Changes in Expression of Vascular Endothelial ...

ARTICLE

Changes in Expression of Vascular Endothelial Growth Factor and Its Receptors in the Aging Mouse Cochlea, Part 1: The Normal-Hearing Mouse Thileeban Kandasamy, MD, David J. Clinkard, MSc, Wei Qian, MD, Stephen Chen, PhD, Joseph M. Chen, MD, FRCSC, Robert V. Harrison, PhD, and Vincent Y.W. Lin, MD, FRCSS ABSTRACT Background: Presbycusis is the most common degenerative otologic condition. New research is pointing toward vascular changes within the cochlea with age. Vascular endothelial growth factor (VEGF) and its receptors, Flt-1 and Flk-1, are important regulators of angiogenesis. Objective: The aim of this study was to characterize the hearing, VEGF expression, and vasculature of young and old Swiss Webster (SW) mice. Methods: Young (4 weeks, n 5 14) and aged (32–36 weeks; n 5 14) SW mice were used. Hearing was evaluated using the auditory brainstem response. Changes in VEGF, Flt-1, and Flk-1 expression and histology were evaluated by immunohistochemistry and realtime polymerase chain reaction (quantitative PCR). Results: Aged SW mice demonstrated clinically stable hearing with age with mean hearing thresholds dropping 5.7, 4.2, 6.5, and 10.9 dB peSPL with age at 4, 8, 16, and 32 kHz pure-tone stimuli, respectively. Immunohistochemistry showed the presence of VEGF, Flt-1, and Flk-1 in the stria vascularis, spiral ganglion, and organ of Corti. Strong expression was found within the hair cells and the stria vascularis. Immunohistochemistry and qPCR demonstrated no difference in expression levels between age groups or between apical and basal turns of the cochlea. Microscopy demonstrated no difference in the number or density of stria vascularis vessels between age groups. Conclusions: We describe a mouse model of stable hearing with aging. Stria vascularis vasculature and expression of VEGF, Flt1, and Flk-1 do not change with age, and there appears to be no apical to basal differential expression. These results provide valuable normalized data to compare VEGF expression and vasculature patterns to other mouse strains. SOMMAIRE Contexte: La presbyacousie est l’affection otologique de´ge´ne´rative la plus fre´quente. D’apre`s des travaux re´cents de recherche, il se produit avec l’aˆge des changements vasculaires dans la cochle´e. Le facteur de croissance endothe´lial vasculaire (FCEV) et ses re´cepteurs, Flt-1 et Flk-1, sont des re´gulateurs importants d’angiogene`se. Objectif: La pre´sente e´tude visait a` caracte´riser l’audition, l’expression du FCEV, et le syste`me vasculaire chez des souris Swiss Webster (SW), jeunes et vieilles. Me´thodes: L’e´tude a e´te´ re´alise´e sur des souris SW, jeunes (4 semaines; n 5 14) et vieilles (32–36 semaines; n 5 14). L’audition a e´te´ de´termine´e a` l’aide des re´ponses e´voque´es auditives du tronc ce´re´bral; les changements d’expression du FCEV, du Flt-1, et du Flk1 et les coupes histologiques ont e´te´ e´value´s a` l’aide de l’examen immunohistochimique et de l’amplification en chaıˆne par polyme´rase en temps re´el (quantitative; ACPq). Re´sultats: Une audition cliniquement stable par rapport a` l’aˆge a e´te´ observe´e chez les vieilles souris; ainsi, la diminution des seuils moyens d’audition avec l’aˆge e´tait de 5.7, 4.2, 6.5, et 10.9 dB peSPL, aux stimulus en son pur de 4, 8, 16, et 32 kHz, respectivement. L’examen immunohistochimique a re´ve´le´ la pre´sence de FCEV, de Flt-1, et de Flk-1 dans la strie vasculaire, le ganglion spiral, et l’organe de Corti. Une forte expression a e´te´ constate´e dans les cellules cilie´es et dans la strie vasculaire. Par contre, aucune diffe´rence d’expression n’a e´te´ observe´e a` l’examen immunohistochimique ou a` l’ACPq entre les groupes d’aˆge ou

Thileeban Kandasamy: Department of Otolaryngology-Head and Neck Surgery, University of Toronto; David J. Clinkard, Wei Qian, Stephen Chen, Joseph M. Chen, and Vincent Y.W. Lin: Department of Otolaryngology-Head and Neck Surgery, Sunnybrook Health Sciences Centre; and Robert V. Harrison: Department of Otolaryngology-Head and Neck Surgery, The Hospital for Sick Children, Toronto, ON.

S36

Address reprint requests to: Thileeban Kandasamy, MD, 770 Bay Street, #1807, Toronto, ON M5G 0A6.

DOI 10.2310/7070.2011.110091 # 2012 The Canadian Society of Otolaryngology-Head & Neck Surgery

Journal of Otolaryngology-Head & Neck Surgery, Vol 41, No S1 (April), 2012: pp S36–S42

Kandasamy et al, Presbycusis and VEGF

S37

entre les spires basale et apicale de la cochle´e. L’examen microscopique n’a pas re´ve´le´ de diffe´rence entre les groupes d’aˆge quant au nombre de vaisseaux ou a` leur densite´ dans la strie vasculaire. Conclusions: L’e´tude a donne´ lieu a` la description d’un mode`le d’audition stable en lien avec le vieillissement chez la souris. L’organisation des vaisseaux dans la strie vasculaire et l’expression du FCEV, du Flt-1, et du Flk-1 ne changent pas avec l’aˆge, et il n’y a pas d’expression diffe´rentielle apico-basale. Les re´sultats fournissent des donne´es normalise´es, qui se re´ve´leront tre`s utiles dans les comparaisons de l’expression du FCEV et de la structure du syste`me vasculaire dans d’autres ligne´es de souris. Key words: angiogenesis, presbycusis, vascular endothelial growth factor

resbycusis—age-related hearing loss—is a growing global health epidemic with significant socioeconomic impact. The prevalence of hearing loss accelerates dramatically with age, with approximately 25% of subjects aged 50 to 65 years having hearing thresholds greater than 30 dB in at least one ear,1 and self-reported hearing loss can be identified in half of those aged 85 years and older.2 Presbycusis is typically seen as a down-sloping, highfrequency hearing loss on an audiogram. Presbycusis is thought to result from age-related degeneration of the cochlea with the cumulative effects of extrinsic damage (noise and other ototoxic agents) and intrinsic disorders. The dominant framework for approaching presbycusis is one championed by Schuknecht, who emphasized the occurrence of metabolic and vascular changes within the cochlea.3,4 More recently, declining function of the stria vascularis has been implicated in the pathogenesis of presbycusis.4,5 Furthermore, diminished density of capillary networks and decreased vascular diameter have been demonstrated in focal segments of the stria vascularis and are thought to underlie the degeneration and dysfunction of the stria that occur with aging.6,7 As a result, new research has focused on the molecular signaling involved in angiogenesis within the cochlea. Vascular endothelial growth factor (VEGF) and its receptors, Flt-1 and Flk-1, are key molecules that help regulate the formation of vascular networks throughout the body. Their presence and function are crucial for the promotion of angiogenesis and the maintenance of tissue vascularization. In vitro studies with VEGF demonstrate a protective effect on cultured neurons from hypoxia, increased reactive oxygen species, serum deprivation, and glutamate-induced excitotoxicity.8 Previous studies have shown that VEGF, Flt-1, and Flk-1 are expressed in the cochlea of animal models.9,10 More recently, studies have shown a link between VEGF levels in the cochlea and noiseinduced hearing loss.11–13 However, only one study has looked at the relationship between VEGF in the cochlea and age-related hearing loss. Picciotti and colleagues examined the cochleas of c57BL/6J mice—a murine model of earlyonset, age-related, down-sloping, high-frequency hearing.14

P

Their group showed a significant reduction in VEGF expression in the aged cochlea compared to the cochlea of younger mice. However, no study thus far has looked at whether the high-frequency hearing loss typically seen in presbycusis is associated with a differential expression of VEGF and its receptors along the cochlea—from basal turn to the apex. More importantly, no previous study has evaluated the gene expression of these molecules in an agematched control group that maintained normal hearing with age. Establishing a mouse model of hearing preservation with age and evaluating the expression of VEGF and its receptors would control for confounding factors and better answer questions surrounding the biochemical etiology of presbycusis. Therefore, the aim of this study was to characterize the hearing and VEGF expression patterns of young and old Swiss Webster (SW) mice, a mouse strain not known for early–onset, age-related hearing loss.

Methods Animal Models SW mice were obtained from Charles River Laboratories (Montreal, QC), and a 1-week acclimatization period was allowed before experimentation began. Animals had ab libitum access to water and food and were kept on standard 12-hour light/dark cycles at 23uC. All experiments were performed with the approval of the University of Toronto Animal Care Committee and Canadian standards of ethical treatment of laboratory animals. Auditory Brainstem Responses Eight young (4 weeks old) and eight old (32–36 weeks old) SW mice were evaluated to establish baseline audiometric data. Auditory brainstem responses (ABRs) were performed in a sound-attenuating chamber on the lightly anesthetized animal, employing ketamine (15 mg/kg) and xylazine (2.5 mg/kg). ABRs were recorded using skin electrodes in a standard vertex to postaural configuration. Acoustic stimuli were short (1 ms rise/fall, 2 ms plateau) tone pips of

S38

Journal of Otolaryngology-Head & Neck Surgery, Volume 41, Number S1, 2012

4, 8, 16, and 32 kHz presented between 70 dB peSPL and 220 dB peSPL. Potentials were bandpass filtered (150 Hz to 3 kHz) and amplified conventionally. After A–D conversion and artifact rejection, signals were averaged (Cambridge Electronic Design 1401 intelligent interface with 80286 host). In general, 300 averages of a 25 ms window were used. Immunohistochemistry All mice evaluated with ABRs were sacrificed by cervical dislocation following isoflurane exposure. The cochlea was quickly isolated and immersed in ice-cold Dulbecco’s Modified Eagle’s Medium (DMEM) with 1% fetal bovine solution (FBS). The brain, muscle tissue, and stapes were removed. The superior semicircular canal was opened, and the cochlea was opened near the round membrane and apex. Four percent paraformaldehyde (PFA) was injected into the cochleostomy. Samples were then stored in 4% PFA overnight at 4uC. Cochleas were then rinsed in phosphatebuffered solution (PBS) and decalcified in 10% ethylenediaminetetraacetic acid (EDTA) solution for 3 days. Cochleas were then immersed in increasing sucrose concentration from 10 to 30% over 3 days. Tissues were then embedded in O.C.T over dry ice, sectioned into 10 mm slices, and placed on charged slides. The samples were then processed for immunohistochemical labeling with VEGF, Flt-1, and Flk-1 primary antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Primary antibodies were used in a 1:500 dilution in 10% normal goat serum (NGS) (Gibco, Carlsbad, CA) in 0.05% Triton X-100 (SigmaAldrich, Oakville, ON) overnight at 4uC on a nutator. An antigoat cy3 secondary antibody (Jackson Immunoresearch, West Grove, PA) was used in a 1:500 dilution in 10% NGS and 0.05% Triton X-100 for 4 hours at room temperature. A phalloidin–fluorescein isothiocyanate (Sigma-Aldrich) counterstain was applied for 15 minutes prior to tissue mounting with Vectashield (Vector Laboratories, CA). Images were taken using a Zeiss LSM 510 confocal microscope with the 603 water immersion lens. Images were then further processed using ImageJ software (National Institutes of Health, Bethesda, MD). Processed images were then used for blood vessel counts and stria vascularis area calculations. This was done using the surface area calculator on ImageJ. Representative sections were analyzed, blood vessels that label for phalloidin were traced, and the total area was calculated. The number of phalloidin-labeled blood vessels was also recorded. The percentage of the imaged portion of the stria vascularis occupied by blood vessels was then calculated. The Student t-test was then used to determine statistical differences in both blood vessel area and number.

Real-Time Polymerase Chain Reaction Twelve mice were sacrificed by cervical dislocation after isofluorane anesthesia. After decapitation, the temporal bones, including the cochlea, were isolated. Apical and basal turns were isolated and placed in RA1 buffer (Machery-Nagel, Germany) on ice, and ribonucleic acid (RNA) was extracted immediately. Messenger ribonucleic acid (mRNA) was isolated using spin columns according to the manufacturer’s protocol (Machery-Nagel,). mRNA quality was assessed using a NanoVue 4282 Spectrophotometer (GE Healthcare Life Sciences). Complementary deoxyribonucleic acid (cDNA) synthesis was performed on 0.25 mg total RNA using a SuperScript II cDNA synthesis kit (Invitrogen) according to the manufacturer’s protocol. The following primers were used: glyceraldehyde 3-phosphate dehydrogenase (GAPDH), VEGF-A, Flt-1, and Flk-1 (Integrated DNA Technologies, CA). One millilitre of cDNA, 0.5 mL of 5000 nM forward and reverse primers, 10.5 mL of ribonuclease free water (BioRad, Hercules, CA), and 12.5 mL of SYBR Green Supermix (Bio-Rad) were combined for a total reaction volume of 25 mL. Reactions were run in triplicate, and amplification products were detected in a StepOne real-time polymerase chain reaction (PCR) detection system (Bio-Rad). The following primer sequences were used: GAPDH Reverse: 59-GCATGGACTGTGGTCATGAG Forward: 59-GCACCACCAACTGCTTAGC VEGF-A Forward: 59-CCACGTCAGAGAGCAACATC Reverse: 59-TCA TTCTCTCTATGTGCTGGCTT Flt-1 ((VEGF-R1) Forward: GAG GAGGATGAGGGTGTCTATAGG Reverse: GTGATCAGCTCCAGGTTTGAC Flk-1 (VEGF-R2) Forward: GCCCTGCTGTGGTCTCA Reverse: CAAAGCATTGCCCATTCG Real-time PCR was carried out for 45 cycles at 95uC for 3 minutes, 57uC for 45 seconds, 95uC for 15 seconds, 90uC for 15 seconds, 60uC for 1 minute, and 95uC for 15 seconds. The 2DDCt method was used to assess for relative changes in mRNA levels.15 Values were normalized with GAPDH and the young SW apical turns. Statistical Analysis Comparing ABR threshold means was done using MannWhitney testing. Analyses of mean for change for gene

S39

Kandasamy et al, Presbycusis and VEGF

product was performed using the Kruskal-Wallis nonparametric test with a p value , .05 taken to indicate significance. Relative changes in mRNA levels are presented as mean values 6 standard deviation.

Results Auditory Brainstem Responses The mean thresholds were 23.6, 11.1, 25.3, and 29.7 dB peSPL at 4, 8, 16, and 32 kHz pure-tone stimuli, respectively, in the younger mice. The older mice had mean thresholds of 29.4, 15.3, 1.3, and 20.63 dB peSPL at 4, 8, 16, and 32 kHz pure-tone stimuli, respectively (Figure 1). The mean hearing thresholds dropped significantly with age, with the mean difference being 5.7, 4.2, 6.5, and 10.9 dB peSPL with age at the respective frequencies (p , .03). Although statistically significant, the results were not clinically significant, with a maximum hearing loss of only 10.9 dB. Immunohistochemistry VEGF, Flt-1, and Flk-1 labeling was detected in the organ of Corti, spiral ganglia, and stria vascularis in both young and old SW mice. Figure 2 demonstrates strong labeling in both the stria vascularis and spiral ganglion cells in young SW mice with VEGF, Flt-1, and Flk-1 immunohistochemistry. Similar strong labeling was also seen in old SW mice (data not shown). The organ of Corti of young SW mice demonstrates strong labeling in all cell types, specifically inner and outer hair cells with their adjacent supporting cells (Figure 3). However, the outer hair cells appear to label more strongly than their adjacent support cells with VEGF, Flt-1, and Flk-1 antibodies. Similar labeling with

higher labeling intensity is also seen in representative organ of Corti sections taken from old SW mice (Figure 4). There was no significant difference in labeling of VEGF, Flt-1, and Flk-1 from base to apex in either the young or old SW mice (data not shown). Blood vessel counts showed an average of 5.55 vessels within the stria vascularis of the young mice and 6.36 vessels in the stria vascularis of the old mice. The difference was not statistically significant (p 5 .2). The mean percentage area of the stria vascularis was 9.69% in the young mice and 10.52% in the old mice. Again, the difference was not statistically significant (p 5 .4). Real-Time PCR Quantification Analysis of our data demonstrated no statistically significant differences (p . .05) in VEGF, Flt-1, and Flk-1 gene expression from basal and apical turns in both young and old SW mice (Figure 5). Overall, there were also no gene expression differences in VEGF, Flt-1, and Flk-1 between young and old SW mice (see Figure 5).

Discussion In our study, we demonstrate that the aged SW mouse maintains clinically normal hearing levels even at age 32 to 36 weeks. Our results show that both young and old SW mice maintain hearing thresholds between 25 and 30 dB peSPL with a mean high-frequency loss of only 10.9 dB peSPL. This is in contrast to c57BL/6J and other mice strains, which experience more rapid and severe high-frequency hearing loss at 32 to 36 weeks to thresholds as low as 120 dB peSPL.16 Therefore, the SW mice strain is an appropriate model for relative age-related hearing preservation.

Figure 1. Auditory brainstem response thresholds in young and aged Swiss Webster mice tested at 4, 8, 16, and 32 kHz. There was a statistically significant drop in hearing thresholds (p , .05) for each frequency tested, but these results are not clinically significant (maximum mean difference of 10.9 dB). Error bars represent standard deviation of the mean.

S40

Journal of Otolaryngology-Head & Neck Surgery, Volume 41, Number S1, 2012

Figure 2. A, Vascular endothelial growth factor (VEGF) labels strongly throughout the entire stria vascularis. Yellow arrows point to voids within the stria vascularis, which represent small capillaries. B, VEGF strongly labels the cytoplasm of each neuronal cell body (white arrow) as well as transversely cut axons. C, Flt-1 labeling is similar when compared to VEGF; the entire stria vascularis stains strongly. D, Spiral ganglion cells and axons also stain strongly with the Flt-1 antibody. E, Similar labeling with Flk1 in the stria vascularis when compared to Flt-1 and VEGF. Note the significant reduction in labeling within the remainder of the spiral ligament. F, Flk-1 labeling within the spiral ganglion cells is similar compared to Flt-1 and VEGF. White bar 5 10 microns.

Previous studies looking at immunohistochemical analysis of VEGF and its receptors in the animal cochlea used paraffin cochlear sections and biotinylated secondary antibodies. High-resolution imaging of specific cochlear

structures such as the organ of Corti, spiral ganglion, and stria vascularis was difficult to interpret due to poor cell morphology. This was a likely a direct artifact from the dehydration required in paraffin sectioning. As a result,

Figure 3. A, Vascular endothelial growth factor (VEGF) strongly labels in both inner hair cells (IHCs; yellow arrow) and outer hair cells (OHCs; white arrow). B, VEGF labeling is present but dramatically diminished in support cells (SCs; blue arrow). C, Flt-1 strongly labels in both IHCs (yellow arrow) and OHCs (white arrow). D, Flt-1 has similar labeling in SCs or (blue arrow) when compared to IHCs/OHCs. E, Flk-1 strongly labels in both IHCs (yellow arrow) and OHCs (white arrow). F, Flk-1 has slightly less labeling in SCs (blue arrow). White bar 5 10 microns.

Kandasamy et al, Presbycusis and VEGF

S41

Figure 4. A, Vascular endothelial growth factor (VEGF) strongly labels in both inner hair cells (IHCs) and outer hair cells (OHCs) but is dramatically diminished in support cells (SCs; white arrow). B, Flt-1 strongly labels in both IHCs and OHCs with similar labeling in SCs when compared to IHCs/OHCs. C, Flk-1 strongly labels in both IHCs and OHC, with slightly less labeling in SCs. White bar 5 10 microns.

labeling differences in specific cell populations within the organ of Corti have never been described. Our immunohistochemical analysis of SW mice using frozen sections showed expression of VEGF, Flt-1, and Flk-1 in the organ of Corti, stria vascularis, and spiral ganglion cells of the mouse cochlea. This is in agreement with previous studies involving other mice strains. The stria vascularis had a particularly strong expression of VEGF and its receptors. There did not appear to be any difference in expression of these molecules between the young and old mice. These findings correlate with our ABR data as there was no clinically significant decrease in hearing with age. In addition, expression was not different when comparing the apical and basal turns of all mice. Again, this correlates with the maintenance of hearing in the aged mice and lack of frequency-biased hearing loss as seen in c57BL/6J mice and in humans. Our tissue processing techniques also allowed for detailed evaluation of cell labeling within the cochlea, which showed increased expression of VEGF and its receptors within the inner and outer hair cells within the organ of Corti. We also found that expression within the support cells was less than

Figure 5. Real-time polymerase chain reaction quantification of expression levels of vascular endothelial growth factor (VEGF), Flt-1, and Flk-1 in the apical and basal turns of the cochlea of young and old Swiss Webster mice. No statistical difference was found in the expression levels of VEGF and its receptors within the cochlea and between the different age groups.

that in the hair cells, with the difference being more dramatic in the outer hair cells. This may point to a potentially important role for VEGF and its receptors in the hair cells of the cochlea, with less of a role in the support cells.

S42

Journal of Otolaryngology-Head & Neck Surgery, Volume 41, Number S1, 2012

To better quantify the expression of VEGF and its receptors, we used real-time PCR techniques. Real-time PCR allows precise quantification of gene expression. Previous studies looking at VEGF expression in the cochlea used Western blotting techniques, but quantification of protein expression using agarose gels is challenging and imprecise. Furthermore, no attempts have been made in the past to evaluate gene or protein expression on specific components of the cochlea (ie, basal or apical turns). Our quantification showed that expression of VEGF and its receptors was similar in both young and aged mice. There was also similar expression in the apical and basal turns of the cochlea. These results support our immunohistochemical findings. Given that declining function of the stria vascularis and changes in capillary density have been implicated in presbycusis, and the potential relationship between VEGF and angiogenesis within the cochlea, we looked at the numbers of blood vessels in our sections within the stria vascularis and the total area of the stria vascularis.4–7 We found no difference in both parameters. This suggests that preservation of the stria vascularis and vessel density within the mouse cochlea correlates with VEGF expression and may provide a protective role in age-related hearing loss. Our results demonstrate that the SW mouse maintains normal hearing with age and shows no change in expression of VEGF, Flt-1, and Flk-1. Although these results do not suggest a correlation between hearing levels and the expression of VEGF and its receptors, they allow for comparative studies with other mouse models to establish such a correlation. Using similar means of hearing threshold testing and gene expression evaluation by immunohistochemistry and quantitative PCR, SW mice can be compared to age-matched mice with age-related hearing loss (c57BL/6J) in a controlled manner to evaluate changes in expression of VEGF and its receptors. Changes in the expression of these genes in aged mice or differential expression in the apical and basal turns of the cochlea would provide compelling evidence to support an important role for VEGF in the pathogenesis of presbycusis. In part 2, we will evaluate that question.

Conclusion We demonstrated that VEGF and its receptors, Flt-1 and Flk-1, are found within the organ of Corti, stria vascularis, and spiral ganglion cells of the mouse cochlea. We also showed that the SW mouse is a model for hearing preservation in the aged mouse and that expression patterns of VEGF, Flt-1, and Flk-1 and the vessel density and surface area of the stria vascularis do not change with age. These

results provide valuable normalized data to assess VEGF expression patterns within other mouse strains.

Acknowledgement Financial disclosure of authors: This work was funded by a research grant from the Hearing Foundation of Canada. Financial disclosure of reviewers: None reported.

References 1.

2.

3. 4. 5.

6.

7.

8. 9.

10.

11.

12.

13.

14.

15. 16.

Davis A, Stephens D, Rayment A, Thomas K. Hearing impairments in middle age: the acceptability, benefit and cost of detection (ABCD). Br J Audiol 1997; 26:1–14, doi:10.3109/03005369209077866. Mulrow CD, Lichtenstein MJ. Screening for hearing impairment in the elderly: rationale and strategy. J Gen Intern Med 1991;6:249–58, doi:10.1007/BF02598971. Schuknecht HF. Further observations on the pathology of presbycusis. Arch Otolaryngol 1964;80:369–82, doi:10.1001/archotol.1964.00750040381003. Schuknecht HF, Gacek MR. Cochlear pathology in presbycusis. Ann Otol Rhinol Laryngol 1993;102:1–16. Saitoh Y, Hosokawa M, Shimada A, et al. Age-related cochlear degeneration in senescence-accelerated mouse. Neurobiol Aging 1995;16:129–36, doi:10.1016/0197-4580(94)00153-7. Gratton MA, Schmiedt RA, Schulte BA. Age-related decreases in endocochlear potential are associated with vascular abnormalities in the stria vascularis. Hear Res 1996;102:181–90, doi:10.1016/S0378-5955(96) 90017-9. Thomopoulos GN, Spicer SS, Gratton MA, Schulte BA. Age-related thickening of basement membrane in stria vascularis capillaries. Hear Res 1997;111:31–41, doi:10.1016/S0378-5955(97)00080-4. Breen EC. VEGF in biological control. J Cell Biochem 2007;1-2:1358–67, doi:10.1002/jcb.21579. Picciotti PM, Torsello A, Cantore I, et al. Expression of vascular endothelial growth factor and its receptors in the cochlea of various experimental animals. Acta Otolaryngol (Stockh) 2005;125:1152–7, doi:10.1080/ 00016480510044241. Michel O, Hess A, Bloch W, et al. Immunohistochemical detection of vascular endothelial growth factor (VEGF) and VEGF receptors Flt-1 and KDR/Flk-1 in the cochlea of guinea pigs. Hear Res 2001;155:175– 80, doi:10.1016/S0378-5955(01)00262-3. Picciotti PM, Fetoni AR, Paludetti G, et al. Vascular endothelial growth factor (VEGF) expression in noise-induced hearing loss. Hear Res 2006;214: 76–83, doi:10.1016/j.heares.2006.02.004. Selivanova O, Heinrich UR, Brieger J, et al. Fast alterations of vascular endothelial growth factor (VEGF) expression and that of its receptors (Flt-1, Flk-1 and neuropilin) in the cochlea of guinea pigs after moderate noise exposure. Eur Arch Otorhinolaryngol 2007;264:121–8, doi:10.1007/s00405006-0154-3. Shi X. Cochlear pericyte responses to acoustic trauma and the involvement of hypoxia-inducible factor-1alpha and vascular endothelial growth factor. Am J Pathol 2009;174:1692–704, doi:10.2353/ajpath.2009.080739. Picciotti P, Torsello A, Wolf FI, et al. Age-dependent modifications of expression level of VEGF and its receptors in the inner ear. Exp Gerontol 2004;39:1253–8, doi:10.1016/j.exger.2004.06.003. Schmittgen T, Livak K. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 2008;3:1101–8, doi:10.1038/nprot.2008.73. Zheng QY, Johnson KR, Erway LC. Assessment of hearing in 80 inbred strains of mice by ABR threshold analyses. Hear Res 1999;130:94–107, doi:10.1016/S0378-5955(99)00003-9.