• Home
  • Add Document
  • Sign In
  • Create An Account

Additional file 1.pptx

Recommend Documents
4.68E-75. Arabidopsis thaliana DOCK family ...... Arabidopsis thaliana photosystem II light harvesting ...... Arabidopsis thaliana light-regulated zinc finger protein 1. mRNA ...... 0.003008732 Arabidopsis thaliana TCP interactor containing.

Email: Wu Hsiung Wu - [email protected]; Feng Sheng Wang* ... The installer will create a new shortcut of the program on the desktop in ... Three template.

other correlation was significant [all ps > .05]. Figure S5: Brain-behavior-correlations for the effect of arithmetic complexity in the addition task. The difference.

Western blots showing that the reduction in RAD51 levels after cisplatin ... or 3 µM cisplatin for 24 (Day 1), 48 (Day 2) or 72 h (Day 3) and western blotted for ...

Acacia etbaica Schweinf. Fabaceae. Hamaressa. EL167. Inability to walk properly /Dereba. L. R. F/D. Cdr. Acacia mellifera (Vahl ) .... Breonadia salicina (Vahl).

a) Expression pattern of Bdh first promoter. (T16F01DD69D0) and the other correlated promoters at cluster 1. b) Expression pattern of Bdh second promoter.

I'm here to record your reactions and comments of the App you'll view. During this session I ... Can you create an icon on your desktop to access it more easily later. Pathway(s) .... Would you use this App your own in the future? Why/why not?

RK [email protected]. KH [email protected] .... Duncan P, Richards L, Wallace D, Stoker-Yates J, Pohl PP, Luchies C, Ogle A, Studenski S: A randomized ...

Acorus calamus. Alisma plantago-aquatica. Baldellia ranunculoides ... Posidonia australis. Posidonia oceanica. Ruppia cirrhosa. Phyllospadix scouleri.

2002 Belfanti Sore throat. Mogilev CT2-19. D2-S75-S15-S101. 4499. 2006 Belfanti Sore throat. Gomel. CT2-20. D2-S75-S40-S101-S15-S101. 5171. 2012 Mitis.

Solvent was evaporated in vacuo, and the residue was dissolved in AcOEt and ... Purification was accomplished by chromatography with AcOEt/hexane mixture ...

The orthologous turkey (Meleagris gallopavo, MGA) chromosome. (from [2]) is also listed. GGA chromosome. GGA BAC. Clone. GGA Marker. APL chromosome.

protein unc-119 homolog B. Q13432. P4. AVDGSGTKF. + ribosome biogenesis protein WDR12. Q9GZL7. P6 .... protein asunder homolog. Q8NVM9. 9.

membrane domains are in bold, and in pink boxes respectively. proteins acting on ... 0.01. 1.00. At1g30710 homologous to berberine-bridge enzyme (S)-.

Fox BD [170]. 2012 BMJ. 3. ... Lopez-Olivo MA [183]. 2012 JAMA .... review and meta-analysis of randomised trials. BMJ. 2017;358:j3887. 17. Batelaan NM .... Khera R, Murad MH, Chandar AK, et al. ..... Keene D, Price C, Shun-Shin MJ, et al.

same grasslands habitats where it avoids competition with L. flavus by foraging ... Further arguments for the likely absence of scramble competition between root.

СТАCGCCATCATGTGAAGCAGCTITAAATTGGGGTTGCTGCтстСТААСАGTCтстттGGTGGGACAATT. Russula puellaris. Russula violeipes. Amanita citrina.

pressure (mmHg). Yes/No. Heart rate per minute. Yes/No. Consciousness. Yes/No. Oxygenation: NRM. Ventimask O2-glasses. None. Oxygen in liters per minute ...

gos - gu § - G Su gaz z os gan. > S. - -. Š a 50. g g os. GGC ACG CTG GGC AGC GAG GCG AAG CTG CGG GAG GAG GAG CTG GGG GCA GAG 663.

Nov 18, 2018 - Additional File 11. Species. Amphimedon queenslandica. Ephydatia muelleri. Oscarella lobularis. Nematostella vectensis. Danio rerio.

Typhoid. Decoction of a mixture of the roots and leaves is taken orally. ..... kamerunensis is orally. Raphia hookeri Man. & Wendl. Arecaceae Kho. Sap. Induces.

Additional file 1 Validation work for eIF4A3, PDI, Hsp70, and PP2A. Supplementary Figure Legends. Figure S1. Knockdown of eIF4A3 did not affect cell viability ...

1. 1. Yes 19.43 (7.22-. 18.95 (8.01-44.85) 16.86 (7.32-38.85) 17.08 (7.12-40.96) 23.57 (9.37-59.27) 15.86 (6.77-37.19) 18.28 (7.20-46.40). Matchbox- test ≤17 1.

C...................................T. A3 (6) .....C........................................................C...................................T. A4 (2) .....C........................................................C.................................

Additional file 1.pptx

Download PDF
0 downloads 0 Views 69KB Size Report
Comment
Similar to sulfate transporter [Arabidopsis thaliana], partial. 0.0052. 2.69. VVCCGC2069C05.b1 Similar to outward-rectifying potassium channel KCO1 ...
Addi

Suggest Documents


Additional file

Additional file

Read more
Additional file

Additional file

Read more
additional file

additional file

Read more
additional file

additional file

Read more
Additional file Additional file 2. Medicinal plants used ...

Additional file Additional file 2. Medicinal plants used ...

Read more
Additional data file 6 ab Additional data file 6: CAGE

Additional data file 6 ab Additional data file 6: CAGE

Read more
Additional File 1_Usability_Interview_Guide

Additional File 1_Usability_Interview_Guide

Read more
Additional file 1

Additional file 1

Read more
Additional file 2

Additional file 2

Read more
Additional File 2

Additional File 2

Read more
Additional file 1

Additional file 1

Read more
Additional file 2

Additional file 2

Read more
Additional File 2

Additional File 2

Read more
Additional file 5_26.10.09 - Hal

Additional file 5_26.10.09 - Hal

Read more
Additional file 1

Additional file 1

Read more
Additional File

Additional File

Read more
Additional file 3

Additional file 3

Read more
Additional file 1

Additional file 1

Read more
Additional file 2

Additional file 2

Read more
Additional File 11

Additional File 11

Read more
Additional file 1

Additional file 1

Read more
Additional file - BioMed Central

Additional file - BioMed Central

Read more
Additional file 2 - PLOS

Additional file 2 - PLOS

Read more
Additional file 7

Additional file 7

Read more

Report "Additional file 1.pptx"

Copyright © 2025 M.MOAM.INFO. All rights reserved.
DMCA.com Protection Status | About Us | Privacy Policy | Terms of Service | Help | Copyright | Contact Us | Cookie Policy

Sign In

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close