Mycopathologia 154: 85–91, 2001. © 2002 Kluwer Academic Publishers. Printed in the Netherlands.
85
Cloning and expression of pkaC and pkaR, the genes encoding the cAMP-dependent protein kinase of Aspergillus fumigatus Brian G. Oliver∗, John C. Panepinto, Jarrod R. Fortwendel, Darcey L. Smith, David S. Askew & Judith C. Rhodes Department of Pathology and Laboratory Medicine, University of Cincinnati, Cincinnati, OH, U.S.A. Received 20 November 2001; accepted in revised form 24 January 2002
Abstract This report describes the cloning and expression of both subunits of PKA in the opportunistic fungal pathogen Aspergillus fumigatus. The predicted translation product of the regulatory subunit, pkaR, is defined as a type II regulatory subunit. The gene encoding the A. fumigatus catalytic subunit, pkaC, contains the conserved kinase and activation domains that are characteristic of PkaC proteins. Both subunit mRNAs are expressed throughout the asexual life cycle of A. fumigatus. Message levels of pkaR and pkaC are higher during co-cultivation with alveolar epithelial cells than during culture alone. Key words: Aspergillus, PKA, cAMP
Introduction Cyclic AMP signaling is a potent regulator of intracellular effects in multiple eukaryotic species. Protein kinase A (PKA), an essential component of this pathway, is a heterotetrameric molecule containing two catalytic and two regulatory subunits. When intracellular cAMP levels are high, cAMP binds to the regulatory subunit, inducing a conformational change in the regulatory subunit dimer, which interrupts its ability to bind the catalytic subunit. The catalytic subunits are then free to phosphorylate downstream targets [1], leading to the activation of effector molecules. Recent work supports a role for the cAMP/PKA pathway in the growth and morphology of several fungi, including the filamentous fungi Aspergillus nidulans, A. niger, Mucor rouxii, and Neurospora crassa and the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe [2–6, 14]. Little is known about PKA in the opportunistic fungal pathogen A. fumigatus. As a first step toward understanding the importance of PKA signaling to A. fumigatus, ∗ Current address: Seattle Biomedical Research Institute, 4 Nickerson St., Suite 200, Seattle, WA 98109-1651. ** Published in 2002.
we have cloned the genes encoding the regulatory and catalytic subunit of the cAMP-dependent protein kinase from A. fumigatus and monitored their expression throughout the asexual development of the organism and during growth on alveolar epithelial cells.
Materials and methods Isolates and culture conditions The A. fumigatus clinical isolate H237 was maintained on Sabouraud’s dextrose agar. Liquid cultures were grown in YG (0.5% yeast extract, 2% glucose) at 37 ◦ C in a shaking incubator at 250 rpm. Genomic cloning and sequencing of pkaR A partial pkaR cDNA clone was used to screen an A. fumigatus genomic library from isolate B5233 in lambda Zap II (Stratagene, USA) [7]. Two overlapping genomic clones were isolated and sequenced completely on both strands by automated DNA sequencing (University of Cincinnati DNA Core Facility). The corresponding region from A. fumigatus H237
86 was then PCR amplified with Pfu polymerase, using primers in the sequence of the B5233 genomic clone (5 -primer 5 -CCTCCCTCCTACTACTACCCC-3 , 3 primer 5 -GGTTGCGTTCGAGTCTCC-3 ). The 3 kb PCR product, containing the full-length open reading frame was cloned into pCR-Blunt II-TOPO (Invitrogen, USA), and 3 plasmids containing PCR products were sequenced completely on both strands. The Genbank accession number for the complete H237 genomic sequence is AF401202. Genomic cloning and sequencing of pkaC Degenerate oligonucleotide primers based upon the PKA kinase domain sequences of S. cerevisiae, M. grisea, U. maydis and A. niger were used to amplify a 500 bp product from A. fumigatus H237 genomic DNA. The sequences of the primers were: 5 -primer (5 -AAVTTCTATGCBGCCGAGG-3 ) and 3 -primer (5 -CCCAGGTGACCTCGGCAAACC-3 ), with V being G, A, or C and B being G, T, or C. The resulting amplicon was verified by sequencing and used to screen an A. fumigatus cosmid genomic library constructed in pWEB (Epicentre Technologies). Three positive subclones from the cosmid DNA insert were sequenced. The GenBank accession number for the complete genomic sequence of the cAMP-dependent protein kinase catalytic subunit is AY046405. Cloning the pkaR and pkaC cDNAs The mycelium from an overnight culture of A. fumigatus was blotted dry, frozen in liquid nitrogen and crushed with a mortar and pestle. The crushed mycelium was resuspended in 50 mM Tris, pH 8.0, 0.3 M NaCl, 5 mM EGTA and extracted with acid phenol and chloroform. RNA was precipitated with ethanol, and the pellet was resuspended in sterile, DEPC-treated water. Total A. fumigatus RNA (10 µg) was treated with DNAse I (Gibco BRL/Life Technologies, USA) using the manufacturer’s recommended protocol and was reverse transcribed using an oligo d(T)17 primer and reverse transcriptase (Gibco BRL/Life Technologies, USA). The pkaR coding sequence was amplified from this first-strand cDNA pool using the 5 -primer 5 GCGCGGATCCAGGATGGCTGATAGCTCTTCTT TCC-3 and the 3 -primer 5 -CATCACGAGGGCGAA GGC-3 . The pkaC coding sequence was amplified from the same pool using a 5 primer 5 CCTCGATGCCGACTTTAGG-3 and a 3 -primer
5 -CTAGAAGTCTGGGAAAAG-3. The PCR reaction was performed for 35 cycles (94 ◦ C, 1 minute; 50 ◦ C, 1 minute; and 72 ◦ C, 2 minutes). The PCR products were cloned and both strands were sequenced. Genomic southern blot analysis Genomic DNA was isolated from A. fumigatus cultures grown overnight in YG as described previously [7]. Total genomic DNA (12 µg per lane) was digested with restriction enzymes, fractionated on a 1% agarose gel, and transferred to a nitrocellulose membrane following depurination [8]. The pkaC probe was a 475 bp fragment containing the highly conserved catalytic domain, and the 1242 bp pkaR probe contained the entire open reading frame. Probes were labeled with 32 P-dCTP using the PrimeIt random labeling kit (Stratagene, USA). Blots were washed at low stringency, 0.1% SDS, 1X SSC, room temperature for twenty minutes. Hybridization was monitored with a STORM phosphorimager (Molecular Dynamics). Developmental expression of pkaC and pkaR Conidia of A. fumigatus were harvested in sterile H2 O and counted in a hemacytometer. Fifty ml cultures of YG for each time point were inoculated with 2.5 × 106 conidia and incubated at 37 ◦ C at 225 rpm. After 6 hours, the organism was harvested by centrifugation and total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s recommended protocol for yeast cultures. In order to measure mRNA levels during conidiation, the germinated conidia in the remaining flasks were harvested by vacuum filtration onto sterile Whatman filter circles. Growth was then continued at 37 ◦ C by incubating the filters on a single layer of 3 mm glass beads supplemented with YG, which was replenished every 6 hours. At subsequent times, mycelium was removed from the filter circles and dried. The dried mycelial mat was frozen, crushed, and processed for isolation of total RNA with the Qiagen RNeasy Plant Mini Kit following the manufacturer’s protocol for filamentous fungi. First strand cDNA from each time point was amplified from DNAse-treated total RNA using an oligo d(T)17 primer and Superscript II reverse transcriptase (GibcoBRL). Steady-state mRNA levels of both subunits were determined by PCR amplification using first strand cDNA as a template. The pkaC primers used were
87 5 -primer, 5 -GAATCTGCTGCTGGACCGGC-3 and 3 -primer, 5 -ATTGTTCAGTCTCCTCGGGG3 . The primers for pkaR were 5 -primer, 5 and 3 -primer, GGCCCCGATGGTATTGGC-3 , 5 -CGCGGAGTATTCAGCCC-3 . The amount of amplicon was normalized to gpdA cDNA levels using a 5 -primer 5 -TCTCCAACGTTCTTGCACC-3 and 3 -primer, 5 -CCACTCGTTGTCGTACCAGG3 . The sequences of the gpdA primers were based upon GenBank AF409105. PCR was performed for 20 cycles, using the protocol described above. Controls containing no reverse transcriptase were run concurrently. Following electrophoresis, amplicons were stained with SYBR Green I (Molecular Probes); relative mRNA levels were measured using a STORM phosphorimager and expressed as the ratio of each PKA subunit to that of gpdA. A549 cultures A549 alveolar epithelial cells (ATCC CCL-185) were propagated in Ham’s F-12 with 5% fetal bovine serum (Gibco/BRL) as recommended by the supplier. Confluent monolayers were inoculated with A. fumigatus conidia (105 per T-25 flask) and incubated at 37 ◦ C for 6, 12, 18, and 24 hours prior to harvest. Control cultures were grown under the same conditions in flasks without A549 cells. Hyphae were harvested, and RNA was extracted as described previously [7], modified by substituting the RNeasy Plant Mini Kit. RNA was analyzed by RT-PCR as described above. Photography To correlate morphological development with mRNA levels, photographs of the asexual development in A. fumigatus were taken every six hours for 24 hours using an Olympus BH-2 microscope equipped for differential interference contrast microscopy.
Results and discussion A. fumigatus pkaR The pkaR gene, GenBank (AF401202), was isolated from an A. fumigatus genomic library using a partial cDNA clone as a probe. The pkaR gene is organized as a single long open reading frame (ORF), initiated by an ATG in good context for eukaryotic translation initiation, which would encode a 413 amino acid protein with a predicted molecular weight of 44 kD [9].
In order to confirm that the protein-coding region was uninterrupted by introns, the entire ORF was PCRamplified from reverse-transcribed mRNA and shown to be identical in sequence to that of the genomic clone. The absence of introns in a coding sequence is a relatively unusual finding in filamentous fungi [10]. Low stringency hybridization failed to identify any related sequences in the genome, suggesting that the pkaR gene is in single copy (data not shown), a finding that is confirmed by BLAST search of the currently available A. fumigatus genome. Database comparisons with the PkaR protein identified the highest level of homology to PKA regulatory subunits of other fungi. As shown in Figure 1, the A. fumigatus PkaR has all of the predicted features of a type II regulatory subunit, including the two cAMP binding domains, the serine pseudosubstrate, and the invariant autoinhibition site [11, 12]. Not surprisingly, the protein with the greatest homology to A. fumigatus PkaR is the corresponding protein from A. nidulans. The two proteins share 79% overall identity, most of which is concentrated in the C-terminal two-thirds of the protein. The divergence in the amino termini of the proteins may reflect different target specificity between the species. Recent studies in S. cerevisiae suggest that the N-terminus determines the subcellular localization of the protein and is required for optimal growth, suggesting that it mediates protein-protein interactions that are necessary for appropriate function [13]. A. fumigatus pkaC The A. fumigatus pkaC gene and corresponding cDNA were cloned using a combination of degenerate PCR and genomic library screening. The entire pkaC gene is contained on a 3 kb BamHI fragment (GenBank AY046405). A comparison between the cDNA and genomic sequence showed that the coding sequence of pkaC is comprised of four exons. Conceptual translation of the ORF predicts a protein of 490 amino acids with a molecular weight of 56 kD. Genomic Southern blot analysis at low stringency failed to identify related sequences in the A. fumigatus genome, suggesting that pkaC is also present in single copy (data not shown). Homology search of the currently available A. fumigatus genome confirms the finding. An alignment between A. fumigatus PkaC and other fungal catalytic subunit proteins revealed that the highest degree of homology was within the carboxyl region of the protein (Figure 2). Again,
88
Figure 1. Multiple sequence alignment of fungal PKA regulatory subunit proteins. Identical amino acids are represented as dashes and sequence gaps are presented as periods. The two predicted cAMP binding domains and the autoinhibition site are underlined in the A. fumigatus sequence. The pseudosubstrate S122 is highlighted in bold. Afum: Aspergillus fumigatus, Anid: Aspergillus nidulans (AF043231), Mgri: Magnaporthe grisea (AF024633), Calb: Candida albicans (AF317472.1), and Cneo: Cryptococcus neoformans (AF288614).
89
Figure 2. Multiple sequence alignment of fungal PKA catalytic subunit proteins. Regions corresponding to the predicted phosphate anchor and the catalytic domain are underlined in the A. fumigatus sequence. The autophosphorylated T334 and the invariant APE (344–346) are highlighted in bold. Identical amino acids are represented as dashes and sequence gaps are represented as periods. Afum: Aspergillus fumigatus, Anid: Aspergillus nidulans (AF262987), Mgri: Magnaporthe grisea (U12335), Calb: Candida albicans (AF317473), and Cneo: Cryptococcus neoformans (AF288614).
90
Figure 3. Expression of PKA subunits during asexual development. (A) Differential interference contrast micrographs of A. fumigatus at 6, 12, 18, and 24 hours of asexual development. (B) RT-PCR analysis of steady-state levels of pkaC and gpdA mRNA during the development of A. fumigatus. (C) RT-PCR analysis of steady state levels of pkaR and gpdA mRNA during the development of A. fumigatus. Gels were stained with SYBRGreen I and imaged on the Storm Phosphoimager.
the A. fumigatus PkaC contained the conserved domains that characterize PKA catalytic subunits (http://www.sdsc.edu/kinases/). A. nidulans PkaC was most closely related in sequence to A. fumigatus PkaC, with 83% overall sequence identity. Developmental expression of pkaR and pkaC In order to determine if the genes comprising PKA in A. fumigatus undergo fluctuations in mRNA levels during the asexual developmental cycle, we compared the relative levels of pkaR and pkaC mRNA in cultures enriched for germlings, vegetative hyphae, and conidiogenous hyphae (Figure 3A). RT-PCR analysis of steady-state mRNA levels showed that both pkaR and pkaC mRNAs were expressed throughout the A. fumigatus life cycle (Figure 3B, C). RT-PCR controls performed in the absence of reverse transcriptase were consistently negatively (data not shown). Because the steady state levels of message for both subunits remain constant during the developmental process, the data does not support a role for transcriptional regulation of PKA during growth and development under these conditions. Expression in cultures with A549 cells Because our previous data suggested that pkaR expression was up-regulated when A. fumigatus was co-cultured with endothelial cells, we sought to determine whether this increased expression was unique to interaction with endothelial cells or whether co-
Figure 4. Expression of PKA subunits during culture with or without alveolar epithelial cells (A549). (A) RT-PCR analysis of pkaC, pkaR, and gpdA at 6, 12, 18, and 24 hours of co-culture with A549 cells. (B) Graphical representation of the data in A presented as a ratio of the intensity of the individual subunit band to that of gpdA. (C) RT-PCR analysis of pkaC, pkaR, and gpdA at 6, 12, 18, and 24 hours of culture without A549 cells. (D) Graphical representation of the data in C presented as in B. Gels were stained and imaged as described in Figure 3.
culture with alveolar epithelial cells might also lead to increased expression [7]. As shown in Figure 4, mRNA levels of both pkaR and pkaC were maintained at higher levels in the presence of alveolar epithelial cells than in the absence of the mammalian cells. We cannot explain why the levels of pkaR and pkaC message appear to be elevated at six hours when cultured in the absence of A549 cells, because microscopic examination at that time point did not suggest that there was a significant difference in the kinetics of germination under the two sets of conditions (data not shown). Further, although the results obtained from conidia alone appear quite different than those obtained when we examined asexual development, differences in culture conditions, including the medium, atmosphere, and vessels used, render such comparisons difficult to defend. However, the increased level of regulatory subunit message seen during co-culture with the alveolar epithelial cells supports our previous finding with endothelial cells. Taken together with the current data on levels of pkaC message, the pattern suggests that up-regulation of pkaR may occur in response to transcriptional up-regulation of pkaC by A. fumigatus in the presence of mammalian cells. There is growing support for a virulence-related role for the cAMP/PKA pathway in the plant pathogens Ustilago maydis, M. grisea, Colletotrichum trifolii and Cryphonectria parasitica, as well as the
91 human pathogens C. albicans and C. neoformans [5, 15–23]. A. fumigatus pkaR expression has recently been demonstrated to be increased when the fungus is grown in contact with human endothelial cells, and we have confirmed that finding in alveolar epithelial cells and extended the observation to the catalytic subunit of PKA, suggesting a possible role for this signalling pathway in A. fumigatus infections [7]. The cloning of the genes for the two subunits of A. fumigatus PKA will enable more detailed studies into the potential role of cAMP/PKA signaling in the growth and virulence of A. fumigatus.
Acknowledgements We would like to thank Jay Card for his photographic assistance. This work was supported in part by National Institutes of Health award AI041119 to J.C.R. and CA61909 to D.S.A.
References 1. Taylor S, Radzio-Andzelm E. Cyclic AMP-dependent protein kinase. In: JR Woodgett, editor. Protein Kinases. Oxford: IRL Press at Oxford University Press, 1994; 2–29. 2. Shimizu K, Keller N. Genetic involvement of a cAMPdependent protein kinase in a G protein signaling pathway regulating morphological and chemical transitions in Aspergillus nidulans. Genetics 2001; 157: 591–600. 3. Bencina M, Panneman H, Ruijter G, Legisa M, Visser J. Characterization and overexpression of the Aspergillus niger gene encoding the cAMP-dependent protein kinase catalytic subunit. Microbiology 1997; 143: 1211–1220. 4. Pereyra E, Mizyrycki C, Moreno S. Threshold level of protein kinase A activity and polarized growth in Mucor rouxii. Microbiology 2000; 146: 1949–1958. 5. Lengeler K, Davidson R, D’Souza C, Harashima T, Shen W, Wang P et al. Signal transduction cascades regulating fungal development and virulence. Microbiol Mol Biol Rev 2000; 64: 746–785. 6. Thevelein J, de Winde J. Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol Microbiol 1999; 33: 904–918. 7. Rhodes J, Oliver B, Askew D, Amlung T. Identification of genes of Aspergillus fumigatus up-regulated during growth on endothelial cells. Med Mycol 2001; 39: 253–260. 8. Sambrook J, Fritsch E, Maniatis T. Molecular Cloning: A Laboratory Manual. 9th edn. Plainview, NY: Cold Spring Harbor Press, 1989. 9. Kozak M. Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res 1984; 12: 857–872.
10. Leong S, Berka R, eds. Molecular Industrial Mycology. 10th edn. New York: Marcel Dekker, Inc., 1991. 11. Diller T, Nguyen-Huu X, Taylor S. Type IIb regulatory subunit of cAMP-dependent protein kinase: purification strategies to optimize crystallization. Protein Expr Purif 2000; 20: 357– 364. 12. Ringheim G, Taylor S. Effects of cAMP-binding site mutations on intradomain cross-communication in the regulatory subunit of cAMP-dependent protein kinase I. J Biol Chem 1990; 265: 19472–19478. 13. Griffioen G, Anghileri P, Imre E, Baroni M, Ruis H. Nutritional control of nucleocytoplasmic localiztion of cAMPdependent protein kinase catalytic and regulatory subunits in Saccharomyces cerevisiae. J Biol Chem 2000; 275: 1449– 1456. 14. Thevelein J. Signal transduction in yeast. Yeast 1994; 10: 1753–1790. 15. Yang Z, Dickman M. Molecular cloning and characterization of Ct-PKAR, a gene encoding the regulatory subunit of cAMP-dependent protein kinase in Colletotrichum trifolii. Arch Microbiol 1999; 171: 249–256. 16. Yang Z, Dickman M. Colletotrichum trifolii mutants disrupted in the catalytic subunit of cAMP-dependent protein kinase are nonpathogenic. Mol Plant Microbe Interact 1999; 12: 430– 439. 17. Xu J-R, Urban M, Sweigard J, Hamer J. The CPKA gene of Magnaporthe grisea is essential for appressorial penetration. Mol Plant Microbe Interact 1997; 10: 187–194. 18. Sonneborn A, Bockmuhl D, Gerads M, Kurpanek K, Sanglard D, Ernst J. Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans. Mol Microbiol 1999; 35: 386–396. 19. Kruger J, Loubradou G, Regenfelder E, Hartmann A, Kahmann R. Crosstalk between cAMP and pheromone signaling pathways in Ustilago maydis. Mol Gen Genet 1998; 260: 193–198. 20. Gold S, Brogdon S, Mayorga M, Kronstad J. cAMP regulates morphogenesis in the fungal pathogen Ustilago maydis. Genes Dev 1997; 8: 2805–2816. 21. Gold S, Brogdon S, Mayorga M, Kronstad J. The Ustilago maydis regulatory subunit of a cAMP-dependent protein kinase is required for gall formation in maize. Plant Cell 1997; 9: 1585–1594. 22. D’Souza C, Alspaugh J, Yue C, Harashima T, Cox G, Perfect J et al. Cyclic AMP-dependent protein kinase controls virulence of the fungal pathogen Cryptococcus neoformans. Mol Cell Biol 2001; 21: 3179–3191. 23. D’Souza C, Heitman J. Conserved cAMP signaling cascades regulate fungal development and virulence. FEMS Microbiol Rev 2001; 3: 349–364. Address for correspondence: Judith C. Rhodes, Ph.D, Department of Pathology and Laboratory Medicine, University of Cincinnati, P.O. Box 670529, Cincinnati, Ohio 45267-0529, U.S.A. Phone: (513)558-0130; Fax: (513)558-2289; E-mail:
[email protected]
