typically have a extensive branchial apparatus), rapid development, and gut functioning as yolk storage. Miniaturization in amphibians is often accompanied by a suite of characters, including reduced ossification and reduction of digits (Inger and Frogner 1980; Alberch and Gale 1985). Within the genus Microhyla, there is a tendency for reduction or loss of Finger I, and a few species show three functional fingers (Inger and Frogner 1980). Miniaturization in this species and the reduced webbing on its pes may be the result of the need to navigate on the slippery (waxy) zone of pitchers of Nepenthes, situated below the peristome. The function of the waxy zone has been shown to be critical for trapping arthropods by these plants (Gorb et al. 2005). Nepenthes ampullaria is somewhat unusual amongst other Nepenthes in having mostly lower pitchers, a diet comprising primarily of detritus and consequently, are found growing under canopy (Clark and Lee 2004). Other challenges in dramatic reduction in body size reported in poikilothermous tetrapods include increased rate of water loss, given their greater surface-to-volume ratios, compensated by their selection of the most humid microhabitats (Hedges and Thomas 2001). The new Microhyla from Kubah is inactive during dry nights, and reproduction and other activities take place in the immediate vicinity of Nepenthes ampullaria, which is one of the smallest species within the genus, with pitchers up to 10 cm high and 7 cm wide (Clarke 1997).

48


DAS & HAAS

Acknowledgements We thank our respective institutions, the Institute of Biodiversity and Environmental Conservation, Universiti Malaysia Sarawak, and University of Hamburg, for supporting our research. Permission and facilities to conduct field work in Kubah was provided by the Sarawak Forest Department, in particular Datuk Cheong Ek Choon (collecting permits (NPW.907.4.2–26, NPW.907.4.2–43; NPW.907.4–35; NPW.907.4–36; NPW.907.4.2–8 and NPW.907.4.2(II)–73) and export permits (04635, 07094–97 and 07484), and to Lim Chan Koon and Oswald Braken Tissen for advice. At Kubah, we are grateful to M. Rajuli and S. binti Sulaiman for logistic support. The Economic Planning Unit (EPU), The Prime Minister’s Department, Malaysia issued EPU Research Permit No. 1168 to A. Haas. We gratefully acknowledge the help and advice of Bernhard Misof and Thorsten Burmester in the phylogenetic parts of this work. R. M. Brown provided information on primers. Field work was aided by students, colleagues and family members, including: A. Jankowski, J. Sukumaran, L. Sir, S. J. Tingsom and C. Michael. We are grateful to M. Hänel who prepared the ink drawing. For permission to examine comparative material/specimen loans, we thank Lim Boo Liat (DWNP); Robert F. Inger and Harold K. Voris (FMNH); L. Lee Grismer (LSUHC); P. Arntzen (RMNH); E. Yen (SBC); D. S. Edwards, H. Pang and J. K. Charles (UBD); P. K. L. Ng and K. K. P. Lim (USDZ/ZRC), Kelum Manamendra-Arachchi and Rohan Pethiyagoda (WHT) and G. Ramakrishna and K. Deuti (ZSI). The basemap for Figure 1 was generated by Jeet Sukumaran. This research was supported by the Volkswagen Foundation, Germany, Grant I/79 405.

References Alberch, P. & Gale, E.A. (1985) A developmental analysis of an evolutionary trend: digital reduction in amphibians. Evolution, 39, 8–23. Bain, R. & Truong, N.Q. (2004) Three new species of narrow-mouth frogs (genus: Microhyla) from Indochina, with comments on Microhyla annamensis and Microhyla palmipes. Copeia 2004, 507–524. Berry, P.Y. (1975) The Amphibian Fauna of Peninsular Malaysia. Tropical Press, Kuala Lumpur, x + 130 pp. Biju, S.D., Van Bocxlaer, I., Giri, V.B., Roelants, K., Nagaraju, J. & Bossuyt, F. (2007) A new nightfrog, Nyctibatrachus minimus sp. nov. (Anura: Nyctibatrachidae): the smallest frog from India. Current Science, 93, 854–858. Clarke, C. (1997) Nepenthes of Borneo. Natural History Publications (Borneo) Sdn. Bhd. and Science and Technology Unit, Kota Kinabalu, xii + 207 pp. Clarke, C. & Lee, C. (2004) A Pocket Guide. Pitcher Plants of Borneo. Natural History Publications (Borneo) Sdn. Bhd. and Science and Technology Unit, Kota Kinabalu, vi + 81 pp. Das, I., Jankowski, A., Makmor, M.I. & Haas, A. (2007) Species diversity, elevational distribution and reproductive modes in an amphibian community at the Matang Range, Sarawak (Borneo). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 104, 1–34. Das, I. & Leh, C. (2005) A legacy of Wallace: Sarawak Museum and the history of herpetological research in Sarawak. In: A. A. Tuen & Das, I. (Eds). Wallace in Sarawak– 150 Years Later: Proceedings of an International Conference on Biogeography and Biodiversity. Institute of Biodiversity and Environmental Conservation, Universiti Malaysia Sarawak, Kota Samarahan. pp: 57–65. Das, I., Yaakob, N. & Sukumaran, J. (2007) A new species of Microhyla (Anura: Microhylidae) from the Malay Peninsula. Hamadryad, 32, 304–314. Dover, C. (1928) Part III.– Batrachia. In: Notes on the fauna of pitcher-plants from Singapore Island. Journal of the Malayan Branch of the Royal Asiatic Society, 6, 13. Dring, J.C. (1987) Bornean treefrogs of the genus Philautus (Rhacophoridae). Amphibia-Reptilia, 8, 19–47. Duellman, W.E. & Hedges, S.B. (2008) Two new minute species of Phrynopus (Lissamphibia: Anura) from the Cordillera Oriental in Peru. Zootaxa, 1675, 59–66. Dutta, S.K. & Ray, P. (2000) Microhyla sholigari, a new species of microhylid frog (Anura: Microhylidae) from Karnataka, India. Hamadryad, 25, 38–44. Eriksson, T. (2003) AutoDecay. Available from: http://www.bergianska.se/index_forskning_soft.html Estrada, A.R. & Hedges, S.B. (1996) At the lower size limit in tetrapods: a new diminutive frog from Cuba (Leptodactylidae: Eleutherodactylus). Copeia, 1996, 852–859. Evans, B.J., Brown, R.M., McGuire, J.A., Supriatna, J., Andayani, N., Diesmos, A., Iskandar, D., Melnick, D.J. & Cannatella, D.C. (2003) Phylogenetics of fanged frogs: testing biogeographical hypotheses at the interface of the



49

Asian and Australian faunal zones. Systematic Biology, 52, 794–819. Fernando, P. & Siriwardhane, M. (1996) Microhyla karunaratnei (Anura: Microhylidae), a new species of frog endemic to Sri Lanka. Journal of South Asian Natural History, 2, 135–142. Frost, D.R. (1985) Amphibian Species of the World. A Taxonomic and Geographic Reference. Allen Press and Association of Systematics Collection, Lawrence, Kansas, 732 pp. Frost, D.R. (2009) Amphibian Species of the World 5.3, An Online Reference. Available from http://research.amnh.org/ vz/herpetology/amphibia/index.php). American Museum of Natural History, New York. (Accessed 21 October 2009) Frost, D.R., Grant, T., Faivovich, J.N., Bain, R.H., Haas, A., Haddad, C.F.B., De Sá, R.O., Channing, A., Wilkinson, M., Donnellan, S.C., Raxworthy, C.J., Campbell, J.A., Blotto, B.L., Moler, P., Drewes, R.C., Nussbaum, R.A., Lynch, J.D., Green, D.M. & Wheeler, W.C. (2006) Amphibian tree of life. Bulletin of the American Museum of Natural History, 297, 1–370. Gorb, E., Haas, K., Henrich, A., Enders, S., Barbakadse, N. & Gorb, S. (2005) Composite structure of the crystalline epicuticular wax layer of the slippery zone in the pitchers of the carnivorous plant Nepenthes alata and its effect on insect attachment. Journal of Experimental Biology, 208, 451–462. Gosner, K.L. (1960) A simplified table for staging anuran embryos and larvae, with notes on identification. Herpetologica, 16, 183–190. Haas, A. (2003) The phylogeny of frogs as inferred from primarily larval characters (Amphibia: Anura). Cladistics, 19, 23–89. Hedges, S.B. & Thomas, R. (2001) At the lower size limit in amniote vertebrates: a new diminutive lizard from the West Indies. Caribbean Journal of Science, 37, 168–173. Hillis, D.M., Moritz, C. & Mable, B.K. (1996) Molecular Systematics. Second Edition. Sinauer Associates, Sunderland, MA, 655 pp. Huson, D.H., Richter, D.C., Rausch, C., Dezulian, T., Franz, M. & Rupp, R. (2007) Dendroscope: An interactive viewer for large phylogenetic trees. BMC Bioinformatics, 2007, 8, 460. Huelsenbeck, J.P. & Ronquist, F.R. (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754–755. Inger, R.F. (1966) The systematics and zoogeography of the Amphibia of Borneo. Fieldiana Zoology, 52, 1–402. Reprinted 1990, Lun Hing Trading Company, Kota Kinabalu. Inger, R.F. (1989) Four new species of frogs from Borneo. Malayan Nature Journal, 42, 229–243. Inger, R.J. & Frogner, K.J. (1980) New species of narrow-mouth frogs (genus Microhyla) from Borneo. Sarawak Museum Journal, 27, 311–324. Inger, R.F. & Stuebing, R.B. (1997) A Field Guide to the Frogs of Borneo. Natural History Publications (Borneo) Sdn Bhd/Science and Technology Unit, Sabah, Kota Kinabalu, x + 205 pp. Bahasa Malaysia edition 1999, Panduan lapangan katak-katak Borneo. Natural History Publications (Borneo) Sdn Bhd/Jabatan Muzium Sabah, Kota Kinabalu, x + 225 pp. Iskandar, D.T. & Colijn, E. (2000) Preliminary checklist of southeast Asian and New Guinean herpetofauna. I. Amphibians. Treubia, 31(3)(Supplement), 1–133. Katoh, K., Misawa, K., Kuma, K. & Miyata, T. (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research, 30, 3059–3066. Kiew, B.-H. (1987) An annotated checklist of the herpetofauna of Ulu Endau, Johore, Malaysia. In: Malaysian Heritage & Scientific Expedition: Endau-Rompin. Malayan Nature Journal, 41, 413–423. Lehr, E. & Catenazzi, A. (2009) A new species of minute Noblella (Anura: Strabomantidae) from southern Peru: the smallest frog of the Andes. Copeia, 2009, 148–156. Lehtinen, R.M., Lanonoo, M.J. & Wassersug, R.J. (2004) Phytotelm-breeding anurans: past, present and future research. In: Lehtinen, R.M. (Ed). Ecology and Evolution of Phytotelm-breeding Anurans. Miscellaneous Publications, Museum of Zoology, University of Michigan 193, 1–9. Leong, T.M. & Chou, L.M. (1999) Larval diversity and development in the Singapore Anura (Amphibia). The Raffles Bulletin of Zoology, 47, 81–137. Leviton, A.E., Anderson, S.C., Gibbs, R.H., Heal, E. & Dawson, C.E. (1985) Standards in herpetology and ichthyology. Part I. Standard symbolic codes for institutional resource collections in herpetology and ichthyology. Copeia, 1985, 802–832. Lim, K.K.P. & Ng, P.K.L. (1991) Nepenthiphilous larvae and breeding habits of the sticky frog, Kalophrynus pleurostigma Tschudi (Amphibia: Microhylidae). Raffles Bulletin of Zoology, 39, 209–214. Malkmus, R., Manthey, U., Vogel, G., Hoffmann, P. & Kosuch, J. (2002) Amphibians & Reptiles of Mount Kinabalu (North Borneo). Koeltz Scientific Books, Königstein, 424 pp. Manthey, U. & Grossmann, W. (1997) Amphibien & Reptilien Südostasiens. Natur und Tier Verlag, Münster, 512 pp. Matsui, M. (2009) A new species of Philautus (Amphibia, Anura, Rhacophoridae) from the lowland of Sarawak, western Borneo. Zoological Science, 26, 437–442.

50


DAS & HAAS

Matsui, M., Ito, H., Shimada, T., Ota, H., Saidapur, S.K., Khonsue, W., Tanaka-Ueno, T. & Wu, G.-F. (2005) Taxonomic relationships within the Pan-Oriental narrow-mouth toad, Microhyla ornata as revealed by mtDNA analysis (Amphibia, Anura, Microhylidae). Zoological Science, 22, 489–495. Misof, B. & Misof, K. (2009) A Monte Carlo approach successfully identifies randomness of multiple sequence: a more objective approach of data exclusion. Systematic Biology, 58, 21–34. Nieden, F. (1923) Anura I. Subordo Aglossa und Phaneroglossa, Sectio I Arcifera. Das Tierreich, 46, i–xxxii + 1–584. Orton, G.L. (1957) The bearing of larval evolution on some problems in frog classification. Systematic Zoology, 6, 79– 86. Parker, H.W. (1926) The brevicipitid frogs of the genus Microhyla. Annals & Magazine of Natural History, Series 10, 2, 473–499. Parker, H.W. (1934) A Monograph of the Frogs of the Family Microhylidae. British Museum (Natural History), London, (1) + viii + 208 pp. Reprinted 1966, Johnson, New York. Phillipps, A. & Lamb, A. (1988) Pitcher plants of East Malaysia and Brunei. Nature Malaysiana, 13(4), 8–27. Phillipps, A., Lamb, A. & Lee, C.C. (2008) Pitcher Plants of Borneo. Second Edition. Natural History Publications (Borneo), Kota Kinabalu/Royal Botanic Gardens, Kew, viii + 298 pp. Pillai, R.S. (1977) On two frogs of the family Microhylidae from Andamans including a new species. Proceedings of the Indian Academy of Sciences, 86B, 135–138. Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics, 14, 817–818. Ronquist, F. & Huelsenbeck, J.P. (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. Russell, R.W. (2008) Spring peepers and pitcher plants: a case of commensalism? Herpetological Review, 39(2), 154– 155. Smith, M.A. (1925) On a collection of reptiles and amphibians from Mt. Murud, Borneo. Journal of the Sarawak Museum, 3, 5–14. Smithe, F.B. (1975) Naturalist’s Color Guide. Parts I and II. American Museum of Natural History, New York, Part I: 8 pp + 18 colour swatches; Part II: xiii + 229 pp. Smithe, F.B. (1981) Naturalist’s Color Guide. Part III. American Museum of Natural History, New York, (iv) + 37 pp. Stocsits, R.R., Letsch, H., Hertel, J., Misof, B. & Stadler, P.F. (2009) Accurate and efficient reconstruction of deep phylogenies from structured RNAs. Nucleic Acids Research, 37, 6184–6193. Swofford, D.L. (2002) PAUP*4 beta. Phylogenetic Analysis Using Parsimony (and Other Methods). Software package. Sinauer Associates, Inc. Publishers, Sunderland, Massachusetts. Taylor, E.H. (1962) The amphibian fauna of Thailand. University of Kansas Science Bulletin, 63(8), 265–599; errata (= 1 p). van Kampen, P.N. (1923) The Amphibia of the Indo-Australian Archipelago. E. J. Brill, Leiden, xii + 304 pp. Vences, M. & Glaw, F. (1991) Revision der Gattung Stumpffia Boettger 1881 aus Madagaskar mit Beschreibung von zwei neuen Arten (Amphibia, Anura, Microhylidae). Acta Biologica Benrodis, 3, 203–219. Vences, M., Thomas, M., Bonett, R. & Vieites, D.R. (2005) Deciphering amphibian diversity through DNA barcoding: chances and challenges. Philosophical Transactions of the Royal Society B: Biological Sciences, 360, 1859–1868. Wu, L., Diong, G. & Xu, R.-H. (1987) [Amphibian Fauna of Guizhou.] Guizhou Peoples Press, Guiyang, (7) + 4 + 192 pp, Pls. 46, folding map 1 [in Chinese.] Yang, D.-T. (Ed.). (1991) [Amphibian Fauna of Yunnan.] China Forestry Publ. House, Beijing, (1) + (1) + (3) + iv + 259 pp. [in Chinese; authors: S.-M. Li, W.-Z. Liu, S.-Q. Lü, B.-L. Wu & D.-T. Yang.] Ye, R.-Q., Fei, L. & Hu, S.-Q. (1986) Early stages of the embryonic development in Bufo melanostictus. Acta Herpetologica Sinica, new series 5(3), 185–188; 2 plates (in Chinese.) Yong, H.-S., Ng, C.K. & Ismail, R. (1988) Conquest of the land: direct development in a Malaysian Philautus tree frog. Nature Malaysiana, 13(4), 4–7.



51

Appendix I. Comparative material examined. Microhyla achatina. RMNH 1728 (syntype). Indonesia: Java; ZSI 18376–80. Indonesia: Java: Tjibodas. Microhyla annectans. ZRC 1.127–28. Malaysia: Pahang: Cameron Highlands. Microhyla berdmorei. ZRC 1.9940–41; 1.9918; 1.9947–61. Vietnam: Nam Cat Tien National Park; ZRC 1.9075, 1.9078. Malaysia: Sarawak: Bario; ZSI 17994, Bangladesh: Chittagong Hill Tracts, Rangamati. Microhyla borneensis. SBC 00283. Malaysia: Sarawak: Gunung Poing, Bau; UBD 171; 317; 365; 575; 614; ZRC 1.3164. Brunei Darussalam: Temburong: Batu Apoi Forest Reserve; ID 8196–1897, 8250, 8508, Malaysia: Sarawak: Kubah National Park; ID 8196–97 (tadpole), ZRC 1.11321. Indonesia: Kalimantan. Microhyla butleri. ZSI 19324. Myanmar: North Shan State: He-Ho Plain. Microhyla chakrapanii. ZSI Chennai SRS VA/770. India: Andaman Islands, Mayabundar (holotype). Microhyla heymonsi. ZSI A.9138. India: Great Nicobar, Kopen Heat. Microhyla karunaratnei. WHT 1174 (2 specimens). Sri Lanka: Rakwana, Morningside. Microhyla maculifera. FMNH 231272. Malaysia: Sabah: Danum Valley Research Centre (paratype). Microhyla mantheyi. ZRC 1.10988 (holotype), Malaysia: Johor: road between Jemaluang and Kahang (02°16N; 103°52– 36'E); also paratypes as follows: DWNP A.0993, DWNP A.1019, and DWNP A.1028, Malaysia: Taman Negara: Pahang: Sungai Relau (04°40'N; 102°05'E); DWNP A.1033, Malaysia: Selangor: Kepong: Engkabang Trail, Forest Research Institute Malaysia (03°14'N; 101°38'E), FRIM 0033, Malaysia: Selangor: Kepong: Engkabang Trail, Forest Research Institute Malaysia, FRIM 0166, Malaysia: Selangor: Kepong: Salleh Trail, Forest Research Institute Malaysia, FRIM 0171, Malaysia: Selangor: Kepong: Engkabang Trail, Forest Research Institute Malaysia, FRIM 0569, Malaysia: Negri Sembilan: Pasoh Forest Reserve (02°59'N; 102°18'E), ZRC 1.11913, Malaysia: Selangor: Kepong: Engkabang Trail, Forest Research Institute Malaysia, LSUHC 06549, Malaysia: Selangor: Kepong: Forest Research Institute Malaysia, LSUHC 06555, Malaysia: Selangor: Kepong: Forest Research Institute Malaysia, ZRC 1.3451, Singapore: Rifle Range Road (01°21'N; 47°02'E), ZRC 1.3865, Malaysia: Selangor: Sungai Dusun (03°39'N; 101°00'E), ZRC 1.8037, Malaysia: Johor: foot of Gunung Panti, along Bunker Trail (01°51'N; 103°23'E), ZRC 1.10161, Malaysia: Pahang: Taman Negara: Sungai Tahan at Lata Berkoh (04°26'N; 102°23'E), ZRC 1.10224, Singapore: Sime Road forest (01°20'N; 103°57'E), ZRC 1.10249, Malaysia: Johor: foot of Gunung Panti, along Bunker Trail, ZRC 1.10256, Singapore: Nee Soon swamp forest (01°24'N; 103°49'E), ZRC 1.10331–33, Malaysia: Johor: foot of Gunung Panti, along Bunker Trail, ZRC 1.10511, Singapore, Bukit Timah Nature Reserve, Taban Valley (01°20'N; 103°46'E), ZRC 1.10799, Malaysia: Kedah: Ulu Muda Forest Reserve (06°05'N; 101°00'E), ZRC 1.10987, Malaysia: Johor: road between Jemaluang and Kahang, ZRC 1.10989, Malaysia: Johor: road between Jemaluang and Kahang. Microhyla ornata. ZSI A.5389. India: Madhya Pradesh, Bastar District; WHT 1207. Sri Lanka: Sigiriya. Microhyla palmipes. FRIM 1236. Malaysia: Selangor, Kepong, Forest Research Institute Malaysia, Engkabang Trail. Microhyla perparva. FMNH 130903. Malaysia: Sabah: Togopi River (paratype); FMNH 136343, 137957. Malaysia: Sarawak: Mengiong River (paratype); FMNH 147408, 147928, 150605. Malaysia: Sarawak: Sungei Seran (paratypes). Microhyla petrigena. FMNH 77224. Malaysia: Sarawak: Sungei Putai (paratype); FMNH 136340, 146259 195347, 203499, 207702. Malaysia: Sarawak: Sungei Mengiong (paratypes); ZRC 1.11281. Indonesia: Kalimantan, Mahakkam; UBD/CR 32, Brunei Darussalam: Temburong: Batu Apoi Forest Reserve; ID 8170, Malaysia: Sarawak, Gunung Mulu National Park: halfway along trail to Camp 1 (tadpoles), ZRC 1.3780–3826. Indonesia: Kalimantan: Sungai Panan. Microhyla rubra. ZSI A.9055. India: Goa, Valpoi. Microhyla sholigari. ZSI Kolkata A.9061. India: Karnataka (holotype); ZSI A.9062–65, India: Karnataka (four paratypes). Microhyla zeylanica. WHT 1198 (four specimens). Sri Lanka: Nuwara Eliya, near Hakgala.

52


DAS & HAAS