Cloning and expression of the Epstein-Barr virus-encoded ... - CiteSeerX

Jour"aZ.°fGenera~.!5!r°/0gY

!2.?7% 7.7, 2.7?S:ZS0S:.....Pr!nte~..~.~.?ea!.Br!!a.~ ............................................................................................................................

Cloning and expression of the Epstein-Barr virus-encoded dUTPase: patients with acute, reactivated or chronic virus infection develop antibodies against the enzyme Peter S o m m e r l 1 Elisabeth Kremmer, z Stefan Bier, s Sigrid K6ni9,1 Petra Zalud, s Michael Z e p p e z a u e r , 3 James F. Jones, 4 N i k o l a u s M u e l l e r - L a n t z s c h 1 and Friedrich A. Gr&sser 1 11nstitut for Mikrobiologie und Hygiene, Abteilung Virologie, Haus 47, Universit~.tskliniken, 66421 Homburg, Germany 2GSF-Institut for Immunologie, IVlarchioninstrasse 25, 81377 NlOnchen,Germany 3Institut for Biochemie, Universittit des Saarlandes, Post-fach 151150, 66041 SaarbrOcken, Germany 4National Jewish Center for Immunology and Respiratory Medicine, 1400 Jackson Street, Denver, CO 80206, USA

The gene encoding the Epstein-Barr virus (EBV)specific dUTPase was amplified from virus DNA by PCR. The active enzyme was expressed in Escherichia coil and in insect cells as a non-fusion protein. The protein from E. coil specifically converted dUTP to dUMP and did not react with other dNTPs or NTPs. Preliminary experiments yielded a Kmvalue of about 0"8 FtM for dUTP. MAbs against the dUTPase reacted with a protein of approximately 31 kDa in 12-O-tetradecanoyl-phorbol- 1 3-acetate (TPA)stimulated B cells harbouring either type 1 or type 2 EBV. The protein was found in untreated cells at low levels, whereas induction of the lytic replication cycle by TPA treatment or by providing the immediate early transactivator BZLF 1 in trans resulted in increased expression. We demonstrated that the

Introduction Epstein-Barr virus (EBV) is an ubiquitous human herpesvirus that infects approximately 90% of world's adult population. The virus persists in the B cell compartment in a latent state, while infectious virus is produced in the oropharyngeal epithelium as well as in peripheral B cells (Miyashita et al., 1995). In vitro, mature resting B cells can become immortalized upon EBV infection. In vivo, EBV has been implicated in the generation of a variety of tumours such as Burkitt's lymphoma, nasopharyngeal carcinoma (NPC), Hodgkin's lymphoma, as well as lymphoid tumours arising under immunosuppression (for review see Miller, 1990). Infection with EBV usually occurs syrnptomless in early Author for correspondence: FriedrichA. Gr~sser. Fax +49 6841 163980. e-mail [email protected]

0001-3880 © 1996 SGM

virus dUTPase isolated from EBV-infected cells is a phosphoprotein. The protein expressed in insect cells was used to test for the presence of specific antibodies in sera from normal, healthy carriers and from patients with various diseases. While the sera of EBV-negative individuals (0/3) or healthy carriers (0/33) did not contain detectable levels of antibodies, patients with mononucleosis (5/18), chronic EBV infection (2/7), EBV reactivation (7/20) and human immunodeficiency virus infection (5/24) showed elevated antibody titres against the enzyme. This indicated that the dUTPase is expressed during EBV replication and reactivation. The enzyme might therefore be a potential target for drug therapy under conditions of active DNA replication.

childhood. Of those individuals infected during adolescence or young adulthood, 50% develop infectious mononucleosis. Virus replication elicits an immune response which defines the serological markers for lyric infection, including antibodies against the early antigen complex (EA) or structural proteins like the capsid antigens (VCA). During the early phase of infection, no antibodies against nuclear antigen i (EBNA1) can be detected (Henle et aI., 1987). Chronic, persistent infection with EBV is often accompanied by the presence of high serum antibody titres against the EA and VCA complex; however, antibodies against EBNAI and often against EBNA2 can also be detected. In severely immunocompromised patients, for instance in human immunodeficiency virus (HIV)-infected individuals, conditions of lytic EBV infection in epithelial tissue such as oral hairy leukoplakia can be observed (Niedobitek et at., 1991). Immunosuppression can finally lead to the development of EBV-induced B cell lymphomas (Freter, 1990). ~_795

It is generally believed that EBV-harbouring tumour cells exclusively express latent replication cycle proteins; this view has recently been called into question b y Rochford & Mosier (1995) who examined tumours induced in SCID mice b y transplantation of human peripheral blood lymphocytes from EBV-positive donors. These authors show that a certain proportion of the tumour cells express lytic cycle proteins. In immortalized B cells, the replicative cycle of EBV can be induced experimentally b y phorbol esters such as 12-0tetradecanoyl-phorbol-13-acetate (TPA) (Boos el al., 1987) or, alternatively, b y superinfection of the Raji cell line with the transformation-defective P3HR-1 virus (Miller et aI., 1984). dUTP is an important intermediate in the biosynthesis of dTTP; its intracellular concentration has to be kept low for two reasons: (i) dUMP, which is formed b y hydrolysis of dUTP, serves as a substrate for thymidylate synthase and (ii) D N A polymerases also utilize dUTP as a substrate, which is potentially mutagenic or lethal for the cell. M a n y observations highlight the regulatory importance of dUTPase which is found in all organisms (Bergman et a]., 1994; Gadsden et al., 1993; Giroir & Deutsch, 1987; Mclntosh et al., 1992; Shlomai & Kornberg, 1978; Williams & Cheng, 1979). In Escherichia coil and the yeast Saccharomyces cerevisiae, the dUTPases appear to be essential for cell viability (E1-Hajj et aI., 1988; Gadsden et al., 1993). The cellular dUTPases keep the amounts of free dUTP at about 0"2 ~M, compared with about 2 0 - 3 0 gM for the other dNTPs (Traut, 1994), b y hydrolysing dUTP to dUMP and pyrophosphate. The d U M P thus created also serves as a precursor for the biosynthesis of dTTP. Since the induction of lytic replication b y most viruses is often followed b y a dramatic reduction of cellular gene expression, some D N A viruses like herpes simplex virus (HSV), varicella-zoster virus and vaccinia virus, and retroviruses like equine infectious anaemia virus and mouse mammary tumour virus, carry their own dUTPases to prevent the accumulation of intracellular dUTP (McGeoch, 1990). HIV, however, does not seem to contain a dUTPase. In this case, the reverse transcriptase, the key enzyme of virus replication, apparently does not utilize dUTP efficiently as a substrate and thus avoids misincorporation of uracil into the c D N A molecules (Martinez et al., 1994). Williams ef aI. (1985) demonstrated that an EBV-specific dUTPase activity induced in TPA-stimulated cells is probably accompanied b y a reduction in endogenous dUTPase activity. The virus dUTPase might therefore be a target for inhibitory drugs, since the subsequent accumulation of uracil in the virus D N A should render the virus genome prone to degradation in newly infected cells (Williams, 1988). The aim of this study was to clone and characterize the EBV-encoded dUTPase as a first step towards the rational design of drugs that inhibit the activity of this enzyme.

Hethods • Cell lines and tissue culture. BL41 is an EBV-negative Burkitt's Iymphoma cell line (Lenoir et al., 1985), Jijoye (Hinuma et al., 1967) is a

!79C

type 2 EBV-infected line, P3HR-I is a subline of Jijoye with a deletion in the EBNA-LP/EBNA2-region (Bomkamm et al., 1982) and Raji (Pulvertaft, 1964) is a type 1 EBV-infected Burkitt's lymphoma line. BJAB is an EBV-negative B cell tumour cell line (Klein et al., I974), B95-8 (Miller & Lipman, 1973) and IB4 (Fennewald et al., 1984) are lymphoblastoid cell lines that contain type 1 EBV. M-ABA-CBL cells, generated by immortalization of human cord blood Iymphocytes with EBV strain MABA (Crawford et al., 1979), were kindly supplied by G. Bomkamm (GSF, Mfinchen, Germany). The cell lines Iarc-070, -303B, -151, -261, -308, -290B, -385, -36, -240B, -63I and -779 were generated from peripheral lymphocytes of patients with EBV-associated diseases (G. Lenoir, Lyon, France, unpublished results). Cells were routinely subcultured once or twice a week in RPMI-1640 medium (Gibco) supplemented with 10 % fetal calf serum (FCS, Serva), 2 mM-L-glutamine, 10 IU/ml moronal, 10 lag/ml neomycin, 50 gg/ml streptomycin and 40 IU/ml penicillin at 37 °C and 7% CO 2. The lyric replication cycle was induced by the addition of 20 ng/ml of the phorbol ester TPA (Boos ei al., 1987). The induced ceils were harvested after 18-20 h for further analysis. The insect cell line Sf158 (Knutson & Tinsley, 1974) was kept at 27 °C in TC100 medium (Summers & Smith, 1987) supplemented as above. The production of recombinant Autographa califomica nucleopolyhedrovirus was as described earlier (Hille eta]., 1993) using BaculoGold (Pharmingen) as a source of baculovirus DNA. • Transfection of ¢e11$. B cells were transfected by electroporation (Chu et al., 1987) using a Bio-Rad Gene Pulser. Briefly, 107 cells from logarithmically growing cultures were washed once and resuspended in 0"25 ml of cold RPMI-1640 medium with 10 % FCS. The ceils were placed on ice in a gene pulser cuvette with an electrode distance of 4 mm and 20 lag of DNA was added. After I0 min, the suspension was subjected to a single pulse at 250 V and 960 p.F and incubated for I0 rain on ice. The cells were resuspended in 5 ml prewarmed medium with 10% FCS. 48 h later, the cells were pelleted, washed with PBS and resuspended in 100 lal of gel loading buffer. Aliquots (20 lal)were used for further analysis on 12'5 % SDS-polyacrylamide gels. • Radioactive labelling, cell extraction and immunoprecipitation. For metabolic labelling, approximately 5 x 107 cells were washed

three times with RPMI-1640 lacking phosphate and resuspended in 1 ml of the deficient medium that contained 10 % FCS and 2"5 mCi of H332P04 for an additional 4 h. Cells were pelleted, washed with ice-cold PBS and resuspended in i ml of lysis buffer consisting of 20 mM-Na~PO4 pH 8"0, 50 mM-NaCl,2"5 mM-MgCI2, 1 mM-CaCl~,300 mM-sucrose, 1 mM-DTT, O'1 mM-PMSF, I lag/mI leupeptin (Sigma) and 2 ~,g/ml aprotinin (Sigma). After 15 min at 0 °C, the lysate was centrifuged at 14000 g and 4 °C for 15 min. For immunoprecipitation, 0"5 ml of cell extract was incubated with 100 lalof tissue culture supernatant containing irrelevant control antibody RmT6 (E. Kremmer, unpublished results) or the EBV dUTPase-specific MAbs described below. The mixture was kept on ice for I h; the immunocomplex was absorbed to 50 p.I of settled Protein A-Sepharose (Pharmacia) previously incubated with 25 lal of goat anti-rat IgG (Dianova) and then washed with PBS. The soIution was agitated for I h at 4 °C, washed twice with lysis buffer followed by RIPA buffer (Gr/isser et al., 1993) containing 500 mM-NaC1.The bound proteins were released with 100 lal of gel loading buffer and 30 lal aliquots were analysed on 12"5% or 15% SDS-polyacrylamide gels. For a second round of immunoprecipitation, the released material was diluted with 900 td of lysis buffer and 250 p.1 of flesh antibody solution was added. Autoradiography was carried out as described (Gr/isser et al., 1991).

Western blot analysis was carried out as described (Gr/isser et al., 1993); the bound antibodies were detected with the appropriate secondary antibody (either goat anti-rat IgG or goat anti-human IgG coupled to horseradish peroxidase; Dianova). The blots were developed either directly with diaminobenzidine (Sigma) as a chromogen or indirectly by enhanced chemiluminescence (ECL; Amersham). Recombinant DNA work was performed according to standard procedures (Sambrook et al., 1989). The open reading flame BLLF3 (nucleotides 88474-87640, formerly designated BLLF2; Baer et al., 1984) encoding the putative EBV dUTPase was obtained by PCR from genomic DNA of the cell line B95-8. The gene was amplified (35 cycles; 1 rain at 94 °C, 1 min at 59 °C, 2 min at 72 °C) using the primers: UTP-5' 5' CGGGATCCATATGGAGGCCTGTCCACACATA 3' UTP-3' 5' TATGAAGCTTTCATGGACCCGAGGATCC 3'. The primer UTP-5' contains the recognition sequences for the restriction enzymes BamHI and NdeI; the latter also contains the AUG initiator codon (underlined) for the translation of the protein. The triplet TCA corresponding to the TGA stop codon of BLLF3 in the primer UTP3' is also underlined. The amplification product was digested with Nde[ and HindIII and ligated to the large NdeI-HindIII restriction fragment of the vector pET3a/ULS0 (Bj6mberg eta/., 1993; Rosenberg et aI., 1987), kindly provided by O. Bj6rnberg (Lund University, Sweden), In the resulting plasmid pET3a-EBV-dUTPase, the ULSO gene encoding the HSV-1 dUTPase was replaced by the corresponding gene of EBV. The plasmids pET3a-EBV-dUTPase and pET3a/ULS0 direct the expression of the coding region of BLLF3 and ULSO, respectively, as non-fusion proteins in E. coil For the generation of MAbs, the BLLF3-specific BamHI fragment generated after PCR amplification from B95-8 DNA was inserted into the BamHI-digested vector pATH1 (Koerner eta]., 1991). The resulting pIasmid pATH-EBV-dUTPase directs the expression of the BLLF3 open reading flame as a trpE fusion protein. The vector pEM401 was generously supplied by E. McIntosh (University of Queensland, St Lucia, Australia) and allows the expression of a functional human dUTPase (McIntosh et al., 1992) as a non-fusion protein in E. coli (E. Mclntosh, personal communication). The non-fusion proteins or the trpE fusion proteins were expressed in E. coil strain BL21/DE3 (Studier et al., 1990). The proteins were induced by the addition of I mM-IPTG. The extracts were prepared as described below. For the expression of the BLLF3 open reading frame as a non-fusion protein in insect ceils, the gene was amplified using the primers: EB-5' 5' CCTGTCTGTGGATCCATAAATATGGAGGCCTGTCCACACATA3' EB-3' 5' ACAAGGGGGATCCAGGTGTCATTGACCCGACGATCCAAA 3'. The product was digested with BamHI (underlined) and inserted into the BamHI-digested baculovirus transfer vector pAcYM1 (Summers & Smith, 1987). The base exchange of a C for a G as underlined in primer EB-3' resulted in a silent mutation to destroy a BamHI cleavage site originally present in the virus gene, to allow the insertion of the complete reading frame of BLLF3, • Generation of MAbs against the EBV-encoded dUTPase. The production of MAbs against the BLLF3-encoded protein was carried out essentially as described (Kremmer et al., I995). Briefly, Lou/c rats were immunized with gel-purified trpE-dUTPase fusion protein. The fusion protein from crude bacterial lysates was subsequently used in conjunction with the irrelevant trpE-EBNA2 fusion protein (Kremmer et al., 1995) to screen for antibody clones that only reacted with the dUTPase fusion protein. Rat Ig isotypes were determined using biotinylated subclass-specific mouse MAbs; rat IgM clones were not pursued. Positive clones were further analysed by immunofluorescence, Western blot and immunoprecipitation using EBV dUTPase expressed as a non-fusion protein in E. coli, insect cells or in EBV-transformed B cells.

MAb BZ.1 (diluted 1:10) directed against the EBV-encoded BZLF1 protein (Young et al., 1991) was a kind gift from M. Rowe (University of Cardiff, UK). • Bacterial cell extracts and dUTPase assay. Growth and IPTG induction of E. coli containing the appropriate plasmids were performed according to Studier et al. (I990). Fifty ml of bacterial culture at an ODG00 of I"0 were pelleted and washed in 1 mM-TES buffer pH 7'5. Cells were lysed in 1'0 ml of the same buffer by a I5 s sonication using a Branson Sonifier 250. To determine the dUTPase activity, 50 }alof this cell extract was added to 925 lal of a I mM solution of phenol red pH 8"0 at 25 °C. The enzymatic reaction was started by the addition of 25 ~1 of substrate solution containing 2"25 mM-dUTP in I mM-phenol red pH 8"0 and 50 ,M-MgC12, In the presence of dUTPase, the substrate is hydrolysed to yield dUMP, pyrophosphate and H +. The release of H* results in a change in the absorption at 600 nm, which was determined within a Perkin Elmer Lambda 9 Spectrophotometer over a period of 2 rain. The conversion of dUTP to dUMP was also tested by reversed phase HPLC. For this purpose, 25,1 of bacterial extract (see above) was mixed with 250 ~1PBS, 25 I~1of dUTP at 2 mg/ml and 7 ill of 5 mM-MgCl2, and incubated for 5 min at 25 °C. HPLC analysis was performed on a 100C18 5 I~M column (Machery and Nagel) attached to a Waters 510 HPLC system. Separation of the products was carried out under similar conditions to those described by Ashman et al. (1987) for the separation of oligonucleotides. A linear gradient from 100% eluent A (0'08 MK~HPO 4 and 5 mM-tributyl ammoniumhydrogen sulphate) to 60 % eluent A/40% eluent B (methanol) in 40 min at a flow rate of 0"7 ml/min was used for the separation of the reaction products. The retention times of dUTP and dUMP were determined using the above conditions, with PBS added instead of bacterial extract. The specificity of the dUTPase for dUTP as compared with the other dNTPs and the corresponding NTPs was tested by adding 5 p,[ of E. coli cell extract containing either the parental plasmid or the EBV dUTPaseexpressing plasmid to 2 I~1of dNTP or NTP (I0 mM) and 13 #1 of a buffer containing 50 mM-Tris-HCI pH 7"5, 4 mM-MgCI2 and 2 mM-2-mercaptoethanol. The mixture was incubated at 37 °C for 1 h and an aliquot was spotted onto polyethyleneimine (PEI)-cellulose (with fluorescent indicator; Sigma). Separation was carried out by ascending chromatography in a buffer consisting of 0"75 M-KH~PO4 pH 3"5. The nucleotides were visualized with UV light at 260 nm. The Km value of the EBV-encoded dUTPase was determined by stopped-flow analysis according to Larsson (1995). Kinetic measurements were performed at 25 °C in a degassed solution containing 250 laM-TES pH 7"8, 0"05 M-KCI, 5 mM-MgC12, 25 UM-cresol red on a Perkin Elmer Lambda 9 Spectrophotometer. • Criteria for the selection of sera. The EBV status of the sera was established by routine diagnostic methods; the antibody titres against EBNA1 and EBNA2A/2B were determined using baculovirus-infected insect cells expressing the proteins individually (HiIle et aI., 1993). The EBV carrier state is defined by the presence of IgG against EBNA1 and VCA; sera from patients diagnosed with infectious mononucleosis were serologically confirmed by the absence of antibodies against EBNAI and the presence of IgM antibodies against VCA as well as antibodies against the EA. Sera of patients with chronic EBV infection were selected from a cohort of patients exhibiting highly elevated levels of antibodies against EA, VCA, EBNA1 and EBNA2A/2B over a prolonged period of time; in addition, these patients showed strong signs of disease such as fatigue and general malaise. The reactivated EBV infection was serologica[ly defined by elevated titres against EA, EBNA1 and EBNA2. In addition, the ratio of the EBNA1/EBNA2 titres was determined. A value below i, i.e. a higher EBNA2 than EBNA1 titre, was taken in conjunction with the

'-7 9";

ili!iiiiiiiiii!iiiiiiiiiiii~iii~i~ii~iiiiiililiiiiiii other criteria as a sign of reactivated EBV infection (Henle et aL, 1987). Furthermore, sera from patients infected with HIV at various stages of the disease were included since EBV reactivation is often observed in such immunocompromised individuals. The HIV-positive sera were identified in the University Hospital at Homburg by a standard procedure. Sera were initially screened by ELISA (Behring Diagnostika). Positive sera were confirmed by Western blot analysis (Pasteur Diagnostics). For detection of dUTPase-specific antibodies by Western blot analysis, the sera were routinely used at a dilution of i :40 and bound antibodies were visualized using a goat anti-human IgG-horseradish peroxidase conjugate (dilution 1:500).

Results The open reading frame BLLF3 of EBV encodes a functional dUTPase The putative EBV-specific dUTPase, which is encoded by the open reading flame BLLF3 (formerly called BLLF2, nucleotide position 88 4 74-8 7 640; Baer et al., 1984), was PCRamplified and subcloned into the vector pET3a (Rosenberg et aI., 1987). The enzyme was expressed as a non-fusion protein in E. coli and analysed by SDS-PAGE. As shown in Fig. 1 (a), the protein migrated with the expected apparent molecular mass of about 31 kDa. In parallel, molecular clones of the HSVi and the human dUTPase were expressed and exhibited the predicted mobility of 39 kDa and I8 kDa, respectively. In our hands however, we could not detect a rise in the expression of the HSV-1 enzyme after induction with IPTG; this matter was not further investigated. Most importantly, we could detect

(a) pET3a

HSV-1

EBV

0

0

0

2

2

2

0

Detection of the EBV-specific dUTPase in B cells Having established that the BLLF3 open reading frame indeed encodes a functional dUTPase, we produced MAbs against this protein. The gene was expressed as a trpE fusion protein using the pATH1 vector (Koerner et aI., 1991) and used

(b) (i)

Human Time (h) kDa "~ 67

dUTPase activity in the cell lysates containing the EBVencoded enzyme as shown in Fig. l(b). Bacterial extracts from cells harbouring either the parental plasmid (pET3a) or the plasmid expressing dUTPase (pET3a-EBV-dUTPase) were induced with IPTG, harvested after 2 h and incubated with dUTP. The reaction products were tested by reversed phase HPLC for the conversion of dUTP to dUMP. Fig. l(b) shows the elution profile of dUTP and dUMP (i), the incubation with control extract (ii) and clearly demonstrates the conversion of dUTP to dUMP by the bacterial extract containing the virus enzyme (iii). In addition, no conversion of dATP, dTTP, dGTP, dCTP or the corresponding NTPs was observed, indicating that the protein specifically recognizes dUTP. Also, the enzyme does not appear to act as an unspecific phosphatase, i.e. by conversion of dUTP to dUDP or to uridine. Using the bacterial extracts, the Kin value of the enzyme for its substrate dUTP was determined using standard procedures. We found a value of approximately 0"8 ~M-dUTP. A comprehensive enzymatic analysis will be reported elsewhere (S. Bier, P. Sommer, P. Zalud, F. A. Gr~isser and M. Zeppezauer, unpublished results).

2

~, ~ ~

(ii)

(iii) "~

kDa -,9

-,9 4 3

67

"q 43

~130

-91 30

~1 20

~ 20

~ ~

. . . . . . . . .

1

2

3

4

5

6

7

8

No enzyme

pET3a

pET3a- EBV-dUTPase

Fig. 1. (a) Expression of dUTPases in E. coll. The HSV-1, EBV and human dUTPase genes were expressed using pET vectors (Rosenberg et el., 1987). Expression of the dUTPases was induced and lysates of the cells were separated by SDS-PAGE at 0 and 2 h after the addition of IPTG, The proteins were stained by Coomassie brilliant blue. The bands corresponding to the various dUTPases are indicated by arrows on the left. The positions of molecular mass markers are indicated. The marker proteins were, in descending order: BSA, ovalbumin, carbonic anhydrase, trypsin inhibitor and O-lactalbumin (Pharmaeia), (b) Demonstration of dUTPase activity in E, coll. Extracts of E. coil transformed either with the parental vector (pET3a; ii) or with the vector expressing the complete dUTPase (pET3a-EBV-dUTPase, iii) were tested in vitro for their ability to hydrolyse dUTP. The extracts were incubated with substrate and subsequently analysed by HPLC for the conversion of dUTP to dUMP. (i) Calibration using a mixture of dUMP and dUTP. The signals corresponding to dUTP and dUMP are indicated; dUTP eluted after 21.3 min, dUMP had a retention time of 12.26 min. In the reaction mixture with the virus dUTPase, essentially all the substrate was converted to dUMP. Eluent A, 0.08 M-KHaPO4, 5 mM-tributyl ammoniumhydrogen sulphate; eluent B, methanol; flow rate 0.7 ml/min; elution was carried out with a gradient of 0 - 4 0 % eluent B in eluent A.

~-7 9~.

I

(a)

+

+

(b)

+

W

U

W

U

W

U

W

U

W

U

W

U

~

b~ I

+

~.

~.

r-,

Ca. ~t

1

MAb

6B3 W

U

8B9 W

U

5C7 W

1.1

7C11 5D10 W

U

W

U

8D1 W

~a

U i

h--

1-• i •

1

2

3

4

5

6

7

8

9

10 11

MAb 6E12

5F7

6G9

6H6

5B9

•:IO

7F5

Fig. 2. (a) Detection of the EBV-encoded dUTPase in bacteria and insect cells with MAbs by Western blot analysis. The reading frame of the EBV-encoded dUTPase missing the five C-terminal amino acids was expressed as a trpE fusion protein which was used for the immunization and screening of the MAbs using the non-fusion trpE protein as a control. Specific binding by MAb 5A10 is shown in the lanes marked pATH1/EBV-dUTPase and pATH1. Non-induced ( - ) and cells induced ( + ) by indoleacrylic acid were used. The lanes denoted bac-wt and bac-EBV-dUTPase show extracts derived from insect cells infected with wild-type and baculovirus expressing the EBV-dUTPase, respectively. Also, E. coil extracts of cells expressing the EBV, HSV-1 and human dUTPase were assayed as well as purified E. coil dUTPase. +, Induction with IPTG. The positions of molecular mass markers (see Fig. 1) are indicated. (b) Immunoprecipitation of baculovirus-derived EBV dUTPase with various specific MAbs. Extracts of Sf158 insect cells infected with either the wild-type virus (lanes designated w) or baculovirus expressing the EBV dUTPase (lanes designated u) were immunoprecipitated with the various MAbs as indicated, and the immune complexes were analysed by Western blotting using the MAb 5A10 to detect the precipitated enzyme. The position of the dUTPase, indicated by arrows, was determined by applying whole cell extract from baculovirus-infected cells. The bands designated h and I correspond to heavy and light chains of the IgG used for precipitation, respectively, that were detected by the secondary, anti-rat antibody. WCE, whole cell extract.

for the Immunization of rats and for the subsequent screening of the antibodies as described previously (Kremmer et aL, I995). In parallel, the BLLF3 open reading flame was expressed as a non-fusion protein in E. coil and in insect cells using the baculovirus system as described (Hille et aL, 1993). Thirteen MAb clones specifc for the dUTPase were further tested by Western blotting, immunoprecipitation and immunofluorescence. In a Western blot, all antibodies clearly detected the EBV-specific dUTPase expressed as a non-fusion protein in extracts of E. coli and baculovirus-infected insect cells, as well as the trpE fusion proteins from E. coil In contrast, neither the trpE protein alone nor proteins in the wild-type baculovirusinfected cell extract reacted with the antibodies. Clone 5AI0 also did not cross-react with either the HSV-I or the human dUTPase from E. coil. The immunoblot using clone 5A10 (rat IgG2a) is shown in Fig. 2 (a). The antibodies also reacted with the baculovirus-expressed protein in an immunoprecipitation

analysis. This is shown in Fig. 2(b). All antibodies tested immunoprecipitated the baculovirus-expressed protein, while an irrelevant antibody did not precipitate the enzyme (data not shown). The antibody 5A10 that was employed to detect the precipitated dUTPase bound to both a full-length protein and a degraded subfragment in the whole cell extract used as a control (Fig. 2 b). While this band was detected by all the other antibodies tested in the Western blot using insect cell extract, it was not detectable in the precipitates. We do not know why this fragment was not precipitated by the antibodies. Possibly, the epitope detected in the small subfragment was not accessible to the antibodies in the native protein, but was after the denaturing conditions during SDS-PAGE and transfer to the membrane. In the next step, several EBV-positive and EBV-negative cell lines were tested for their expression of the EBV dUTPase. First, the lyric infection cycle was induced by treatment of B

!79 c

(a)

(b) BL41

B95-8

--

--

+

:

IB4

+

--

Jijoye

Raji

-

-

M-ABA-CBL

BJAB _ +

+

+

+

-

+

kDa

~

B95-8 _ +

-

IB4 P3HR1 + _ +

Raji M-ABA-CBL _ + + kDa

~ 43

-~ 43

-., 3~'~ d U T P a s e

-~ dUTPase "30

", 20

:

:

-', 43 ~.9 BZLF1

1

3

4

5

6

7

8

9

10

11

, BZLF1

12

1

2

3

4

5

6

7

8

9 10

11 12

Fi9. 3. (e) Detection of the EBV-encoded dUTPase in TPA-stimulated B cells. The rat NAb 7D6 (dilution 1:20) was used for the demonstration of dUTPase protein in EBV-infected B cell lines. The EBV-negative cell line 8L41 served as a negative control. The cells were either untreated ( - ) or induced with TPA (+). In parallel, the same cell extracts were stained with the mouse NAb BZ.I (dilution I : I O) directed against the BZLFI protein. The bound antibodies were visualized by ECL staining. The positions of the dUTPase, the BZLF-I protein and the molecular mass markers (see Fig. I ) are indicated. (b) Detection of EBV-encoded dUTPase after transient expression of BZLF-1. Cells were either electroporated with 20 pg plasmid pCMV-BZLF1 ( + ) or mock-treated (--), The proteins were detected with the MAbs 7D6 and BZ.1 (see Fig. 3 o). The bound antibodies were visualized by ECL staining, The positions of the dUTPase, BZLF-1 and the molecular mass markers are indicated,

Table 1. Expression of the EBV-encoded dUTPase in B ceils The detection of dUTPase or BZLF-1 in cells either treated with or without T P A or electroporated with or without pCMV-BZLF1 (directing the expression of BZLF-I protein) was assayed by W e s t e r n blot. N T , N o t tested.

dUTPase dUTPase BZLF1 Cell line

(-TPA)

(+TPA)

(-TPA)

BZLF1 (+TPA)

dUTPase

dUTPase

(-pCMV-BZLF1)

(+pCMV-BZLF1)

BZLF1 (-pCMV-BZLF1

BZLF1 (+pCMV-BZLF1)

BL41

.

NT

NT

NT

NT

BJAB B95-8 IB4 Jijoye

NT

NT

NT

NT

--

--

--

q-

+ . +

+

--

+

+

+

+

.

+ +

q-

--

--

NT

NT

NT

NT

P3HR1

NT

NT

NT

NT

-~-

-it-

+

-}-

Rail

+

+

-

-

-

+

-

+

M-ABA M-ABA-CBL Iarc-070

+ . q-

-[-

NT

NT

NT

NT

NT

NT

.

.

.

.

.

.

. +

.

. --

.

.

.

.

.

+

--

NT

NT

NT

NT NT

Iarc-303B

+

-~-

--

--

NT

NT

NT

Iarc-151

+

q-

--

--

NT

NT

NT

NT

Iarc-26I

--

-}-

--

--

NT

NT

NT

NT

Iarc-308

--

~-

--

--

NT

NT

NT

NT

Iarc-290B Iarc-385 Iarc-36

+ q--

+ q-

-NT

-NT

NT NT

NT NT

NT NT

NT NT

--

NT

NT

.

.

.

.

Iarc-631

--

--

NT

NT

.

.

.

.

Iarc-779

-t-

-~-

NT

NT

NT

NT

NT

NT

Iarc-240B

+

-}-

NT

NT

NT

NT

NT

NT

cells w i t h t h e p h o r b o l

e s t e r T P A u s i n g B L 4 1 as a n e g a t i v e

d e t e c t a b l e w i t h a n t i b o d y 7 D 6 , w h i l e n o s i g n a l w a s o b t a i n e d in

et al., 1 9 7 8 ; B o o s et al., 1987). A s

B L 4 1 o r in t h e s t r i c t l y l a t e n t E B V - p o s i t i v e cell l i n e s IB4 a n d M -

in Fig. 3 (a), t h e E B V - p o s i t i v e p r o d u c e r cell l i n e s

A B A - C B L . In t h e i n d u c i b l e cell lines, T P A s t i m u l a t i o n r e s u l t e d

B 9 5 - 8 , J i j o y e a n d Raji c o n t a i n e d p r o t e i n s o f t h e e x p e c t e d size

in a n i n c r e a s e d e x p r e s s i o n o f t h e d U T P a s e (Fig. 3 a, l a n e s 4, 8,

control

(zur H a u s e n

demonstrated

iiiiiiiiiiiiiiiiiii RmT6

Table 2. C h a r a c t e r i z a t i o n o f N A b s d i r e c t e d a g a i n s t the EBV-specific dUTPase

7D6

BL41 --

NAb

IgG subtype

WB*

IFt

IP$

5A10 5B9 6B3 8B9 5C7 7Cli 7D6 8D1 6E12 5F7 7F5 6G9 6H6

2a 2a 2a 2a 2b 2a 2b 2a 2b I 2a 1 2a

+ -+ + + -+ -t+ + + + q-

q+ q-+ -+ + + -+ q-

4+ + q+ q+ + + -I+ + q-

* WB, Western blot analysis. t- IF, immunofluorescence assay. :1: IP, immunoprecipil:ation assay. 10). To ensure that the cells had entered the lytic cycle of replication, we tested the same cell extracts for the presence of the BZLFI protein, the expression of which is a prerequisite for the induction of the cycle. As shown in Fig. 3 (a), we were only able to detect BZLFI expression in TPA-treated B95-8 cells using MAb BZ.1. In addition to the cell lines shown in Fig. 3 (a), further EBV-positive B cell lines were tested for the expression of dUTPase. In most cases a rise in the expression of the protein was observable after TPA treatment. In some cases the protein was already detectable in untreated cells, whereas in other cases the dUTPase could only be observed after TPA stimulation. Furthermore there were cell lines in which no expression of the protein could be detected, even after TPA treatment. These results are summarized in Table i. Since the expression of BZLFI as measured by Western blot analysis might be below the level of detectability, we chose to induce the lyric cycle of replication by electroporation of plasmid pCMV-BZLFI, which directs the expression of BZLF1 under the control of the human cytomegalovirus promoter (Hammerschmidt & Sugden, 1988). As shown in Fig. 3(b) we could detect BZLF1 expression and the concomitant synthesis of dUTPase in B95-8, P3HR-1 and Raji cells, while the strictly latent cell lines IB4 and M-ABA-CBL did not express the dUTPase even in the presence of detectable levels of BZLF1 protein. We were not able to detect plasmid-directed synthesis of BZLF1 in the cell lines Iarc-36 and Iarc-63 i. These results are also summarized in Table 1. We conclude from this data that the EBV-specific dUTPase is conserved among the virus strains tested. We also note that none of the antibodies against the EBV dUTPase recognized either the human enzyme (i.e. in the EBV-negative BL41 cells or in extracts from E. colt) or the HSV-1 enzyme.

+

iNiiiiiiiiii!i!iiiiiiiiiiiiiiiiiii

B95-8 --

+

BL41 --

B95-8 +

+

kDa

69 -'446

~'q30

~,II4

1

2

3

4

5

6

7

8

Fig. 4. Phosphorylation of the EBV-encoded dUTPase. The cell lines BL41 (EBV-negative) and B95-8 (EBV-positive), either untreated ( - ) or TPAstimulated (+), were labelled with 32P-orthophosphate and subjected to immunoprecipitation using the irrelevant rat MAb RmT6 or the dUTPasespecific antibody 7D6. The precipitate was analysed by SDS-PAGE followed by autoradiography using intensifying screens. The positions of 14C-labelled molecular mass markers (Amersham) are indicated. Marker proteins were, in descending order: BSA, ovalbumin, carbonic anhydrase and trypsin inhibitor.

The antibodies were also tested in an immunofluorescence assay using TPA-stimulated cells for their ability to detect the dUTPase. Untreated or TPA-stimulated EBV-negative BL41 cells did not yield a signal, TPA-induced Jijoye ceils harbouring type 2 EBV were clearly stained using M A b 7D6, while untreated cells only gave a faint signal (data not shown). The results concerning the characterization of the antibodies are summarized in Table 2. The EBV-encoded dUTPase is a phosphoprotein Having established that the antibodies also detected the protein in EBV-positive B cell extracts, untreated or TPAinduced B95-8 cells were labelled with 32p~ and subjected to precipitation analysis employing M A b 7D6 or non-specific antibody RmT6. Since we observed a high background of phosphoproteins after the first precipitation (data not shown), the enzyme was purified further by a second round of immunoprecipitation (Gr~sser e~ aI., i991). This procedure yielded a single band migrating at 31 kDa, as shown in Fig. 4, the non-specific antibody RmT6 (rat IgGi) did not precipitate any protein from either the untreated or the TPA-induced cell extract. The specific antibody 7D6 clearly detected the protein in stimulated, but not in untreated cells. The very low amount of radioactive dUTPase precipitated precluded the deterruination of the phosphorylated residues. 80 ¸

304b

203c

>

5A10

>

>

kDa

cases) and chronic infection (2/7 cases). We also tested a panel of sera derived from patients with various stages of HIV infection that also exhibited serological markers of reactivated EBV infection. A significant number (5/24 cases) also had detectable levels of anti-dUTPase antibodies. A representative immunoblot using sera of patients with chronic EBV infection is shown in Fig. 5. The sera were tested either with cell extracts from dUTPase-containing insect cells or with extracts from cells infected with the wild-type baculovirus. The results obtained with the various sera are summarized in Table 3.

191 6 7

~.9 4 3

*.9 3 0

20

1

2

3

4

5

6

Fig. 5. Antibodies in sera of patients with chronic EBV infection detect the EBV-encoded dUTPase. Extracts of baculovirus-infected insect cells were employed in a Western blot analysis to test for the presence of the virus dUTPase (lanes 1, 3 and 5). Wild-type bacutovirus-infected extract was applied in lanes 2, 4 and 6. The EBV dUTPase-specific rat MAb 5A10 was used as a positive control. Sera 304b and 203c detected a band corresponding to the dUTPase (arrows). The positions of the molecular mass markers (see Fig. 1 ) are indicated.

Sera of patients with mononucleosis, reactivated or chronic EBV infection contain antibodies against the dUTPase We then asked whether the EBV-encoded dUTPase is expressed during primary, reactivated or chronic EBV infection, The synthesis of the enzyme in lyrically infected cells should result in the induction of specific antibodies in the patients. For this purpose, sera were tested in an immunoblot using the baculovirus-expressed protein. While the sera of three EBVnegative individuals and of 33 EBV-positive healthy carriers did not exhibit detectable activity, the presence of dUTPasespecific antibodies was found in sera of patients with mononucleosis (5/18 cases), reactivated EBV infection (7/20

Discussion On the basis of sequence comparisons, it had previously been suggested that the EBV-encoded open reading frame BLLF3 encodes a dUTPase (McGeoch, I990). A prior publication had shown that dUTPase activity can be detected in EBV-transformed B cells induced to enter the lytic cycle of virus replication (Williams et al., 1985). Here, we provide direct evidence that the open reading frame BLLF3 of EBV indeed encodes a protein of approximately 31 kDa which is active as a dUTPase in bacterial cell lysates. The protein specifically converted dUTP to dUMP, but did not utilize the other dNTPs or NTPs and had no unspecific phosphatase activity. Using the bacterial extracts, the Km value of the enzyme for its substrate dUTP was determined. We found a value of 0"8 gM, which is comparable to the values determined for other virus and cellular dUTPases (for example Shlomai & Kornberg, 1978; Williams & Cheng, 1979; Wist, 1979). A comprehensive analysis will be reported elsewhere (S. Bier, P. Sommer, P. Zalud, F. A. Gr/isser and M. Zeppezauer, unpublished results). The presence of a dUTPase in EBV could be required for the virus to replicate in resting epithelial tissue or resting B cells. For instance, HSV-I mutants deficient in their dUTPase have a severely reduced neurotropism (Pyles et aI., I992). These authors point out that the conversion of dUTP, leading to dTTP, might be a prerequisite for the replication of HSV-I in otherwise resting cells. Using MAbs directed against the enzyme, we were able to demonstrate that the protein can be induced during the lyric cycle of EBV replication in accordance with a prior report (Williams et a]., 1985). The MAb developed against the dUTPase reacted with the protein of B cells harbouring different EBV strains. The dUTPase was only detectable in cell lines that are known to enter the lyric cycle of replication, either spontaneously like B95-8 (Fig. 3) or by stimulation with TPA. The induction of the dUTPase could also be observed in those cells after transfection with a plasmid which directs the synthesis of BZLF-1; however, the dUTPase was not inducible by TPA or plasmid-directed expression of BZLF-1 in strictly latent cell lines like IB4 and M-ABA-CBL (King et al., 1980). Our data are compatible with the idea that EBV supplies its own dUTPase upon induction of the lyric cycle replication. However, our data do not show that the expression of the

i!iiiiiiiiiiiiiiiiiiiii iiiil iii i iiiiiiiiiiiiiiii iiiiiii.iii Table 3. Immune response against the EBV-specific dUTPase Patients

EBV-negative healthy individuals EBV-positive healthy carriers Infectious mononucleosis Reactivated EBV infection, HIV-negative Chronic EBV infection Reactivated EBV infection, HIV-positive

Responsive/total

Percentage

0/3

0

0/33 5/18 7/20 2/7 5/24

dUTPase is restricted to cells that have entered the lyric cycle of virus replication. Additional experiments will be necessary to clarify this point. We demonstrated that the EBV-encoded dUTPase is a phosphoprotein. We were not able to detect phosphorylated dUTPase in unstimulated cells, indicating that the protein might be phosphorylated upon stimulation of virus replication. We assume, however, that the level of protein present in untreated cells was too low to be detectable, since TPA treatment resulted in an increase in virus dUTPase expression. The protein expressed in bacterial cells was active with a rather low Km value. It remains to be seen whether the protein isolated from B cells exhibits a different Km value than the bacterially expressed protein. It was proposed that cellular dUTPases are inactivated through dephosphorylation upon infection by HSV-1 (Lirette & Caradonna, 1990). More recent data, however, suggest that phosphorylation might serve to translocate the human enzyme to the nucleus (Ladner et aI., 1996). Experiments are now under way to determine the effect of the expression of the EBV dUTPase on the activity of cellular dUTPases. Most importantly, we demonstrated that normal, healthy EBV-infected carriers do not show antibodies against the dUTPase, while an elevated number of patients with primary infection or with diseases associated with a reactivated EBV infection had antibodies against the protein. We take this as an indication that rather high levels of the protein must be expressed in lyrically infected cells. This notion is further supported by our previous finding that patients with chronic EBV infection develop antibodies against the EBV-specific DNase and DNA polymerase, which are expressed during the lyric cycle of EBV replication (Jones et al., 1988). There are several possible explanations for the fact that not all sera from this latter cohort of patients had antibodies against the dUTPase. For instance, it is conceivable that the appearance of antibodies depends on the stage of the primary infection at which patients present for diagnosis. Secondly, although we detected the enzyme in most of the cell lines tested so far, additional subtypes of the virus might exist that elicit antibodies that do not recognise the dUTPase from the B95-8 strain. Finally, the immune response to the lytic cycle proteins

0 27"7 35 28"5 20"8

could differ between the various patients. Experiments are now under way to assay sera from patients with EBV-related malignancies like Hodgkin's lymphoma and NPC for the presence of antibodies against the dUTPase. Sera from patients with NPC might be the most promising source of such antibodies since these patients often exhibit very high titres of antibodies directed against lytic cycle proteins (for review see Yip ef al., I996). Individuals with a compromised immune system are prone to develop several clinically overt diseases like oral hairy leukoplakia or fatal EBV-associated malignancies. The failure of an otherwise apparently intact immune system to suppress the replication of EBV during chronic EBV reactivation is not understood, and treatment with antiviral drugs like acyclovir often do not yield satisfying results, possibly due to mutations in the key virus enzymes. The inhibition of the dUTPase by specifically designed drugs might interfere with the replication of EBV by inducing the degradation of newly synthesized virus DNA. The development of drugs that inhibit the replication of EBV and/or reinfection of cells with the virus could thus be employed in the management of EBV-associated diseases. We thank Barbara G~irtnerfor critical reading of the manuscript, M. Rowe, G. Lenoir, O. Bj6rnberg and E.M. McIntosh for generously providing us with MAb BZ.1, cell lines and the plasmids pET3a/ULS0 and pEM401, respectively.Supportedby a grant from the Universit~itdes Saarlandes to F.G.

References Ashman, K., Bosserhoff, A. & Frank, R. (1987). High-speedpreparative

reversed-phase high-performance liquid chromatography of synthetic oligonucleotides.]ournal of Chromatography 39Y, 137-140. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Haffull, G., Hudson, G. S., Satchwell, S. C., Seguin, C.,

Tuffnell,P. S. & Barrell, B. G. (1984). DNA sequenceand expressionof the B95-8 Epstein-Barrvirus genome. Nature 310, 207-2II. Bergman, A. C., Bj6rnberg, 0., Nord, J., Nyman, P. O. & Rosengren, A. M. (1994). The protein p30, encoded at the gag-pro junction of mouse

mammary tumour virus, is a dUTPase fused with a nucleocapsidprotein. Virology 204, 420-424. Bj6rnberg, O., Bergman, A. C., Rosengren, A. M., Persson, R., Lehman,

I. R. & Nyman,P. O. (1993). dUTPase from herpes simplexvirus type I: _~80~

purification from infected green monkey kidney (Veto) cells and from an overproducing Escherichia colt strain. Protein Expression and Purification 4, 149-159.

Boos, H., Berger, R., Kuklik-Roos, C., Iftner, T. & Mueller-Lantzsch, N. (1987). Enhancement of Epstein-Barr virus membrane protein (LMP) expression by serum, TPA, or n-butyrate in latently infected Raji cells. Virology 159, 161-I65. Bornkamm, G., Hudewentz, J., Freese, U. K. & Zimber, U. (1982). Deletion of the non-transforming Epstein-Barr virus strain P3HR-1 causes fusion of the large internal repeat to the DSL region. Journal of Virology 43, 952-968. Chu, G., Hayakawa, H. & Berg, P. (1987). Electroporation for the efficient transfection of mammalian cells with DNA. NucleicAcids Research 15. 1311-I326.

Crawford, D.H., Epstein, M.A., Bornkamm, G.W., Achong, B.G., Finerty, S. & Thompson, J. (1979). Biological and biochemical observations on isolates of EB virus from the malignant epithelial cells of two nasopharyngeal carcinomas. International Journal of Cancer 24, 294-302.

polymerase in the chronic fatigue syndrome. Archives of Internal Medicine 148, 1957-I960.

King, W., Thomas-Powell, N., Raab-Traub, N., Hawke, H. & Kieff, E. (1980). Epstein-Barr virus RNA. V. Viral RNA in a restringently infected, growth-transformed ceil line. Journal of Virology 36, 506-518. Klein, G., Lindahl, T., Jondahl, M., Leibold, W., Menezes, J., Nilsson, K. & Sundstr6m, C. (1974). Continuous lymphoid cell lines with characteristics of B-cells (bone marrow-derived), lacking the Epstein-Barr virus genome and derived from three human lymphomas. Proceedingsof the National Academy of Sciences, USA 85,995-999. Knutson, J.C. & Tinsley, T.W. (1974). Replication of a nuclear polyhedrosis virus in a continuous ceil culture of Spodoptera frugiperda : purification, assay of infectivity, and growth characteristics of the virus. Journal of Virology 14, 934-944. Koerner, T. J., Hill, I. E., Myers, A. M. & Tzagoloff, A. (1991). Highexpression vectors with multiple cloning sites for construction of trpE fusion genes: pATH vectors. Methods in Enzymology 194, 477-490.

EI-Hajj, H.H., Zhang, H. & Weiss, B. (1988). Lethality of a dut (deoxyuridine triphosphatase) mutation in Escherichia coil. Journal of Bacteriology 170, 1069-1075.

Kremmer, E., Kranz, B., Hille, A., Klein, K., Eulitz, M., Hoffmann-Fezer, G., Feiden, W., Herrmann, K., Delecluse, H.-J., Delsol, G., Bornkamm, G. W., Mueller-Lantzsch, N. & Gr~;sser, F. A. (1995). Rat monoclonal antibodies differentiating between the Epstein-Barr virus nuclear antigen 2A (EBNA2A) and 2B (EBNA2B). Virology 208, 336-342.

Fennewald, S., Van Santen, V. & Kieff, E. (1984). Nucleotide sequence of an mRNA transcribed in latent growth-transforming virus infection indicates that it may encode a membrane protein. Journal of Virology 51, 411-419.

S.J. (1996). Characterization of distinct nuclear and mitochondrial forms of human deoxyuridine triphosphate nucleotidohydrolase. Journal of Biological Chemistry 271, 7745-7751.

Freter, C. E. (1990). Acquired immunodeficiency syndrome-associated lymphomas. Monographs of the National Cancer Institute 10, 45-54.

Larsson, G. (1995). The structure and function of dUTPase. PhD thesis, University of Lund.

Gadsden, H. H., Mclntosh, E. M., Game, J. C., Wilson, P. J. & Haynes, R. H. (1993). dUTP pyrophosphatase is an essential enzyme in Saccharomyces cerevisiae. EMBO Journal 12, 4425-4431. Giroir, L.E. & Deutsch, W.A. (1987). Drosophila deoxyuridine triphosphatase. Purification and characterization. Journal of Biological Chemistry 262, 130-134.

Lenoir, G. M., Vuillaume, M. & Bonnardel, C. (1985). The use of lymphomatous and lymphoblastoid cell lines in the study of Burkitt's lymphoma. In Burkitt's Lymphoma: A Human Cancer Model, IARC publication number 60, pp. 309-318. Edited by G. Lenoir, G. O'Connor & C. L. M. OIweny. Lyon: IARC Scientific Publications.

Gr~sser, F.A., Haiss, P., Gottel, S. & Hueller-Lantzsch, N. (1991). Biochemical characterization of Epstein-Barr virus nuclear antigen 2A. Journal of Virology 65, 3779-3788. Gr~sser, F.A., Sauder, C., Haiss, P., Hille, A., Konig, S., Gottel, S., Kremmer, E., Leinenbach, H. P., Zeppezauer, M. & Mueller-Lantzsch, N. (1993). Immunological detection of proteins associated with the Epstein-Barr virus nuclear antigen 2A. Virology 195, 550-560. Hammerschmidt, W. & Sugden, B. (1988). Identification and characterization of oriLyt, a lyric origin of DNA replication of Epstein-Barr virus. Cell 55, 427-433. Henle, W., Henle, G., Andersson, J., Ernberg, I., Klein, G., Horwitz, C. A., Marklund, G., Rymo, L., Wellinder, C. & Straus, S. E. (1987). Antibody responses to Epstein-Barr virus-determined nuclear antigen (EBNA)-I and EBNA-2 in acute and chronic Epstein-Barr virus infection. Proceedings of the National Academy of Sciences, USA 84, 570-574. Hille, A., Klein, K., B~umler, S., Griisser, F. A. & Mueller-kantzsch, N. (1993). Expression of Epstein-Barr virus nuclear antigen 1, 2A and 2B in the baculovirus expression system: serological evaluation of human antibodies to these proteins. Journal of Medical Virology 39, 233-241. Hinuma, Y., Konn, M., Yamaguchi, J., Wudarski, D. J., Blakeslee, J. R. & Grace, T. J., Jr (1967). Immunofluorescence and herpes-type virus particles in the P3HR-1 Burkitt lymphoma cell line. Journal of Virology 1, I045-105 I. Jones, J. F., Williams, H., Schooley, R. T., Robinson, C. & Glaser, R. (1988). Antibodies to Epstein-Barr virus-specific DNase and DNA

'.804

kadner, R. D., HcNulty, D. E., Carri, S. A., Roberts, G. D. & Caradonna,

Lirette, R. & Caradonna, S. (1990). Inhibition of phosphorylation of cellular dUTP nucleotidohydrolase as a consequence of herpes simplex virus infection. Journal of Cell Biochemistry 43, 339-353.

McGeoch, D.J. (1990). Protein sequence comparisons show that the 'pseudoproteases' encoded by poxviruses and certain retroviruses belong to the deoxyuridine triphosphatase family. Nucleic Acids Research 18, 4105-4110.

Hclntosh, E. H., Ager, D. D., Gadsden, H. H. & Haynes, R. H. (1992). Human dUTP pyrophosphatase: eDNA sequence and potential biological importance of the enzyme. Proceedingsof the National Academy of Sc&nces, USA 89, 8020-8024; Erratum 90, 4328. Hartinez, M. A., Vartanian, J. P. & Wain-Hobson, S. (1994). Hypermutagenesis of RNA using human immunodeficiency virus type 1 reverse transcriptase and biased dNTP concentrations. Proceedingsof the National Academy of Sciences, USA 91, 11787-11791.

Miller, G. (1990). Epstein-Barr virus: biology, pathogenesis and medical aspects. In Virology, 2nd edn, pp. 1921-1958. Edited by B. N. Fields & D. M. Knipe. New York: Raven Press. Miller, G. & Lipman, H. (1973). Release of infectious Epstein-Barr virus by transformed marmoset leukocytes. Proceedingsof the National Academy of Sciences, USA 70, 190-I94. Miller, G., Rabson, M. & Heston, L. (1984). Epstein-Barr virus with heterogeneous DNA disrupts latency. Journal of Virology 50, 174-182. Miyashita, E. H., Yang, B., kam, K. M. C., Crawford, D. H. & ThorleyLawson, D. A, (1995). A novel form of Epstein-Barr virus latency in normal B cells in vivo. Ceil 80, 593-601.

i!ii!iilili i i l Niedobitek, G., Young, L.S., Lau, R., Brooks, L., Greenspan, D., Greenspan, J. S. & Rickinson, A. B. (1991 ). Epstein-Barr virus infection in oral hairy leukoplakia: virus replication in the absence of a detectable latent phase. Journal of General Virology 73, 3035-3046.

Pulvertaft, R.J.V. (1964). Cytology of Burkitt's tumour (African iymphoma). Lancet i, 238-240. Pyles, R. B., Sawtell, N. M. & Thompson, R. L. (1992). Herpes simplex virus type 1 dUTPase mutants are attenuated for neurovirulence, neuroinvasiveness, and reactivation from latency. Journal of Virology 66, 6706-6713.

Rochford, R. & Mosier, D. E. (1995). Differential Epstein-Barr virus gene expression in B-cell subsets recovered from lymphomas in SCID mice after transplantation of human peripheral blood Iymphocytes. Journal of Virology 69, 150-155. Rosenberg, A. H., Lade, B. N., Chui, D. S., Lin, S.W., Dunn, J.J. & Studier, F. W. (1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56, 125-135.

Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor Laboratory. Shlomai, J. & Kornberg, A. (1978). Deoxyuridine triphosphatase of Escherichia coil Purification, properties, and use as a reagent to reduce uracil incorporation into DNA. Journal of Biological Chemistry 253, 3305-3312. Studier, F.W., Rosenberg, A.H., Dunn, J.J. & Dubendorff, J.W. (1990). Use of T7 RNA polymerase to direct expression of cloned genes. Methods in Enzymology 185, 60-89.

Traut, T.W. (1994). Physiological concentrations of purines and pyrimidines. Molecular and Cellular Biochemistry 140, 1-22. Williams, M, V. (1988). Herpes simplex virus-induced dUTPase: target site for antiviral chemotherapy. Virology 166, 262-264. Williams, M.V. & Cheng, Y.-C. (1979). Human deoxyuridine triphosphate nucleotidohydrolase. Purification and characterization of the deoxyuridine triphosphate nucleotidohydrolase from acute lymphocytic leukemia. Journal of Biological Chemistry 254, 2897-2901. Williams, M.V., Holliday, J. & Glaser, R. (1985). Induction of a deoxyuridine triphosphate nucleotidohydrolase activity in Epstein-Barr virus-infected cells. Virology 142, 326-333.

Wist, E. (1979). Partial purification of a dUTPase and its effect on DNA synthesis in isolated HeLa cell nuclei. Biochimica et Biophysica Acta 565, 98-106. Yip, T. T. C., Lau, W. H., Ngan, R. K. C., Poon, Y. F., Joab, I., Cochet, C., Ho, J. H. C. & Lo, T. Y. (1996). Role of Epstein-Barr virus serology in the prognosis of nasopharyngeal carcinoma: the present and the future. Epstein-Barr Virus Report 3, 25-33. Young, k.S., Lau, R., Rowe, M., Niedobitek, G., Packham, G., Shanahan, F., Rowe, D., Greenspan, D., Greenspan, J., Rickinson, A. & Farrell, P. (1991). Differentiation-associated expression of the EpsteinBarr virus BZLF1 transactivator in oral hairy leukoplakia. Journal of Virology 65, 2868-2874. zur Hausen, H., O'Neil, E. J., Freese, K. & Hecher, E. (1978). Persisting oncogenic herpes-virus induced by tumour promoter TPA. Nature 272, 373-375.

Summers, M. D, & Smith, G, E, (1987). A Manual of Methods for Bacu]ovirus Vectors and Insect Cell Culture Procedures. College Station: Texas Agriculture Experimental Station, Bulletin 1555.

Received 15 January 1996; Accepted 11 July 1996

~ 8 0 .c