Plant Mol Biol (2010) 73:169–179 DOI 10.1007/s11103-009-9596-5
Characterization, expression and function of DORMANCY ASSOCIATED MADS-BOX genes from leafy spurge David P. Horvath • Sibum Sung • Donghwan Kim Wun Chao • James Anderson
•
Received: 29 August 2009 / Accepted: 28 December 2009 / Published online: 13 January 2010 Ó U.S. Government 2010
Abstract DORMANCY ASSOCIATED MADS-BOX (DAM) genes are related to AGAMOUS-LIKE 24 and SHORT VEGETATIVE PHASE genes of arabidopsis and are differentially regulated coordinately with endodormancy induction and release in buds of several perennial plant species. DAM genes were first shown to directly impact endodormancy in peach where a deletion of a series of DAM resulted in loss of endodormancy induction. We have cloned and characterized several MADS box genes from the model perennial weed leafy spurge. Leafy spurge DAM genes are preferentially expressed in shoot tips and buds in response to cold temperatures and day length in a manner that is relative to the level of endodormancy induced by various environmental conditions. Over-expression of one DAM gene in arabidopsis delays flowering. Additionally, we show that at least one DAM gene is differentially regulated by chromatin remodeling. Comparisons of the DAM gene promoters between poplar and leafy spurge have identified several conserved sequences that may be important for their expression patterns in response to dormancy-inducing stimuli.
Electronic supplementary material The online version of this article (doi:10.1007/s11103-009-9596-5) contains supplementary material, which is available to authorized users. D. P. Horvath (&) W. Chao J. Anderson Biosciences Research Laboratory, USDA-ARS, Fargo, ND, USA e-mail:
[email protected] S. Sung D. Kim Section of Molecular Cell & Developmental Biology, School of Biological Sciences, Institute for Cellular and Molecular Biology, The University of Texas at Austin, Austin, TX, USA
Keywords Endodormancy MADS-box Phylogenetic footprinting Flowering
Introduction Leafy spurge (Euphorbia esula) is a deep rooted and invasive weed that has been developed as a model system for studying various aspects of herbaceous perennial biology and invasive weedy characteristics (Chao et al. 2005). We have developed an EST database containing more than 23,000 unique sequences from multiple tissues and growth conditions (Anderson et al. 2007), a 23K element cDNA microarray containing 19,000 unigenes from leafy spurge plus another 4,000 unigenes from cassava which generally cross hybridize with leafy spurge (Horvath et al. 2008), a 2-hybrid capable cDNA library, and a genomic library in Zap-express (Chao et al. 2005). A bacterial artificial chromosome library for leafy spurge is under construction, and a transformation system for leafy spurge is being optimized. The use of leafy spurge as a model system is only limited by its moderately large haploid genome (2,069 Mbp), and the fact that it is an auto-allo hexaploid which can complicate allele and gene family member analyses (Chao et al. 2005). Leafy spurge maintains a perennial lifecycle by producing and maintaining a large number of adventitious buds on the lateral roots and underground stem (or crown) (Chao and Anderson 2004). The large number of well defined shoot buds and excellent genomic resources has made leafy spurge an ideal system for studying adventitious bud development and growth. Leafy spurge buds are capable of transitioning through the three characteristic phases of dormancy described by Lang (1987). Lang defined these dormancy states as (1) paradormancy—also
123
170
known as correlative inhibition or apical dominancy, where signals from the shoot apices or other organs inhibit bud growth during the growing season, (2) endodormancy— also known as innate or seasonal dormancy where signals with the bud itself prevent normal shoot growth and development even under growth-conducive conditions, and (3) ecodormancy—where non-growth-conducive conditions such as low temperature or lack of water inhibit bud growth. Underground buds of leafy spurge, once formed, are maintained in a paradormant state through the growing season (Horvath 1998). Several studies have shown that paradormancy in leafy spurge is controlled both by auxin signaling from the above-ground growing shoot in a manner that appears to be akin to the processes controlling apical dominance in many plant species (Horvath 1998, 1999; Horvath et al. 2002). Additionally, a second signal prevents underground bud growth. This second signal appears to be sugar which negatively impacts gibberellic acid signaling and limits bud growth by preventing the G1 to S phase transition of the cell cycle (Chao et al. 2006; Horvath et al. 2002). In autumn, underground buds undergo the transition from paradormancy to endodormancy (Anderson et al. 2005). The primary signal coordinating this transition appears to be cold temperatures, with day length playing only a minimal role (Foley et al. 2009). Interestingly, perception of conditions that induce endodormancy also alters the competency of the plants to perceive extended cold temperatures required for vernalization (Foley et al. 2009). In field grown plants in Fargo ND, leafy spurge buds transition from endodormancy in October or early November to a flowering competent but ecodormant state by late November or early December (Anderson et al. 2005). These seasonal transitions through dormancy states in leafy spurge buds are associated with numerous changes in gene expression (Horvath et al. 2008). One notable change in gene expression is the induction of a series of DORMANCY ASSOCIATED MADS-BOX (DAM) genes (Horvath et al. 2008). DAM genes are MIKCc-type MADS-box genes of the StMADS11 clade which includes floral regulators such as SHORT VEGETATIVE PHASE (SVP) and AGAMOUSLIKE 24 (AGL24) of arabidopsis (Arabidopsis thaliana), JOINTLESS of tomato (Lycopersicon esculentum), and ZMMAD2 of maize (Zea mays) (Becker and Theissen 2003). DAM genes were first associated with endodormancy following the cloning of the EVERGROWING locus in peach (Prunus persica). Mutations in this locus were shown to prevent terminal buds of peach from going endodormant in autumn (Diaz 1974). Subsequent map-based cloning of this locus indicated it was caused by a large deletion that included a series of 6 tandomly repeated DAM genes along
123
Plant Mol Biol (2010) 73:169–179
with 13 other genes (Bielenberg et al. 2004, 2008). Of these 19 genes, only the DAM genes were shown to be differentially expressed between mutant and wild type peach (Bielenberg et al. 2008). Subsequently, DAM genes were identified in several screens for genes that are differentially expressed during endodormancy induction and release (Horvath et al. 2008; Mazzitelli et al. 2007; Yamane et al. 2008). As noted above, DAM genes are related to two different transcription factors previously associated with flowering regulation in the winter annual arabidopsis. These genes, SVP and AGL24 have opposite effects on flowering, with SVP inhibiting flowering, through negative regulation of the floral regulatory genes FLOWERING LOCUS T (FT) and AGL24 through positive regulation of LEAFY (LFY) (Hartmann et al. 2000; Lee et al. 2007, 2008; Michaels et al. 2003). Interestingly, over-expression of FT in poplar prevents short day-induced growth cessation which is the first step in endodormancy induction (Bohlenius et al. 2006), and transgenic plants over-expressing PHYTOCHROME A (PHYA) have elevated levels of FT and a related gene CENTRORADIALIS-LIKE 1 (CENL1) and fail to enter endodormancy per se following extended periods of short day conditions (Ruonala et al. 2008). SVP is negatively regulated by the circadian regulatory proteins CIRCADIAN CLOCK–ASSOCIATED1 (CCA1) and LATE ELONGATED HYPOCOTYL (LHY) (Fujiwara et al. 2008). Analysis of publicly available arabidopsis microarray data also shows that SVP is up-regulated under short day conditions. In this paper, we describe the cloning and analysis of several cDNA and genomic clones of DAM genes from leafy spurge. Expression analysis of leafy spurge DAM genes indicates tissue specificity and correlation of expression with endodormancy-inducing conditions. Comparisons of promoter sequences between DAM genes of leafy spurge and poplar reveal several conserved elements consistent with the expression patterns of these genes. The analysis of histone modifications at DAM1 chromatin indicated that DAM genes are regulated, at least in part, by the mechanism similar to the vernalization—mediated FLOWERING LOCUS C (FLC) repression. Finally, over-expression of a DAM gene in arabidopsis has a negative impact on flowering and growth.
Materials and methods Plant material Leafy spurge plants were propagated vegetatively through shoot cuttings, potted in sunshine mix (Fisons Horticulture Inc. Bellview WA, USA), and grown as single stems in No. 1 Ray Leach Cone-tainers (Stuewe and Sons Inc. Corvallis,
Plant Mol Biol (2010) 73:169–179
OR, USA) under greenhouse conditions (16 h day with natural and supplemental lighting with average day and night temperatures at *25°C). When plants were 3 months old, they were moved to growth chambers and various temperature and light regimes were imposed for 6 weeks. The aerial portion of the plant was removed and the plants were placed back in the greenhouse where regrowth was monitored and from which crown bud samples were collected for further analysis. For drought stress, water was withheld from greenhouse-grown plants until they appeared wilted (between 5 and 7 days). For cold stress, plants were placed in growth chamber under a 12 h day at 11°C constant temperatures for 5–7 days. Shoot tips including un-expanded leaves were removed and frozen in liquid N2 for analysis. Arabidopsis were transformed with a construct containing DAM1 under control of the CAMV promoter in pBI121. Independent transgenic lines were confirmed by PCR, and T3 families were screened by PCR to identify homozygous lines. Both wild and transgenic arabidopsis plants were propagated from seed in pots containing sunshine mix overlaid with fine vermiculite. Seeds were stratified for 2 days and then placed in a growth chamber under 16 h day 20°C conditions. Growth and flowering were monitored.
171
primarily by dormancy inducing short day conditions in poplar whereas the other DAM gene family members were responsive to other environmental stimuli that were not associated with endodormancy induction. Genomic sequences of these poplar DAM gene promoters were obtained from the poplar genome database. Phylogenetic footprinting was done both manually and using various motif finding programs. Expression and southern hybridization analysis RNA or DNA of leafy spurge was collected and separated on agarose gels (denaturing gels were used for northern analysis). Blots were hybridized with P32 labeled gene specific probes derived from the 30 portions of either DAM1 or DAM2 or the 50 coding region which is common between both genes. For Real-Time PCR, RNA from rosettes of wild type and transgenic arabidopsis collected 2 weeks after germination was reverse transcribed. Primers designed for arabidopsis FT (Forward TTCCAAGTCCTAGCAACCCT CACC, Reverse CTTCCTCCGCAGCCACTCTCC) were used in triplicate to follow FT expression levels. Primers designed for ACTIN2 (Forward TTGTTCCAGCCCTCGT TTGTG, Reverse CCTTAATCTTCATGCTGCTTGGTG) were used as an internal control as previously described for analysis of FT in arabidopsis (Kotake et al. 2003).
Cloning and analysis of cDNA and genomic DAM genes
Chromatin immunoprecipitation analysis
Two cDNAs encoding DAM1 were identified in the leafy spurge EST database following microarray analysis (Horvath et al. 2008). Full length probes derived from these sequences were used to screen both cDNA and genomic libraries. Likewise, primers (Forward CCCAACCTTCTTC TGCTTTG, Reverse GCCTTCAGAGATCTAGCCGC) derived from these initial sequences were also used to amplify cDNAs from reverse transcribed crown bud RNA. Three full length cDNAs were identified from our library and sequenced. Two genomic clones were also identified and sequenced. Probes were designed from the 50 sequences of the cDNA for DAM1 and used again to probe the genomic library. The resulting clone was sequenced and found to be contiguous with both of the genomic clones initially identified. Subsequent BlastN searches of the leafy spurge EST data base identified two additional partial cDNA clones that likely contain portions of related DAM genes. BlastX searches using leafy spurge DAM1 and DAM2 sequences indicated that of the poplar DAM genes, MADS 27–29 were most similar to DAM1 and 2 based on amino acid sequence similarity. Additionally, expression data (Chen 2008), indicated that these genes were up-regulated
Ecodormant and endodormant bud tissues of leafy spurge were immersed in formaldehyde solution (0.4 M sucrose, 10 mM Tris–Cl [pH 8.0], 1 mM EDTA, 1 mM PMSF, 1% formaldehyde) under vacuum for 30 min. Glycine (final concentration as 0.1 M) was added, and incubation was continued for an additional 5 min. The bud tissues were then washed and frozen with liquid nitrogen. Approximately 0.3 g of buds was ground for each immunoprecipitation and was resuspended in 1 ml nuclei isolation buffer (0.4 M sucrose, 5 mM MgCl2, 15 mM PIPES [pH 6.8], 180 mM KCl, 1% Triton X-100, 0.1 mM PMSF, protease inhibitor 1 tablet) and incubated on ice for 15 min. Samples were centrifuged at 14,500 rpm at 4°C for 10 min and the pellets were resuspended in lysis buffer (50 mM HEPES [pH 7.5], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% deoxycholate, 0.1% SDS, 1 mM PMSF, protease inhibitor 1 tablet). DNAs were sheared by sonication to approximately 500–1,000 bp fragments. After centrifugation, the supernatants were pre-cleared with 60 ll Protein A agarose for 1 h at 4°C. After 2 min of centrifugation at 3,000 rpm, the supernatants were transferred to a siliconized tube, and 10 ll of the appropriate antibody was added [anti-trimethyl-histone H3 (Lys4)
123
172
Plant Mol Biol (2010) 73:169–179
#ab8580 and anti-trimethyl-histone H3 (Lys27) #ab6002 from Abcam Inc. Cambridge, MA, USA]. After incubation overnight with rotation, 60 ll Protein A agarose was added and incubation continued for 2 h. The agarose beads were then washed with 1 ml each of the following: 2 9 lysis buffer, 1 9 LNDET buffer (0.25 M LiCl, 1% NP40, 1% deoxycholate, 1 mM EDTA, 10 mM Tris–Cl [pH 8.0], and 2 9 TE buffer (10 mM Tris–Cl [pH 8.0], 1 mM EDTA). The immuno-complexes were eluted from the beads with 300 ll Elution buffer (1% SDS, 0.1 M NaHCO3). A total of 10 ll 5 M NaCl was then added to each tube, and crosslinks were reversed by incubation at 65°C for at least 6 h. Residual protein was degraded by the addition of 20 lg Proteinase K (in 10 mM EDTA and 40 mM Tris–Cl [pH 8.0]) at 45°C for 1 h. DNAs were purified using the Qiaquick PCR purification kit (Qiagen, Germany) and finally resuspended in 50 ll TE. Approximately 1–2 ll was used for each PCR reaction. Primers (Table 1) specific to various regions of the DAM gene or to control sequences were used to amplify the immunoprecipitated DNA. Measurement of flowering time in arabidopsis Two methods were used to measure flowering time. The initial method measured the time to bolting as a function of average bolt height during flower initiation. Two independent transgenic lines carrying the DAM1 cDNA driven by the CAMV promoter in pBI131 along with the wild type line used to create the transgenic plants. One week after sowing, wild type and transgenic arabidopsis (Columbia) plants were thinned to 10 plants per 150 mm pots with two pots per genotype for each of three independent experiments. When 50% of the wild type plants had bolts of at least 10 mm in height, measuring of all bolt heights and flowering was recorded for each plant daily. For the second measurement of flowering time, wild type arabidopsis and one of the transgenic lines were planted in 75 mm pots and then thinned to one plant per pot 1 week after sowing. Twenty each wild type and transgenic plants were randomly mixed in two separate trays in the growth chamber. Counts of rosette and cauline leafs were made after 1 week, 2 weeks, and then daily until the first flower appeared.
Results Analysis of genomic and cDNA clones of leafy spurge DAM genes identifies a multigene family with alternate splicing Microarray analysis identified a DAM gene as differentially regulated during transitions from paradormancy through ecodormancy in leafy spurge. The EST associated with this DAM gene was 532 bp and contained a complete open reading frame of only 207 bp which is significantly smaller than most similar genes from other species. This gene was named DAM1. Screening a genomic library with a DAM1 probe identified several clones which formed a contig that covered the entire DAM1 reading frame plus several thousand bases of putative promoter sequence (Fig. 1). Comparisons between the DAM1 cDNA and the DAM1 genomic contig suggested that the DAM1 gene possessed two short introns within its 50 UTR, and a large intron following the likely DNA binding domain of the protein encoded by DAM1. The putative promoter was subsequently delineated based on sequences of the 50 end of several DAM1 cDNAs identified using 50 RACE which confirmed the putative TATA box sequence at bp -675 in leafy spurge DAM promoter 1. However, 50 RACE experiments also indicated that the TATA box located at bp -202 was also functional (data not shown). Northern analysis suggested that, along with DAM1, several larger transcripts with similar sequences were also expressed in leafy spurge (Horvath et al. 2008). PCR with gene specific primers designed from the DAM1 gene amplified one additional DAM cDNA (DAM1a) with nearly identical coding sequences but with only one of the likely two 50 UTR introns removed (Fig. 1). It is unknown if this gene is a splice variant, allele, or homeologue of DAM1, or a very closely related gene family member. The leafy spurge cDNA library from which the ESTs were derived was also screened by hybridization to the DAM1 gene and two additional DAM genes were identified (DAM2 and DAM3). All 4 DAM cDNAs have nearly identical sequences in the first coding exon. However DAM2 contained an open reading frame of 663 bases more typical of DAM
Genomic clones 1-4
hypothetical DAM1 contig From clones 1-4 cDNAs
Dam1a Dam1
Fig. 1 Diagram of the DAM1 gene as derived from genomic and cDNA clones. Heavy dark lines indicate coding sequences, lighter dark lines indicate 50 and 30 UTR sequences and thin lines indicate introns and promoter sequence. The arrow indicates the likely start of transcription
123
Plant Mol Biol (2010) 73:169–179
genes from other species, but had sequence variation within the 50 UTR that could not easily be explained by differential splicing of a DAM1 allele (supplemental Fig. 1). DAM3 contained an unusually long 50 UTR which had regions of similarity with both DAM1 and DAM2, but which also could not be easily explained by differential splicing of either of these two genes. However, sequences between the stop codon and the poly A tail of DAM3 are identical to predicted sequences within the third intron of DAM1 suggesting both that DAM3 likely represents a transcript that has run into the 3rd intron before terminating, and that there is considerable homology even within the non-coding regions of distinct DAM gene family members. To gather more information on the number of DAM gene family members, a Southern blot was hybridized to a short gene specific probe made from the 30 end of DAM. This fragment did not span any known introns and did not contain restriction sites for the enzymes used. Likewise a duplicate Southern blot was hybridized to a probe specific for the 30 end of the DAM2 gene which might or might not span introns and may include restriction sites for the enzymes used. Both hybridizations showed multiple bands that hybridize with varying intensities (Fig. 2). Thus, as observed in other species, DAM genes of leafy spurge are encoded by a small gene family containing a minimum of 5 DAM1-like genes and probably more DAM2-like genes.
173
Phylogenic footprinting identifies likely regulatory sequences in DAM promoters of leafy spurge and poplar Three tandomly repeated poplar DAM genes share considerable similarity with the cloned DAM genes of leafy spurge. The poplar DAM genes have been named MADS27–29 (Leseberg et al. 2006). Putative promoter and 50 UTR sequences (2,865 bp) for these three poplar DAM genes were compared to the two cloned promoters for DAM genes of leafy spurge both manually and using various programs such as the Gibbs Motif Sampler (http://bayesweb.wads worth.org/gibbs/gibbs.html) that identify short conserved sequences. These analyses helped identify several transacting binding sites that appear to be conserved between the poplar and leafy spurge DAM genes (supplemental Fig. 2). Perhaps the most obvious was a putative EVENING element binding site present in three out of the five promoters. Additionally, putative C-repeat/DRE-Binding Factor (CBF) sites were found in both leafy spurge DAM promoters, and one in the MADS27 promoter. However, the CBF binding site was found within the 1st 2,000 bases of the start of translation in only the DAM promoters of leafy spurge and not in the poplar MADS27–29 promoters. Several other similar sequences include a 26 base motif TTGCTKGCTA TRRRAWWCTTYTTYTT (green box in supplemental Fig. 2) which is found between 900 and 1,500 bases from the start codon in all 5 promoters, an ATTKYCCTCT (red box) sequence that is often present in two or more copies within the 1st 1,000 bases and often within the likely 50 UTR, and a RRAAGKMCTTMY (pink box) sequence found within the 1st 500 bases in the poplar DAM promoters, but between 1,400 and 1,800 in the leafy spurge promoters. None of these conserved elements appear to be similar to sequences previously described as cis-acting regulatory sequences as defined in the PLACE database (http://www.dna.affrc. go.jp/PLACE/index.html).
DAM genes are preferentially expressed in meristems and buds and induced by cold
Fig. 2 Southern blot analysis of DAM1. Genomic DNA was digested with EcoRI, BamHI, or HindIII, separated on a 1% agarose gel and blotted. The resulting blot was hybridized to either a DAM2 (DAM2 30 ) or a DAM1 specific probe (DAM1 30 ). A size standard is indicated on the right
DAM genes from apricot show varying levels of tissue specificity, and poplar DAM genes are responsive to differing light conditions (Li et al. 2009; Ruttink et al. 2007). Northern analysis using a probe which would likely hybridize to all known leafy spurge DAM genes was done to ascertain tissue specificity and environmental regulation of the leafy spurge DAM genes (Fig. 3). DAM1 appears to be induced preferentially in cold treated meristems (CSA) and buds that are endodormant (Oct). DAM2 is preferentially expressed in cold treated meristems (CSA) and ecodormant buds (Feb). No hybridization was detected in
123
174
Plant Mol Biol (2010) 73:169–179
Fig. 3 Northern blot of various tissues collected at different times during the year or following different treatments. Apr, Oct, Feb— crown buds collected in April, October or February respectively, DS—dry seed, R, S, L—roots, stems and leaves (respectively) from control plants, SA—shoot apices including meristem and immature leaves, DSA—drought stressed shoot apices, CSA—cold treated shoot apices. Blot was probed with sequences from the 1st exon which is common between DAM1 and DAM2-like genes
any tissue using a DAM3-specific probe. No DAM genes were detected at this level of sensitivity in non-meristematic tissues, dormant or germinating seeds, or drought stressed meristems. DAM1 shows altered histone modifications following transition from endodormancy to ecodormancy There are similarities between vernalization and dormancy regulation Chouard 1960; Horvath et al. 2003). These have led to the hypothesis that similar molecular mechanisms may regulate both processes. Indeed, like FLC in arabidopsis, leafy spurge DAM1 is down-regulated following extended cold treatments experienced by leafy spurge between October and December (Fig. 4). In arabidopsis, vernalization results in an increase in repressive histone modifications, including trimethylated H3K27 (H3K27 triMe) and a decrease in active histone modifications, including trimethylated H3K4 (H3K4triMe) (Sung and Amasino 2005). Furthermore, H3K27triMe histones are generally associated with repressed genes that are developmentally regulated (Zhang et al. 2007). In contrast, H3K4triMe histones are generally associated with the chromatin commonly found in genes that are actively transcribed. Thus we examined enrichment of H3K4triMe and H3K27triMe (IP) at three different regions within the DAM1 promoter (P1-3) and two regions in the transcribed sequences (P4 and P5) using chromatin immunoprecipitation in endodormant (Oct) and ecodormant (Dec) buds. Non-immunoprecipitated DNA was used as a control (input). In endodormant when DAM1 is most highly expressed as compared to ecodormant buds, chromatin was enriched with H3K4triMe in regions 30 to the start of transcription (Fig. 4, regions P4 and 5). Minimal enrichment in H3K4triMe histones was observed in regions 50 to
123
Fig. 4 Chromatin immunoprecipitation (ChIP) analysis of the DAM1 promoter using antibodies specific for H3K4triMe or H3K27triMe from crown buds collected in either Oct, when DAM1 expression peaks (see inset), or in Dec, when DAM1 expression has fallen. The enrichment of 5 different regions of the DAM promoter (as noted in green) was detected by semi-quantitative PCR. ?1 marks the putative start of transcription
the start of transcription. The P4 region of the promoter which is approximately 20 bp 30 to the transcription start site was enriched with H3K27triMe in ecodormant buds as DAM1 expression decreases. Surprisingly, regions P2 and P3 appear to show a decrease in the level of H3K27triMe histones during the same time. These same regions are not precipitated at all with antibodies that interact with H3K4triMe histones. Likewise, the region of DAM1 covering the start of translation (P5), show no decrease in the level of H3K27triMe histones as the buds reduce expression of DAM1 between October and December. These discrepancies may be explained by the presence of duplicate DAM1-like genes as shown in Fig. 2. Indeed, a DAM1specific probe was previously shown to hybridize to a larger RNA that was more highly expressed in December than in October (Horvath et al. 2008). DAM2 gene expression correlates with endodormancy induction in leafy spurge DAM2 gene expression was highest under long day cold conditions, second highest under short day cold, third highest under short day warm, and undetectable under long day warm conditions. No DAM1 gene expression was detected in these experiments, but a four fold increase in expression of DAM1 was detectable by real-time PCR— interestingly with peak expression under short photoperiod cold conditions (data not shown). The level of
Plant Mol Biol (2010) 73:169–179 Table 1 List of primers used for RT–PCR following chromatin immunoprecipitation analysis
175
ChIP primer name
Nucleotide sequence
Size (bp)
DAM1-P1-F
TGTTAATCTCTGACACACCTCCTCA
255
DAM1-P1-R
CACAACCTACCTTTAGTTATTGTCAAAG
DAM1-P2-F
CTCGAATGTCATCTATTGAGCTAAAAGG
DAM1-P2-R
CTACTTTTCCTAATTGGAAATAAATTAAAGAGA
DAM1-P3-F
GTATTGCCCTCTCTTTTTGCCAAC
DAM1-P3-R
CTCGGGAGCTACTTTATTATTATCTCTCT
DAM1-P4-F
CGATCTTGAATTGGCATTTGTCTAGTC
DAM1-P4-R
GGAGATGCAAAGAAAGATCCAGCC
DAM1-P5-F
GTGATTTTTGCTGGAAAGAGTTGAAG
DAM1-P5-R
CCAGTTGCAGAAAAAACTATCAGAGC
UBQ-F
ACCCTAACTGGCAAGACTATCACTCTCG
UBQ-R
GGTGAAGAGTGGACTCCTTCTGGATG
Retro-F
CCAAATCTTCTATAGTTTGCAAGCTCA
Retro-R
GGCTATAGTCAGACCTAGACTGATG
endodormancy, (measured as a delay in shoot growth as indicated by average shoot height over time) in plants following similar treatments were done to determine if DAM2 gene expression correlated with regrowth potential of crown buds. The results clearly indicate that conditions that induced the highest DAM2 gene expression were the most dormant (Fig. 5). However, there was no significant difference in the regrowth between plants treated with short day cold or short day warm, although the plants grown under short day cold tended to regrow slower than the short day warm treated plants. However both of these treatments had significantly slower regrowth than the plants grown under long day warm conditions.
Fig. 5 Regrowth of shoots from leafy spurge following 6 weeks under various conditions known to alter DAM2 expression (see inset). LW—long day (13 h) warm (25°C constant temp), SC—short day (11 h), cold night (10°C), SW—short day (11 h), warm (25°C constant temp), LC—long day (13 h), cold dusk to dawn (10°C night plus 1 h after light and 1 h before dark). Inset shows DAM2 expression levels. Error bars are standard error from three independent experiments
220 221 213 208 187 132
Over-expression of DAM1 in arabidopsis inhibits flowering and suppresses FT expression We hypothesized that DAM genes impact dormancy by repressing FT or FT-like genes (Horvath et al. 2008). Thus we would expect that over-expression of DAM genes might inhibit flowering through the repression of FT or FT-like genes. To test this hypothesis, we placed DAM1 under the control of the CAMV promoter in pBI121 and transformed this construct into arabidopsis. Flowering and bolt growth of transgenic plants were compared to non-transgenic arabidopsis. Results indicated that over-expression of DAM1 resulted in plants that consistently initiated bolting and flowering about 1 day later than wild type. This delayed bolting and flowering was evident by an increased leaf number at the time of flowering and a significantly shorter average bolt height for transgenic plants (Fig. 6a–c). However, the slope of the bolt growth rate in the transgenic was not significantly different between transgenic and wild type plants (data not shown). Because it has been hypothesized that DAM acts by suppressing FT expression (Horvath et al. 2008) we analyzed the level of FT expression in the transgenic arabidopsis (Fig. 7). FT levels are 2–3 fold lower in the transgenic lines than they are in the wild type.
Discussion DAM genes form a small gene family in leafy spurge DAM genes are organized into a small gene family and have been associated with regulation of dormancy through expression studies and mutation analysis in several tree
123
176
Fig. 6 a Average bolt height (from a total of 20 plants with 10 each in 2 separate pots) of two different transgenic lines over-expressing leafy spurge DAM1 (T-A and T-B) and non-transgenic wild type (WT). b Average days to flowering in plants used for bolt height measurements. c Average leaf number (including rosette and cauline
Fig. 7 Real time-PCR analysis of FT expression levels in arabidopsis. FT levels were determined in wild type and two independent transgenic lines expressing DAM1 from leafy spurge. FT expression levels were normalized to ACTIN2 as an endogenous control gene
species (Bielenberg et al. 2004; Horvath et al. 2008; Mazzitelli et al. 2007; Yamane et al. 2008). Here, we report that DAM genes of leafy spurge are also organized into a small gene family and are associated with dormancy transitions in this model herbaceous perennial species as well. However, the number of different DAM genes detected by the gene specific probes was lower than expected for leafy
123
Plant Mol Biol (2010) 73:169–179
leaves) at time of flowering—note that there were significant differences in wild type leaf number between experiments comparing the two different transgenic lines and thus the wild type leaf numbers could not be combined and are reported separately. Error bars indicate standard error
spurge which is an auto-allo hexaploid (Schulzschaeffer and Gerhardt 1989). There are at least seven DAM-like genes in poplar and at least six in peach. Given the genetic makeup of leafy spurge, we expected in excess of 15 bands. The fact that we could only detect 5–10 strongly hybridizing bands suggests that there might be fewer DAM genes in leafy spurge than in poplar and peach, or that other leafy spurge DAM genes have differentiated to the point where they will not readily hybridize to the probes used. However, this data along with the comparisons between the cDNA and genomic sequences of the various DAM genes strongly suggest multiple DAM genes exist in leafy spurge. Cloning of DAM genes from a large insert library will be needed to determine if DAM genes in leafy spurge are organized in clusters as they appear to be in poplar and peach. Analysis of the DAM1 cDNA sequences support the hypothesis that alternate splicing occurs in this gene family, particularly within the 50 UTR region. Alternate splicing of the 50 UTR of floral-regulating MADS-box genes of Citrus ssp. has recently been reported (Zhang et al. 2009). Interestingly, in the case of citrus, specific splice
Plant Mol Biol (2010) 73:169–179
variants were associated with transition from juvenile to mature trees. Leafy spurge does not appear to have a significant juvenile phase as our unpublished observations show that seeds are capable of producing flowering plants within the first growing season. Promoter analysis and regulation Phylogenetic foot-printing (Gumucio et al. 1992) identified several potential regulatory sequences in the 50 non-coding regions of DAM genes from poplar and leafy spurge. The only sequence previously associated with a known function that was conserved between the promoters was a potential EVENING element. EVENING elements serve as binding sites for the circadian regulated MYB transcription factors CCA1/LHY1. CCA1/LHY1 are preferentially expressed in the morning (Alabadi et al. 2001), and binding to EVENING elements by these proteins leads to morning repression and evening expression. Thus, if these conserved EVENING elements in the DAM promoters of poplar and leafy spurge are functional, it would be expected that DAM genes would be induced preferentially in the afternoon. However, attempts to confirm this pattern of expression were inconclusive (data not shown). Among the other potential regulatory elements is a fairly long sequence (TTGCTKGCTATRRRAWWCTTYTTYTT) that is not only conserved in sequence, but also is found in similar proximity to the putative TATA box in multiple DAM gene promoters of leafy spurge and poplar. Thus, it seems likely that this conserved sequence plays some direct role in regulating the expression of these genes in response to dormancy transitions. However, considerable work is needed to test the hypothesis that these conserved sequences actually play a functional role in regulating DAM gene expression. The fact that DAM1 appears to be regulated, at least in part, by chromatin modifications supports earlier hypotheses concerning the role of chromatin remodeling in regulation of dormancy transitions (Horvath et al. 2003). Control of other environmentally regulated MADS-box genes by chromatin remodeling is well established. The most-well characterized of these is FLC. Studies have identified numerous genes involved in repression of FLC by long-term cold conditions. Interestingly, DAM1 and FLC share expression patterns in that long term cold causes chromatin remodeling and repress gene expression. It should be noted however, that DAM2 appears to have a very different pattern of expression in that it is preferentially expressed after long term cold treatment, which would result in the repression of DAM1 and a transition from endo- to ecodormancy. It will be interesting to clone promoters of DAM2-like genes to determine differences in both promoter sequences and potential sites of chromatin
177
remodeling that may play a role in their unique expression pattern. We were unable to detect significant expression of DAM genes in non-meristematic tissue of leafy spurge even under normally DAM gene-inducing low temperature conditions. This contrasts with peach in which DAM gene expression was observed in leaf tissue as well (Li et al. 2009). This discrepancy might be due to the detection methods used, as RT–PCR is likely to be much more sensitive than northern analysis. However, if that is indeed the case, clearly DAM gene expression levels are significantly greater in meristematic tissue than in other tissues. Additionally, it is clear that DAM gene expression is not just associated with dormancy per se as no expression was detected in dry seeds. Surprisingly, given the likelihood that DAM genes are regulated at least in part through the action of CBF transcription factors, no detectable DAM gene expression was observed in drought stressed meristems. Since both drought stress and cold activate many but not all genes in the CBF regulon (Shinozaki and Yamaguchi-Shinozaki 2000), this observation suggests that DAM genes are specifically responsive to the cold-stress regulating CBF proteins. One CBF-like gene, similar to At2g35700, was noted to be induced during endodormancy in leafy spurge (Horvath et al. 2008). Its expression coincided with the induction of DAM1 but not induction of DAM2. Thus, it is tempting to speculate that this particular transcription factor plays a role in regulating DAM1. The expression of DAM2 in meristems following 5–7 days of cold stress was inconsistent with the observation that DAM2 expression was only observed following long term cold in crown buds. This discrepancy could mean that there is differential control of DAM2 expression between the growing shoot apices and non-growing crown buds. However in the initial experiments, crown buds were sampled monthly. Thus it is also possible that DAM2 expression could have been transiently induced following the initial drop in temperature under natural conditions that was missed during the sampling regime. Further experiments are needed to precisely determine the temporal and environmental parameters of the various DAM gene induction processes in buds and shoot tips. In poplar, DAM genes are preferentially expressed in response to short day length (Ruttink et al. 2007). Likewise, short day lengths are the primary signal regulating endodormancy induction in poplar. In leafy spurge, low temperatures preferentially induced endodormancy (Foley et al. 2009). Likewise DAM2 genes of leafy spurge are preferentially expressed in plants placed in low night temperatures. However, DAM2 gene expression was slightly induced by short day lengths as well, and the depth of endodormancy was similar between plants placed in short days alone or those that were placed in short days and
123
178
low night temperatures. This suggests that leafy spurge is capable of entering endodormancy in response to short day length alone. Surprisingly, maximum expression of DAM2 genes in leafy spurge occurred under long day conditions where low night temperatures were maintained several hours following dawn and preceding dusk. In support of a role for DAM genes in dormancy induction in leafy spurge, the level of DAM2 gene expression corresponded quite well with the depth of endodormancy caused by these various treatments.
Plant Mol Biol (2010) 73:169–179
then inhibition of flowering would be expected. Indeed, not only was flowering inhibited in arabidopsis lines expressing DAM1, but FT levels in these transgenic lines was also significantly repressed. Further work will be required to demonstrate direct interaction or regulatory relationships of DAM proteins with genes similar to FT in leafy spurge or other perennials. Acknowledgments I would like to thank Laura Kelly for significant technical assistance with these experiments and Dr. Marion Wood for her helpful commentary on this manuscript.
DAM gene expression correlates with dormancy and flowering The expression of DAM2 genes was highest under long day/cold evening-night-morning conditions, and DAM1 expression is highest in outdoor-grown endodormant buds. Less DAM gene expression was detected under both short day/cold night and the least under short day/warm conditions. No DAM gene expression was detected under long day/warm. Likewise, long day/cold night treatments induced the deepest dormancy in the crown buds of leafy spurge. No significant difference between the depth of dormancy was observed when short day/cold night treatments were compared to short day/warm treatments. This observation suggests that cold temperatures experienced during light both induce the highest level of DAM gene expression as well as induce the deepest endodormancy. This result compares well with previous experiments that indicated cold temperatures were more important than day length in inducing both endodormancy and floral competence in leafy spurge (Foley et al. 2009). However, contrary to previous results of Foley et al., our results also indicate that short day alone can induce some level of endodormancy in leafy spurge. This discrepancy might be due to the fact that in previous experiments, plants were subjected to gradual shortening of day lengths for a 3 month period, while in this study plants were subjected to 6 weeks with consistent conditions throughout. Over-expression of the leafy spurge DAM1 in transgenic arabidopsis consistently delayed flowering by approximately 1 day (2 leaves) relative to wild-type. Although the delay is not substantial, it was significant. Because DAM genes are similar to both SVP and AGL24, two MADS-box transcription factors that respectively negatively and positively regulate flowering in arabidopsis, it was unknown if DAM genes would increase or decrease flowering time. However, FT is known to negatively impact seasonal growth cessation that precedes endodormancy induction (Bohlenius et al. 2006), and SVP acts to inhibit FT expression (Lee et al. 2007). If DAM gene expression during endodormancy induction is required for inhibition of FT expression as hypothesized (Horvath et al. 2008),
123
References Alabadi D, Oyama T, Yanovsky MJ, Harmon FG, Mas P, Kay SA (2001) Reciprocal regulation between TOC1 and LHY/CCA1 within the Arabidopsis circadian clock. Science 293:880–883 Anderson JV, Gesch RW, Jia Y, Chao WS, Horvath DP (2005) Seasonal shifts in dormancy status, carbohydrate metabolism, and related gene expression in crown buds of leafy spurge. Plant Cell Environ 28:1567–1578 Anderson JV, Horvath DP, Chao WS, Foley ME, Hernandez AG, Thimmapuram J, Liu L, Gong GL, Band M, Kim R, Mikel MA (2007) Characterization of an EST database for the perennial weed leafy spurge: an important resource for weed biology research. Weed Sci 55:193–203 Becker A, Theissen G (2003) The major clades of MADS-box genes and their role in the development and evolution of flowering plants. Mol Phylogenet Evol 29:464–489 Bielenberg DG, Wang Y, Fan S, Reighard GL, Scorza R, Abbott AG (2004) A deletion affecting several gene candidates is present in the evergrowing peach mutant. J Hered 95:436–444 Bielenberg DG, Wang Y, Li ZG, Zhebentyayeva T, Fan SH, Reighard GL, Scorza R, Abbott AG (2008) Sequencing and annotation of the evergrowing locus in peach [Prunus persica (L.) Batsch] reveals a cluster of six MADS-box transcription factors as candidate genes for regulation of terminal bud formation. Tree Genet Genomes 4:495–507 Bohlenius H, Huang T, Charbonnel-Campaa L, Brunner AM, Jansson S, Strauss SH, Nilsson O (2006) CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312:1040–1043 Chao W, Anderson JV (2004) Euphorbia esula crop protection compendium. CAB International, Wallingford Chao WS, Horvath DP, Anderson JV, Foley ME (2005) Potential model weeds to study genomics, ecology, and physiology in the 21st century. Weed Sci 53:929–937 Chao WS, Serpe MD, Anderson JV, Gesch RW, Horvath DP (2006) Sugars, hormones, and environment affect the dormancy status in underground adventitious buds of leafy spurge (Euphorbia esula). Weed Sci 54:59–68 Chen K-Y (2008) Type II MADS-box genes associated with poplar apical bud development and dormancy. Thesis Dissertation Department of Plant Sciences and Landscape Architecture, University of Maryland Chouard P (1960) Vernalization and its relations to dormancy. Annu Rev Plant Physiol Plant Mol Biol 11:191–238 Diaz MD (1974) Vegetative and reproductive growth habits of evergreen peach trees in Mexico. In: Proceedings from the XIX International Horticulture Congress vol 18, p 525
Plant Mol Biol (2010) 73:169–179 Foley ME, Anderson JV, Horvath DP (2009) The effects of temperature, photoperiod, and vernalization on regrowth and flowering competence in Euphorbia esula (Euphorbiaceae) crown buds. Botany 87:986–992 Fujiwara S, Oda A, Yoshida R, Niinuma K, Miyata K, Tomozoe Y, Tajima T, Nakagawa M, Hayashi K, Coupland G, Mizoguchi T (2008) Circadian clock proteins LHY and CCA1 regulate SVP protein accumulation to control flowering in Arabidopsis. Plant Cell 20:2960–2971 Gumucio DL, Heilstedtwilliamson H, Gray TA, Tarle SA, Shelton D, Tagle DA, Slightom JL, Goodman M, Collins FS (1992) Phylogenetic footprinting reveals a nuclear-protein which binds to silencer sequences in the human-gamma and human-epsilon globin genes. Mol Cell Biol 12:4919–4929 Hartmann U, Hohmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J 21:351–360 Horvath DP (1998) The role of specific plant organs and polar auxin transport in correlative inhibition of leafy spurge (Euphorbia esula) root buds. Can J Bot 76:1227–1231 Horvath DP (1999) Role of mature leaves in inhibition of root bud growth in Euphorbia esula L. Weed Sci 47:544–550 Horvath DP, Chao WS, Anderson JV (2002) Molecular analysis of signals controlling dormancy and growth in underground adventitious buds of leafy spurge. Plant Physiol 128:1439–1446 Horvath DP, Anderson JV, Chao WS, Foley ME (2003) Knowing when to grow: signals regulating bud dormancy. Trends Plant Sci 8:534–540 Horvath DP, Chao WS, Suttle JC, Thimmapuram J, Anderson JA (2008) Transcriptome analysis identifies novel responses and potential regulatory genes involved in seasonal dormancy transitions of leafy spurge (Euphorbia esula L.). BMC Genomics 9:536 Kotake T, Takada S, Nakahigashi K, Ohto M, Goto K (2003) Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. Plant Cell Physiol 44:555–564 Lang GA (1987) Dormancy—a new universal terminology. Hortscience 22:817–820 Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH (2007) Role of SVP in the control of flowering time by ambient temperature in Arabidopsis. Genes Dev 21:397–402 Lee J, Oh M, Park H, Lee I (2008) SOC1 translocated to the nucleus by interaction with AGL24 directly regulates LEAFY. Plant J 55:832–843 Leseberg CH, Li AL, Kang H, Duvall M, Mao L (2006) Genomewide analysis of the MADS-box gene family in Populus trichocarpa. Gene 378:84–94
179 Li Z, Reighard GL, Abbott AG, Bielenberg DG (2009) Dormancyassociated MADS genes from the EVG locus of peach [Prunus persica (L.) Batsch] have distinct seasonal and photoperiodic expression patterns. J Exp Bot 60:3521–3530 Mazzitelli L, Hancock RD, Haupt S, Walker PG, Pont SDA, McNicol J, Cardle L, Morris J, Viola R, Brennan R, Hedley PE, Taylor MA (2007) Co-ordinated gene expression during phases of dormancy release in raspberry (Rubus idaeus L.) buds. J Exp Bot 58:1035–1045 Michaels SD, Ditta G, Gustafson-Brown C, Pelaz S, Yanofsky M, Amasino RM (2003) AGL24 acts as a promoter of flowering in Arabidopsis and is positively regulated by vernalization. Plant J 33:867–874 Ruonala R, Rinne PLH, Kangasjarvi J, van der Schoot C (2008) CENL1 expression in the rib meristem affects stem elongation and the transition to dormancy in Populus. Plant Cell 20:59–74 Ruttink T, Arend M, Morreel K, Storme V, Rombauts S, Fromm J, Bhalerao RP, Boerjan W, Rohde A (2007) A molecular timetable for apical bud formation and dormancy induction in poplar. Plant Cell 19:2370–2390 Schulzschaeffer J, Gerhardt S (1989) Cytotaxonomic Analysis of the Euphorbia Spp (leafy spurge) complex. 2. Comparative-study of the chromosome morphology. Biologisches Zentralblatt 108: 69–76 Shinozaki K, Yamaguchi-Shinozaki K (2000) Molecular responses to dehydration and low temperature: differences and cross-talk between two stress signaling pathways. Curr Opin Plant Biol 3:217–223 Sung S, Amasino RM (2005) Remembering winter: toward a molecular understanding of vernalization. Annu Rev Plant Biol 56:491–508 Yamane H, Kashiwa Y, Ooka T, Tao R, Yonemori K (2008) Suppression subtractive hybridization and differential screening reveals endodormancy-associated expression of an SVP/AGL24type MADS-box gene in lateral vegetative buds of Japanese apricot. J Am Soc Hortic Sci 33:708–716 Zhang X, Germann S, Blus BJ, Khorasanizadeh S, Gaudin V, Jacobsen SE (2007) The Arabidopsis LHP1 protein colocalizes with histone H3 Lys27 trimethylation. Nat Struct Mol Biol 14:869–871 Zhang JZ, Li ZM, Mei L, Yao JL, Hu CG (2009) PtFLC homolog from trifoliate orange (Poncirus trifoliata) is regulated by alternative splicing and experiences seasonal fluctuation in expression level. Planta 229:847–859
123
