Additional file 1: List of oligonucleotide primers and ... - BioMed Central
Recommend Documents
Additional file 1: Gene expression profiling analysis. ... Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, ...
The following PCR primers were used to generate templates for in vitro transcription (T7 promoter is underlined). Yeast genomic DNA of BY4741 strain was used ...
the University of New South Wales. 4 Gender ... discussed by BHR and LK and by 14 interviews new ... free coded to identify different or emergent themes or.
Sydney, NSW Department of. Health. 3. Booth ML ... Sydney, NSW Ministry of Health. 8. Hardy LL, King L, ... Get skilled: Get active. A K-6 resource to support.
We call Figure S1C. PCA-position profile. ..... Figure S5. Correlation ... International Conference on Genome Informatics 2003, 14:84-93. 5. Cheng Y, Miura RM, ...
Intervention delivery via Aboriginal Community Controlled Health Services compared ... services. 36%of all urban consults,. 23% rural, 15% remote. Composite.
Additional file 1 Validation work for eIF4A3, PDI, Hsp70, and PP2A. Supplementary Figure Legends. Figure S1. Knockdown of eIF4A3 did not affect cell viability ...
Technology, Saudi Arabia), Christopher J.O. Baker (University of New ... (Kyushu Institute of Technology, Japan), Igor V. Kurochkin (Bioinformatics Institute,.
A Detected superdomains and cooperative domains in DIP data by APMM. Table I: .... The domain names are labeled by the same color as in the Pfam domain ...
server's memory requirements below 2 GB (see methods). A disadvantage of .... time for a complete oligo library from several weeks to several hours on our dedicated. MySQL server .... downstream tools for their custom needs. Some example ...
If the person decides to seek professional help, the first aider should encourage them to take a support person to their appointment. 1. As far as possible, the first ...
Additional file 4. Control of the ... YFPC fragment) and on the top (fusions with the YFPN fragment), together with a âplastidâ-CFP marker. The co- transformation ...
Homo sapiens transmembrane 4 L six family member 1 (TM4SF1), mRNA. [NM_014220]. 1.486. SCAMP5. Homo sapiens secretory carrier membrane protein 5 ...
Additional file 8 | Bisulfate converted primers used in HRM. Genes. Forward. Reverse. Annealing (oC) Marker (Kb)*. FUCA1. TCGGTGTTAGGTTAGTGCGTAG.
One input file with the extension 'snpe' for p-values is required. ... In the above file, column 1 is the marker name, column 2 is the chromosome number, column 3.
Organisational aspects (password availability, access to computers). 3. What could be done ... connection, passwords, usability of the website. 2. What could be ...
the Upper Kapuas. Lakes System. Peat. Fauna Flora International,. Macquarie Bank http://karbon- redd.blogspot.com/2009/08/redd-projects- in-indonesia.html. 2.
Additional file 1: List of oligonucleotide primers and ... - BioMed Central
Additional file 1: List of oligonucleotide primers and microRNA assays used in this study. Oligonucleotide primers used for Genomic PCR of the LOC554202 locus LOC554202Ex1GF: 5’-GCAGCTGCGACCTGTGCATAACTT-3’ LOC554202Ex1GR: 5’-GGCCCCGAAGCCTCCTCAACTC-3’ PCR product size: 338 bp LOC554202Ex2GF: 5'-TTTTTCTATCACTGCCTTTTCACA-3’ LOC554202Ex2GR: 5’-GCCCCCAACTCTATTTACCAA-3’ PCR product size: 358 bp LOC554202Ex3GF: 5’-GTGAAAAATGGCAAACTTAT-3’ LOC554202Ex3GR: 5’-GACAACAAATTCTGAGATGAGGAT-3’ PCR product size: 379 bp LOC554202Ex4GF: 5’-TAGGGCTGCCAGTAGAGGGAAGAG-3’ LOC554202Ex4GR: 5’-GCAAGCAGGCCAACCAACAAG-3’ PCR product size: 450 bp LOC554202Ex4GF: 5’-TAGGGCTGCCAGTAGAGGGAAGAG-3’ miR-31-Genomic-R: 5’-CATCTTCAAAAGCGGACACTCTAAGGAAGACTATGTTG-3’ PCR product size: 363 bp ERVK6-F: 5’-AGGGACTAGGGAAAAATGAAGATG-3’ ERVK6-R: 5’-GGGTTGAATTACGGCGTTTACAGC-3’ PCR product size: 343 bp Maps to BAC clone RP11-33P21 from human chromosome 7 Oligonucleotide primers used for Bisulfite sequencing Forward primer: 5’-GGGATTTAGGTTTTTTTATTGTAA-3’ Reverse Primer: 5’-AAAAAACCCCTAAAAAAACAAAAAT-3’ Number of CpG dinucleotides covered: 14 Product size: 250 bp Oligonucleotide primers used for Methylation–Specific PCR MSP set 1 Left M primer 1: 5’-CGGGATTTAGGTTTTTTTATTGTAAC-3’ Right M primer 1: 5’-CCTCTCCCTTAACTCTAACTACGAA-3’ Left U primer 1: 5’-TGGGATTTAGGTTTTTTTATTGTAATG-3’ Right U primer 1: 5’-CCTCTCCCTTAACTCTAACTACAAA-3’ Product size: 138 bp
Additional File 1 Continued MSP set 2 Left M primer 2: 5’-CGGGATTTAGGTTTTTTTATTGTAAC-3’ Right M primer 2: 5’-CCTCTCCCTTAACTCTAACTACGAA-3’ Left U primer 2: 5’-TGGGATTTAGGTTTTTTTATTGTAATG-3’ Right U primer 2: 5’-CCCTCTCCCTTAACTCTAACTACAAA-3’ Product size: 138 bp
Oligonucleotide primers used for RT-PCR LOC554202 Ex1 F: 5’-CAGAGCTGGGAGGCGGTGTTC-3’ LOC554202 Ex3R: 5’-AGGAGGCTGGGAGGGTGGTCT-3’ LOC554202 Ex4R: 5’- CTCTACACTGGCCTTGAGGAGGTA-3’ GAPDH-F: 5'-TGAAGGTCGGAGTCAACGATTTGGT-3' GAPDH-R: 5'-CATGTGGGCCATGAGGTCCACCAC-3' PCR product size: 932 bp miR-31 transfection reagents miR-31 mature sequence: AGGCAAGAUGCUGGCAUAGCU pre-miR-31 precursor: Ambion Product Number: AM17100; Product ID: PM11465 Negative Control miR: Ambion Product Number: AM17110 TaqMan microRNA assays for qt-RT-PCR Mature miR-31 TaqMan microRNA Assay ID 002279 Pri-miR31 microRNA TaqMan assay ID Hs03302684_pri miR-16 TaqMan microRNA Assay ID 000391 RNU6B TaqMan microRNA Assay ID 001093