Cell Biol. Int. (2012) 36, 779–783 (Printed in Great Britain)
Methodology
A column-based rapid method for the simultaneous isolation of DNA, RNA, miRNA and proteins Sandeep K. Rajput*, Vivek P. Dave*,{, Ankita Rajput{, Hausila P. Pandey*, Tirtha K. Datta{ and Rakesh K. Singh1* * Department of Biochemistry, Banaras Hindu University, Varanasi, India { {
Amity University, Noida, Uttar Pradesh, India Animal Genomics Lab, ABTC, NDRI, Karnal 132001, India
Abstract In the 21st century, systems biology is a holistic approach to understand life by the cross-talk study between the genome, Rnome and proteome of a cell. We describe a column-based rapid method for the simultaneous extraction of DNA, RNA, miRNA (microRNA) and proteins from the same experimental sample without prior fractionation, which allows a direct correlation between genomic, epigenomic, transcriptomic and proteomic data. This method provides a simple and effective way to analyse each of these biomolecules without affecting yield and quality. We also show that isolated biomolecules are of the highest purity and compatible for all the respective downstream applications, such as PCR amplification, RT–PCR (reverse transcription–PCR), real-time PCR, reverse Northern blotting, SDS/PAGE and Western blot analysis. The buffers and reagents used in this method are optimized extensively to achieve the cost effective and reliable procedure to separate the functional biomolecules of the cell. Keywords: guanidine thiocynate; miRNA; nucleic acid isolation; protein; real-time PCR; reverse Northern blotting
1. Introduction To understand the molecular mechanism involved in the changes from the physiological to pathophysiological state of cells and tissues, studies of cross-talk between the genome, Rnome, proteome and microRnome have increasingly become important (Chong and Ray, 2002; Reif et al., 2004; Cox et al., 2005). Traditionally, samples are fractionated prior to purification of each of these biomolecules and processed independently, which requires large amounts of sample, and may also lead to inconsistent results due to different source of analytes. In many instances, samples such as biopsies, tissue samples, or samples from cell cultures could be small in size, precious, or difficult to obtain, making pre-isolation fractionation impractical. Therefore an increasing interest is being taken in technology that can allow a simple and rapid isolation and purification of RNA, miRNA (microRNA), genomic DNA and proteins from the identical sample with a high throughput yield, purity, reproducibility and scalability of the biomolecules. The speed, accuracy and reliability of such procedure should be maximal, while the risk of cross-contamination should be minimal. Currently, several proprietary solutions and kit-based commercial methods are available to isolate DNA, RNA, miRNA and protein, which are expensive. Articles describing such procedures are rare, perhaps reflecting the need of commercial companies to protect the confidentiality of the solutions and buffers composition used in the protocol (Tolosa et al., 2007; Takahiro et al., 2011). We describe a procedure to isolate high-quality DNA, RNA, miRNA and protein from the identical sample with detail description of optimized buffer composition. The isolated biomolecules were
also validated to use for further sensitive downstream applications such as PCR, RT–PCR (reverse transcriptase–PCR), qRT–PCR (quantitative qRT–PCR), reverse Northern blotting, SDS/PAGE and Western blotting. The current procedure was developed by utilizing specific physical and chemical properties of individual target molecule. DNA and RNA were separated based on the different binding capacity to the silica column in the presence of guanidine thiocynate at pH 8.0 and 6.0 respectively (Nanassy et al., 2007; Takahiro et al., 2011). We also exploited the property of ethanol to separate RNA and miRNA at varying concentration in the presence of chaotropic salts (Lodes et al., 2009). Thus, we have developed a convenient guanidine thiocynate-based method using a silica column to separate DNA, RNA and miRNA, whereas the protein was isolated by the conventional phenol:chloroform method (Chomczynski and Sacchi, 1987). The buffers and reagents used in this method were optimized extensively to achieve a cost effective and reliable procedure. This method can be easily employed by any laboratory to save time, energy and expenditure involved in purchasing proprietary kits and solutions from commercial sources.
2. Materials and methods An outline of the protocol is given in Figure 1. All the buffers were prepared in 0.1% DEPC (diethyl pyrocarbonate) treated water and stored at room temperature. All the chemicals were procured from Sigma–Aldrich unless otherwise stated.
1
To whom correspondence should be addressed (email
[email protected]). Abbreviations: DIG, digoxigenin; DWB, DNA wash buffer; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GuSCN, guanidine thiocyanate; miRNA, microRNA; RCF, relative centrifugal force; RT–PCR, reverse transcriptase–PCR; qRT–PCR, quantitative RT–PCR; RWB, RNA wash buffer; snRNA, small nuclear RNA.
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
Volume 36 (9) N pages 779–783 N doi:10.1042/CBI20110342 N www.cellbiolint.org
779
DNA, RNA, miRNA and protein isolation method
DWB-I, followed by 750 ml of DWB-II at 9200 RCF for 30 s. Flow through was discarded and the column was placed in the same collection tube. An additional centrifugation at 9200 RCF for 2 min was used to remove all traces of ethanol. Finally, the spin column was placed in a fresh 1.5 ml centrifuge tube and 50–100 ml of warm (50uC) nuclease-free water was added directly to the silica membrane. After 2 min of incubation at room temperature, the column was centrifuged at 9200 RCF for 30 s to elute the DNA. The eluted DNA was further examined by agarose gel electrophoresis and PCR amplification to determine the quality and quantity of DNA.
2.4 RNA isolation from flow through-I
Figure 1
Protocol outline for the column-based isolation of DNA, RNA, miRNA and protein
2.1 Buffer solutions 1. Lysis buffer: 4 M guanidine thiocynate, 100 mM Tris/HCl (pH 7.4), 30 mM EDTA (pH 8.0) and 1% Triton X-100. 2. RWB-I (RNA wash buffer-I): 3 M guanidine thiocynate, 50 mM Tris/HCl (pH 6.0) and 50% ethanol. 3. RWB-II: 50 mM Tris/HCl (pH 7.4) and 80% ethanol. 4. DWB-I (DNA wash buffer-I): 3 M guanidine thiocynate, 50 mM Tris/HCl (pH 7.4) and 10 mM EDTA (pH 8.0). 5. DWB-II: 50 mM Tris/HCl (pH 7.4), 20 mM NaCl, 5 mM EDTA (pH 8.0) and 70% ethanol. 6. Elution buffer: 10 mM Tris/HCl (pH 7.4) and nuclease-free water. These buffers can be stored at room temperature.
2.2 Sample preparation Between 500 and 105 animal cells (HeLa) were collected in 1.5 ml centrifuge tube by removing the culture at 2000 RCF (relative centrifugal force) for 3 min. Lysis buffer (500 ml) was added to the cell pellet and gently mixed by either vortexing or gentle pipetting for 30 s. The resultant lysate was centrifuged at 4500 RCF for 5 min to remove completely the cell debris before the supernatant was transferred to a fresh nuclease-free 1.5 ml centrifuge tube.
2.3 DNA isolation The supernatant was loaded on to a silica spin column (MachereyNagel GmbH & Co. KG) placed in a 2 ml collection tube and centrifuged at 6000 RCF for 1 min. ‘Flow through-I’ was collected and processed for RNA, miRNA and protein isolation. The column was transferred to a fresh 2 ml tube and washed with 650 ml of
780 www.cellbiolint.org N Volume 36 (9) N pages 779–783
An equal volume of water saturated phenol:chloroform mixture (5:1) was added to flow through-I, mixed vigorously for 30–60 s and centrifuged at 13200 RCF for 15 min at 4uC. The upper aqueous phase was transferred to a fresh 1.5 ml centrifuge tube to isolate RNA and miRNA, whereas remaining solution (interphase and organic phase) was stored at 4uC until protein extraction. The collected aqueous phase was thoroughly mixed with 0.6 volumes (300 ml) absolute ethanol and loaded on to the silica column placed in a 2 ml collection tube. After centrifugation at 9200 RCF for 30 s, ‘Flow through-II’ was collected and saved for miRNA isolation. The spin column was washed with 600 ml of RWB-I, followed by 750 ml of RWB-II at 9200 RCF for 30 s. RNA was eluted with 50 ml of nuclease-free water as described above for the DNA, and was further analysed by agarose gel electrophoresis, RT–PCR, qRT–PCR and reverse Northern blotting.
2.5 miRNA isolation from flow through-II A total 2/3 (,534 ml) volume of 100% ethanol was added in flow through-II by pipetting, and this was loaded on to a fresh silica column placed in 2 ml collection tube. The column was centrifuged at 9200 RCF for 30 s at room temperature. The flow through was discarded and the spin column washed with 600 ml of RWB-I prior to 750 ml of RWB-II at 9200 RCF for 30 s. Elution of miRNA was carried out with 50 ml of nuclease-free water using the same conditions as described above for DNA and RNA. Recovery of miRNA was estimated by agarose gel electrophoresis and quantification of expression level of U6 snRNA (small nuclear RNA) in eluted sample, using SYBR green-based qRT–PCR assay.
2.6 Protein isolation from the organic and interphase Total protein was isolated from the organic and interphase saved during RNA isolation by following the method described by Chomczynski and Sacchi (1987). Briefly, 3 volumes of acetone was added and mixed for 10 s. After 10 min of incubation at room temperature, proteins were precipitated by centrifugation at 13200 RCF for 10 min at 4uC. The obtained protein pellet was washed three times (15 min incubation for each wash) in 0.5 ml of 0.3 M guanidine hydrochloride (prepared in 95% ethanol), centrifuged at 600 RCF for 5 min and final wash was performed with 1 ml of ethanol containing 2.5% glycerol (v/v). After 15 min incubation, protein was sedimented at 600 RCF for 5 min and the
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
Cell Biol. Int. (2012) 36, 779–783
Figure 2
Representative picture of isolated (A) DNA, (B) RNA, (C) miRNA and (D) proteins from 105 HeLa cells M is the molecular mass marker and lanes 1 and 2 are from experiments performed in duplicate.
pellet was dried for 7–10 min at room temperature. The pellet obtained after briefly air-drying was resuspended in 200 ml 1% SDS by gentle pipetting for 15–20 min and stored at 220uC until Western blotting was performed.
3. Results 3.1 DNA isolation The concentration and purity of the isolated genomic DNA were measured using a nano-drop spectrophotometer. The purity was determined by calculating the ratio of A260/A28051.86 indicated the absence of protein contamination and the ratio of A260/ A23052.03 indicated the absence of other organic compounds. To check the quality of DNA and contamination of RNA, isolated DNA was run on a 0.8% agarose gel (Figure 2A). Further validation of the isolated DNA was done by GAPDH (glyceraldehyde-3phosphate dehydrogenase) gene amplification. The forward and reverse primers were designed against exons 8 and 9 respectively with 476 amplicon size (including 104 bp intron) (Figure 3A). The sequence for GAPDH forward primer was GTCAGTGGTGGACCTGACCT; and that for the reverse primer was GACTGAGTGTGGCAGGGACT.
synthesis kit (Fermentas) as per the manufacturer instructions. The GAPDH amplification was carried out using the same primer set as used for gDNA (genomic DNA) amplification. The agarose gel electrophoresis showed a 372 bp product size as expected with cDNA (Figure 3A). To confirm the efficiency of cDNA amplification, real-time PCR was performed using serially diluted cDNA (1–1025) with the same set of GAPDH primers (Figure 3C).
3.3 miRNA isolation The quantity and quality of isolated miRNAs were verified by running 5 ml sample volume on 2% agarose gel electrophoresis (Figure 2C). Further validation of the isolated miRNA was done by the PCR-based expression study of U6 snRNA using the technique developed by Kaul et al. (2006) (Figure 3D).
3.4 Protein isolation Isolated proteins were resolved on SDS/12% PAGE gels, followed by Coomassie Blue staining for visual examination (Figure 2D). Further validation of protein was done by Western immunoblotting against b-actin (Figure 3E).
4. Discussion
3.2 RNA isolation The concentration and purity of the isolated RNA were measured using a nano-drop spectrophotometer. The purity was determined by calculating the ratio of A260/A28051.90, which indicated the absence of protein contamination and the ratio of A260/A23052.01, which indicated the absence of other organic compounds. To check the quality of RNA and contamination of DNA, isolated RNA was analysed on a 0.8% agarose gel (Figure 2B). Further validation of isolated RNA was done by reverse Northern blotting against GAPDH gene using non-radioactive DIG (digoxigenin) labelling and detection kit (Roche) as per the manufacturer’s protocol (Figure 3B). To check the integrity of RNA first strand cDNA synthesis was also performed using Revert AidTM first strand
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
Although there is a burgeoning field of systems biology, studies of gene expression at the level of transcription and translation by quantification of RNA and protein combined with verifications of genomic sequence are often hampered by the small sample size and the necessity of different, often incompatible, techniques for DNA, RNA, miRNA and protein_isolation. Further, samples may comprise precious cultured cells, biopsies and tumour tissues that cannot be fractionated prior to purification of each of these molecules. Therefore, here we provide the method for sequential isolation of DNA, RNA, miRNA and protein, from the same stock of cultured cells_using optimized buffers based on the existing facts available in the literature. Silica column-based DNA isolation from the cultured animal cells was our first objective; therefore a lysis
Volume 36 (9) N pages 779–783 N www.cellbiolint.org
781
DNA, RNA, miRNA and protein isolation method
Figure 3
Quantitative analysis of isolated biomolecules using their respective downstream applications (A) Representative ethidium bromide stained 2% agarose gel showing the PCR amplicons of GAPDH, where M is the molecular mass marker, lane 1 is the GAPDH amplicons from DNA template, and lane 2 is the GAPDH amplicons from cDNA template. (B) Representative reverse Northern blot analysis of serially diluted (10 ng to 0.1 pg) GAPDH PCR products, hybridized with the DIG-labelled probe synthesized from the RNA isolated using current protocol. (C) Representative real-time amplification plot of GAPDH from the serially diluted cDNA library of RNA and amplification efficiency. (D) Representative realtime amplification plot of U6 snRNA from the serially diluted cDNA library of miRNAs and their amplification efficiency. (E) Representative Western blot analysis of total protein using anti-b-actin antibody, where M is the protein marker and lanes 1 and 2 are from duplicate experiments.
buffer was designed consisting of GuSCN (guanidine thiocyanate), Tris/HCl (pH 7.4), Triton-X-100 and EDTA. These four components play a unique role in the isolation, lysis and maintain the integrity of target molecules (Maniatis et al., 1982; Boom et al., 1990). GuSCN is a chaotropic salt that inhibits DNase, RNase and protease and dramatically increases the binding of DNA to the silica membrane at pH 7.4. The pH of the lysis buffer was maintained by adding Tris buffer (pH 7.4). A non-ionic detergent (Triton X-100) was compatible with GuSCN salt which helps to solubilize membrane lipoprotein and glycolipid (Boom et al., 1990). EDTA was included to chelate the divalent cation (Mg+2), which maintains the integrity of the cell membrane and worked as a cofactor for DNase I (Allers and Lichten, 2000). After lysis of the cultured cells, the lysate was passed through the silica column to allow the binding of DNA to the silica membrane. Flow-through was collected assuming that RNA, miRNA and protein would be bound. RNA (total RNA, miRNA) and proteins were separated by the phenol–chloroform-based 2-phase method (Chomczynski and Sacchi, 1987). RNA and miRNA can bind to the column in the presence of chaotropic salt only when mixed with a particular concentration of ethanol (Lodes et al., 2009). The aqueous phase containing RNA and miRNA was mixed with low and high concentration of ethanol and passed through the column to separate large RNA and miRNA respectively.
782 www.cellbiolint.org N Volume 36 (9) N pages 779–783
The method assumes significant importance in allowing the simultaneous study of genomics, epigenomics, Rnomics, regulatory events and proteomics from a sample without its fractionation, thereby facilitating high throughput reproducibility. The procedure is as good as available commercial kits in terms of yield, starting amount, time and importantly it is cost effective. The method has been optimized and is routinely used in our laboratory with samples, such as mammalian embryos, oocytes and cell lines. Thus, we have successfully developed a column-based (potentially commercial) method for the sequential isolation of DNA, RNA, miRNA as well as protein from a single sample without its fractionation, thus giving more consistent results and reducing variability. This method not only provides a rapid isolation of crucial biomolecules within 1 h but also the highest quality of isolated biomolecules. Isolated DNA, RNA and miRNAs are suitable for all commonly used downstream applications, such as PCR, qRT–PCR, reverse Northern blotting and real-time PCR. Similarly, isolated protein is also suitable for SDS/PAGE and Western blot analysis. The buffers and reagents used in this method were optimized to achieve the most cost effective and reliable procedure to separate the functional biomolecules of the cell.
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
Cell Biol. Int. (2012) 36, 779–783
Author contribution Sandeep Rajput and Vivek Priye Dave provided the concept, designed the experiments and performed real-time PCR, Western blotting, reverse Northern blotting studies and data analysis. Ankita Rajput carried out the DNA, RNA, miRNA and protein isolation and also optimized the buffer compositions. Tirtha Kumar Datta revised the article for important intellectual content. Hausila Prashad Pandey participated in the design of the study and helped to draft the manuscript. Rakesh Kumar Singh provided the funding, drafted manuscript and supervised the research group. All authors read and approved the final manuscript.
Funding This work was supported by institutional grants from the Banaras Hindu University.
References Allers T, Lichten MA. Method for preparing genomic DNA that restrains branch migration of Holliday junctions. Nucleic Acids Res. 2000;28:e6.
Boom R, Sol CJA, Salimans MMM, Jansen CL, Wertheim van Dillen PME, van der Noordaa J. Rapid and simple method for purification of nucleic acids. J Clin Microbiol 1990;28:495–503. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156–9. Chong L, Ray LB. Whole-istic Biology. Science 2002;295:1661. Cox BT, Kislinger, Emili A. Integrating gene and protein expression data: pattern analysis and profile mining. Methods 2005;35:303–14. Kaul D, Khanna A, Suman. Evidence and nature of a novel miRNA encoded by HIV1. Proc Indian Natl Sci Acad 2006;72:91–5. Lodes MJ, Caraballo M, Suciu D, Munro S, Kumar A, Anderson B. Detection of cancer with serum miRNAs on an oligonucleotide microarray. PLoS ONE 2009;4(7):e6229. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; 1982. p. 194–7. Nanassy OZ, Haydock PV, Reed MW. Capture of genomic DNA on glass microscope slides Original Research Article. Anal Biochem 2007;365:240–5. Reif DM, White BC, Moore JH. Integrated analysis of genetic, genomic and proteomic data. Expert Rev. Proteomics 2004;1:67–75. Tolosa JM, Schjenken JE, Civiti TD, Clifton VL, Smith R. Column-based method to simultaneously extract DNA, RNA, and proteins from the same sample. BioTechniques 2007;43:799–804. Takahiro N, Takashi A, Terumoto K, Thomas W, Shaf K, Hideki K et al. Simultaneous isolation of total RNA, DNA, and protein using samples obtained by EBUS-TBNA. J Bronch Interv Pulm 2011;18:301–5.
Received 11 June 2011/ 16 March 2012; accepted 3 May 2012 Published as Immediate Publication 3 May 2012, doi 10.1042/CBI20110342
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
Volume 36 (9) N pages 779–783 N www.cellbiolint.org
783
