1
Protocol of RAD library construction Masashi Sekino, Ph.D, National Research Institute of Fisheries Science Please email me (
[email protected]) if you find uncertainties on this protocol.
This protocol is based on one of the methods of RAD library construction (Amores et al. 2011) with minor modifications. In our case, a RAD library basically contained DNA from three individuals. For each library, we allocated one lane of Genome Analyzer IIx flow cell (Illumina, http://www.illumina.com/) to obtain sequence reads (single-read sequencing). As a type II restriction enzyme, we used SbfI, which recognizes a stretch of nucleotides, 5'-CCTGCAꜜGG-3' (DNA is cleaved at the position indicated by arrow). The following are abbreviations of supplier names of reagents/consumables used in this protocol (web sites accessed, 22 Apr, 2015). NEB: New England Biolabs, https://www.neb.com/ PMG: Promega, https://www.promega.com/ LNZ: Lonza, http://www.lonza.com/ LTC: Life Technologies, https://www.lifetechnologies.com/ ZMR: Zymo Research, https://www.zymoresearch.com/ TKR: Takara, http://www.takara-bio.com/ EPC: Epicentre, http://www.epibio.com/ BKM: Beckman Coulter, https://www.beckmancoulter.com/ 1. DNA digestion with restriction enzyme SbfI We obtained starting genomic DNA of glass eels using the standard phenol/chloroform method with RNase A treatment. As tissue samples for DNA extraction, we used a section of body trunk posterior to the anal. For each individual, we quantified the DNA concentration using Qubit® fluorometer (LTC). Prepare reaction mixture (70 μl) for each individual containing: 10× CutSmart buffer (NEB)
6.0 μl
SbfI-HF (NEB) (20 U/μl) Genomic DNA
0.5 μl x μl (equivalent to 0.8-1.0 μg)
ddH 2O
63.5−x μl
Incubate the mixture at 37˚C for 2.5 hrs, followed by a heat inactivation step (65˚C, 45 min). Decrease the temperature of mixture to RT gradually (ca. 30 min). Note that the
2 input of initial DNA from each individual should be changed depending on the number of individuals to be contained in a library (2.5-4.0 μg per library). 2. P1 adapter ligation First, add P1 adapter (Appendix) to the deactivated SbfI reaction mixture. DNA-SbfI mixture P1 adapter (100—200 nM)
70.0 μl 5.2 μl
Add the following reagents to the mixture. 10× NEBuffer 2 (NEB)
9.0 μl
rATP (PMG) (10 mM)
0.7 μl
T4 DNA ligase (NEB)* 0.5 μl *400 cohesive end units/μl ddH 2O
4.6 μl
Mix well the contents gently. Incubate the mixture (90.0 μl in total) at RT for 2 hrs (or 65˚C, 30 sec > 72˚C, 90 sec Final elongation: 72˚C, 5 min After checking the amplification success on agarose gels (Fig. 2; 5 μl loading volume), perform additional three sets of PCR for each library. For each library, combine the PCR products obtained from four PCR sets including the first preliminary amplification.
5 Fig. 2 Agarose gel electrophoresis of PCR products (four RAD libraries).
Target products
Purify the combined PCR products using AmPure beads. At this point we use AmPure as much as 1.2-fold the volume of DNA solution. Repeat this purification step four times. The final elution volume (elution buffer) is 15.0 μl. The resulting DNA solution refers to a RAD library. Quantify the DNA concentration using Qubit dsDNA HS Assay Kit. Then, check the library quality in Agilent 2100 Bioanalyzer (Agilent Technologies; http://www.agilent.com/home) (Fig. 3).
Fig. 3 An electrophoregram of diluted (one-third) RAD library (Agilent’s Bioanalyzer). Two peaks at 35 and 10,380 bp are internal size standard. Confirm that undesired peaks (typically shorter size) are negligibly weak. If not, re-purification should be made.
Reference Amores A, Catchen J, Ferrara A, Fontenot Q, Postlethwait JH (2011) Genome evolution and meiotic maps by massively parallel DNA sequencing: spotted gar, an outgroup for the teleost genome duplication. Genetics 188:799−808
6
Appendix Adapters (modified Illumina’s Solexa © adapters; SbfI-specific) Notes: XXXXXX, 6 nt of index sequence; ♯, phosphorothioation (S-oligo); P, phosphorylation For details of index sequences (Illumina’s TrueSeq ® index), consult the supplier.
P1 adapter Top 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXXXXTGC♯A-3′ Bottom 5′-PXXXXXXAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -3′
P2 adapter Top 5′-PGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCAGAACAA-3′ Bottom 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC ♯T-3′
PCR primers P5-forward primer 5′-AATGATACGGCGACCACCGA-3′
P7-reverse primer 5′-CAAGCAGAAGACGGCATACGA-3′
