questionnaire used in the ...... Survey for Children and Youth study; NW, normal weight; OB, obese; OR, odds ratio; OW, overweight; PCQ, Primary Caregivers'.
Nov 24, 2015 - Current Gene List for Congenital Immune Defects (N=305). IBTK. BTK. IGHM. IGLL1 (λ5). CD79A. CD79B. BLNK. LRRC8A. ICOS. CD19. CD81.
Supplementary Figure S1. (A) Inhibition rates of WHCO1 cancer cells incubated with different concentrations of cisplatin for 24 h. (B) Inhibition rates of WHCO1 ...
Expansion of M-MDSC by dexmedetomidine is inhibited by yohimbine. (A-B) CD11b. +. CD33. +. HLA-DR. â cells (3 Ã 10. 4 cells/well) isolated from lung cancer ...
Table S1. Control and PD cases; Figure S1. Melanin bleaching in postmortem midbrain sections and immunostaining for phospho-eEF2 (p-eEF2, Thr56); Figure ...
Additional file 1: Table S1. List of 91 raptor nesting sites in the study area in India and prey composition recorded for each raptor species. Locality. Lat. Long.
234. 1.1 (0.5-3.0). Specific joint involvement, n (%). Hip joint. 422. 58 (13.7). Ankle joint. 422. 188 (44.6). Tarsal joint. 422. 36 (8.5). Subtalar joint. 422. 54 (12.8).
The following PCR primers were used to generate templates for in vitro transcription (T7 promoter is underlined). Yeast genomic DNA of BY4741 strain was used ...
GTATTTCTAAAACACGTGATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGAG G CGTCATTATACACGTGATAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACT TCGACCGAATTCTCCCCATTGGGTGGATATGGTGTATTTGCGAGAAAATCTTTCGAGAAGGGAGAACTTGT