Cloning and Expression of Two Chalcone Synthase and a ... - JIPB

Acta Botanica Sinica 植 　　物 　　学 　　报

2004, 46 (5): 588－594

http://www.chineseplantscience.com

Cloning and Expression of Two Chalcone Synthase and a Flavonoid 3'5'Hydroxylase 3'-end cDNAs from Developing Seeds of Blue-grained Wheat Involved in Anthocyanin Biosynthetic Pathway YANG Guo-Hua1, 2 , LI Bin 1 , GAO Jian-Wei1 , LIU Jian-Zhong1 , ZHAO Xue-Qiang1 , ZHENG Qi1 , TONG Yi-Ping3 , LI Zhen-Sheng1 * (1. State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, The Chinese Academy of Sciences, Beijing 100101, China; 2. College of Chemistry and Life Sciences, Tianjin Normal University, Tianjin 300074, China; 3. Research Center for Eco-environmental Sciences, The Chinese Academy of Sciences, Beijing 100085, China)

Abst r ac t: Using reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) strategies, two chalcone synthase (CHS) cDNAs were cloned from developing seeds of blue-grained wheat, both of the deduced peptides contain 394 amino acids, and share 98.9% of amino acid seque nce identity and th e nucleot ide sequen ces have the identity of 96. 0%, and o ne flavono id 3'5'hydroxylase (F3 '5 'H) 3'-end cDNA was isolated. Four CHS genomic DNAs were cloned from Thinopyrum ponticum (Podp.) Z. W. Liu et R. R.-C. Wang (ThpCHS.tg), blue-grained wheat (TaCHS.bg), white-grained offspring of light blue-grained wheat (TaCHS.wg) and Chinese Spring (2n=42)(TaCHS.csg), respectively. Although these four genomic DNAs were isolated from different materials, they are very high homologous and each has one intron. The difference of the four CHS genomic DNAs mainly exists in intron. Through DNA alignment we found that one CHS cDNA (TaCHS.t1) came from one of the parents, Th. ponticum, the other one (TaCHS.w1) had the identity of 100% with white grain parent. This indicated that CHS genes from two parents expressed at the same developing stage in blue-grained wheat. Southern blotting analysis showed that they have at least four copies in wheat, the copy numbers in different color grains are not significantly different, but they are different from that of Th. ponticum. CHS in blue-grained wheat belongs to a CHS multifamily. Rever se Nort hern analysis indicate d that t he CHS expr essed st rongly in the developing blue-grained seeds at early stage (15 d after flowering, DAF), but F3 '5 'H and dihydroflavonol 4reductase (DFR) transcripts accumulated less than that of CHS at early stage. However, at the lat er de velo ping stage (21 DAF), F3 '5'H an d DFR t ranscripts accum ulat ed m ore than that of CHS, t he transcripts of CHS could hardly be detected. The expression order of the three genes is the same as the order of the biosynthetic steps in anthocyanin biosynthesis. At the same time, CHS genes cloned from seeds have not been detected in leaves of blue-grained wheat, but F3 '5 'H and DFR expressed strongly in leaves. This showed th at the expression of CHS genes cloned by u s had tissu e specificit y. RT-PC R indicated that the transcripts of F3 '5'H accumulated a lot in the developing seeds of blue- and whitegrained wheats at 21 DAF, but the transcripts of CHS and DFR accumulated in the blue-grained wheat more than those of white-graine d wheat and Chinese Spring at th e same deve loping stage. Therefo re, we proposed that anthocyanin biosynthetic pathway existed in blue-grained wheat and the expression of the secondary structure genes in anthocyanin biosynthetic pathway was coordinately regulated by regulatory gene(s) during the period of blue pigment formation. Ke y wo rds: blue-grained wheat; anthocyanin biosynthetic pathway; chalcone synthase (CHS); flavonoid 3'5'-hydroxylase (F3 '5 'H); reverse Northern analysis Blue-grained wheat was derived fromthe hybrid of Triticum aestivum (2n=42)× Thin opyrum ponti cum (2n=70). The F1 hybrid was backcrossed to various wheat cultivars and a blue-grained substitution line with 42 chromosomes was derived (Li et al., 1982; 1983). In the selfing progeny of this substitution line, a plant with 41 chromosomes and its grains wit h blue pigmen t were iso lated . Th is p lant is a

mo nos omic sub st itu tio n o f one ch ro mos ome from Th . ponticum for 4D of common wheat. The blue pigmentation gene or gene(s) controlling the formation o f blue pigment is located on the Th. ponticum chromosome(s) and especially express ed in the aleuro ne lay er of endo sperm and has distinct dosage effect. Four kinds of grains, which were dark blue, medium blue, light blue and white, were observed

Received 19 May 2003 Accepted 28 Aug. 2003 Supported by the National Natural Science Foundation of China (30170491). * Author for correspondence. Tel(Fax): +86 (0)10 64889381; E-mail: .

YANG Guo-Hua et al.: Cloning and Expression of Two Chalcone Synthase and a Flavonoid 3'5'-Hydroxylase 3'-end cDNAs from Developing Seeds of Blue-grained Wheat Involved in Anthocyanin Biosynthetic Pathway

in a single spike of the selfed blue monosomic plant (Li et al., 1983; 1986). The chromoso me fragment (s) from Th . ponti cum det ected b y GISH was co-s egregat ed with the blu e-grained ch aracter (Yan g et al., 2002). We p redicted that the gene(s) controlling the formation of blue pigment in aleuron e layer was o riginat ed fro m the g enome of Th . ponticum. Prev ious biochemical analys is results showed that the blue-g rained aleurone lay er consis ted of at least eig ht different pigment s (Gao et al., 2000; 2001). It s uggest ed that the gene(s) from Th. ponti cum is clos ely relat ed with th e pro duction of flav onoid s. To iden tify the identity of the blue-g rained gene(s), we planned t o clone allthe genes involved in the anthocyanin biosynthetic pathway in b lue-grained wh eat and tried to establish t he relationsh ip between the express ion patterns of these genes and the blue-pigmentation ch aracter and ultimately found the gene(s) directly responsible for the blue-pigmentation. Although the genetics of the blue-grained wheat has been well characterized, the molecular mechanism of the biosynthet ic pat hway o f blue pigmen ts in the blu e grain is s till unclear yet. Chalcone synthase (CHS) catalyzes the first step in the biosyn thes is o f flavo noid s (Holt on and Corn ish, 1995; Shirley, 2002), which are important for the pigmentation of flo wers and other part s of plan ts. Genes enco ding CHS con stitu te a multig ene family in wh ich t he cop y number varies among plant species and functional divergence appears to have occurred repeatedly (Koes et al., 1990; Shirley, 2001; Shirley, 2002; Yang et al., 2002). CHS gen e-specific expression in soybean seed coats shows that multiple CHS genes are expressed in seed coats (Todd and Vodkin, 1996). The expression of CHS is an important control step in the biosynthesis of flavonoids. CHS transcription is regulated by endogenous programs and in response to environmental signals (Thain et al., 2002). Aida et al. (2000) repo rted t he mod ificat io n of flower co lo r in to ren ia (Toreni a fournieri) by re-introduction of t he dihydroflavon ol-4-reductase (DFR) gene o r the CHS gene. Chalco ne and s tilbene synthases (CHS and STS) catalyze condensation reactions of p-coumaroyl-CoA and three C (2)-unit from malonyl-CoA, but cat alyze different cyclization reactions to produce naringenin chalcone and resveratrol, respectively (Suh et al., 2000). Flavonoids are a diverse group of pheno lic secondary met abolites. Many of th e comp ounds belo nging to t his group are potent antioxidants in vitro and epidemiological studies suggest a direct correlation between high flavonoid intake and decreased risk of cardiovascular disease, can cer and oth er age-related diseases. En hancin g flavo noid

５８９

biosynthesis in chosen crops may provide new raw materials that have the potential to be used in foods designed for specific benefits to hu man health (Verhoeyen et al., 2002; Bartel and Matsuda, 2003). Analysis of the flavonoids accumulated in tissues from mutant lines implies that (genetic) control of flavonoid biosynthesis is highly tissue-specific (Koes et al., 1990). The production of anthocyanins in fruit tissues is h ighly cont rolled at t he dev elop men tal lev el (Jaakola et al., 2002). The ubiquito us plant enzymes phenylalanine ammonia-lyase (PAL) and CHS are key biosynt het ic cat aly s ts in ph eny lp ro p an o id an d flavo n oid assembly, respectively (Moore et al., 2002). The maize Lc and C1 genes expressed in petu nia differentially activate the promoters of the chalcone synthase genes CHSA and CHSJ in the same way as the homologous petunia genes do (Quattrocchio et al., 1993).

1 Materials and Methods 1.1 Plant materials All materials were kept in the laboratory of 705 Research Gro up, State Key Laboratory of Plant Cell and Chro mosome Engineering, Institute of Genetics and Developmental Biology, Th e Chin ese Academy of Sciences (CAS). Young spikes of dark blue-grained wheat were harvested at 15 and 21 DAF, respectively . White-grained wheat from the progeny of blue-grained monosomic line and the backcross parent, Chinese Spring, were planted in the field. The spikes were cut and frozen in liquid nitrogen and stored in a –80 ℃ refrigerator for total RNA extraction. 1.2 RNA extraction and RT-PCR Total RNAs were isolated from developing seeds of dark blue-grained at different developing stages and its young seedlings . We applied an economical, modified SDS/phenol method to extract RNA. The total RNA samples were digested with DNaseⅠ before use. Four microgrammes of mixed total RNA of blue-grained wheat seeds at different developmental stages were reverse t ran s crib ed in a v olu me o f 20 µL as d es crib ed as Invitrogen TM. Two microlitres of the first-strand cDNA solution dilu ted fiv e times was u sed for PCR, which h ad a total volume of 50 µL including 0.2 µmol/L degenerate oligonucleotide of each primer and 2.5 unit of TaKaRa LA Taq DNA polymerase with GC buffer Ⅰ. The 20-b degenerate fo rward primer h as th e sequ en ce 5'-(C/ T)T(A/ T/ G/ C) ATGATGTA(C/T)CA(A/ G)GG(A/T/G/C)TG-3' and t he reverse primer has the s equence 5'- (A/T/ G/C)CC(A /G)AA (A/T/G/C)CC(A/G)AA(A/T/G/C)A(A/G)(A /T/G/C)AC(A/ T/G/C)CCCCA-3', which were used to amplify CHS fragmen t fro m blu e-grained wheat. PCR was conducted in a

５９０

DNA Thermal Cycler (Perkin-Elmer Gene Amp PCR system 9600). The amplification product was fractionated in 0.8% agarose gel and recovered by DNA Fragment Quick Purification/Recover Kit (Dingguo, Beijing). A cco rd in g t o t he seq uen ce o f DFR in Gen Ban k (accession number:AY209183), the full length primers were us ed : DFR1F 5'-ATGGA CGGGA ATA AAGGGCCGG-3'; DFR1R 5'-CGCAGCAGCGCTGGCTTATTATGT-3'. F3'5'H fo rwa rd d eg en e rat e p rimer was d es ig n ed a s 5'AAAGAATTCTT(T/C)ACIGC(A/T/G/C)GGIAC(A/T/G/C) GA (T / C )A C I- 3' an d t h e r ev er s e p r imer as 5 'AAATCTA GAICC(A/ T/G/ C)AT(A/T/ G/C)AT(A /T/G/C) GCCCA(T/G/C)AT(G/A)TTIAC-3'. 1.3 5'-RACE and 3'-RACE CHS gene-specific primers (GSP1－2) were deduced from the sequence of CHS-p. The 5'-RACE was carried out essentially according to the manufactu re’s instructions usin g th e kit from In vit rogen TM Life Techn ologies (www. invitrogen.com). Total RNA mixture from different developing stages of blue-grained seeds was reversibly transcribed using 5'- (A/T/G/C)CC(A/G)AA(A/T/G/C)CC(A/G)AA(A/ T/ G/C)A(A /G)(A/ T/G/ C)A C(A /T/ G/C)CCCCA-3' as t he primer. After purification and terminal transferase reaction, 5 µL of the resulting TdT product was used as a template in the first-ro und PCR in the p resence of the Abridged Anc h o r p r i me r ( I n v i t r o g e n TM ) a n d GS P 1 ( 5 ' CATGGCGGTGATCTCCGAGCA G-3'). Fo r th e seco nd round PCR, 5 µLof the diluted first-round PCR product was re-amp lified with AUAP (Inv it ro gen TM) an d GSP2 (5'TTGTTCTCGGCGATGTCTTTGG-3'). For 3'-RACE, two CHS gene-specific primers (GSP3－4), were designed according to the sequence of CHS fragment. In the first round PCR, the abridged universal amplification p r ime r ( A U A P ) a n d C H S - G S P 3 ( 5 ' CAGGATGGCCAAGCAACCACTG-3') were used and total RNA mixtu re was reversibly trans crib ed us in g AP (Invitrogen TM) as the primer. The product was used as template for the first round PCR. For the second round PCR, 2 µL of the diluted first round PCR product was re-amplified wit h A U A P ( In v i t ro g en TM ) an d C H S -GSP4 (5 'CACTGGAGAGGGTA AGGAGTGG-3'). At the same time, two F3'5'H gene-sp ecific primers (GSP1－2) were synthesized according to the sequence of F3'5'H-p. F3'5'H-GSP1: 5'-TCGACGCCACTCTCCCTTCCTCG-3', F3'5'H-GSP2: 5'AGGACTGCGAGGTGGA CGGCTAC-3'. Th e met hod of PCR amplificatio n of F3'5'H 3'-end is the same as that of CHS. A final PCR was performed t o create a full-lengt h version of the CHS gene that completely lacked endogenous

Ａｃｔａ　Ｂｏｔａｎｉｃａ　Ｓｉｎｉｃａ　　植物学报　　Ｖｏｌ．４６　　Ｎｏ．５　　２００４

5'-untranslated region. The following PCR primers were us ed: CHS1F 5'-ATGGCGGCGACGATGACGGTGGA-3'; CHS1R 5'-CTAGGCTGTGACTGGGACGCTAT-3'. These primers were used to clo ne the CHS genes from genomic DNAs of Th. ponticum, blue-grained wheat, white-grained wheat and Chinese Spring by PCR. 1.4 Southern and reverse Northern blotting analyses Genomic DNAs were digest ed by end onucleases and then fractionated in 0.8% agarose gel, blotted onto HybondN+ membranes by capillary act ion with 0.4 mol/L NaOH overnight and cross-linked to the Hybond-N+ memb ranes via baking at 80 ℃ for 2 h. Pre-hybridization, hybridization and washing of the filter were p erformed as described (Sambroo k et al., 1989) with minor modifications, we used an economical and effective hyb ridization s olution which con tain s 0.3 mo l/L sodium phosphate (pH 7.2), 2% BSA, 1 mmol/L EDTA and 7% SDS. Reverse North ern prob e was lab eled as the following procedure: adding 4 µg t otal RNA, 1.5 µL Oligo-dT, and RNase-free water up to a total volume of 12.5 µL to a 1.5 mL eppendorf tube, 65 ℃ water bath for 15 min, then p ut the tube immediately on ice for at least 2 min. Add the second mixture which contains 1 µLmixture (dATP, dGTP, dTTP 10 mmol/L each), 5 µL 5×buffer, 1 µL RNasin (40 U/µL), 1 µL M-MLV (200 U/µL) or reverse transcriptase (SuperScript Ⅱ TM), 2.5 µL [α-32 P]dCTP (10 Ci/µL) and RNase-free water t o a total volume of 12.5 µL to th e first mixture, mixed thoroughly. The tu be was incubated at 42 ℃ fo r 50 min, then added the same volume (25 µL) of 0.4 mol/L NaOH to the tube to denature the labeled probe at room temperature for 10 min. Th e procedures of hybridizatio n, washing and auto-radiograp hy were the same as that of Southern blotting hybridization. 1.5 DNA sequencing and analysis The amplified CHS and F3'5'H fragments, and the CHS and DFR full-length genes were subsequently purified and cloned into pGEM-T Easy Vector (Promega, USA). The sequences of t he clone were d etermined by automatic sequencing using the ABI PRISM TM Big DyeTM Terminator Cycle (Applied Biosystem/Perkin-Elmer, San Jose, CA), then th e n ucleo tid e s equ en ces were co mpared with th e s equences in NCBI using BLAST program. The positive fragments or genes were defined as CHS-p, DFR and F3'5'H-p.

2

Results

2.1 Isolation of two CHS cDNAs, one DFR cDNA and a F3'5'H (belongs to P450) cDNA 3'-end Through DNA sequencing, we obtained two d ifferent

YANG Guo-Hua et al.: Cloning and Expression of Two Chalcone Synthase and a Flavonoid 3'5'-Hydroxylase 3'-end cDNAs from Developing Seeds of Blue-grained Wheat Involved in Anthocyanin Biosynthetic Pathway

through sequence alignment. This indicates that genes on the pathway at the primary steps controlling the secondary metabolites of anthocyanin biosynthetic pathway are very conservative du ring the plant evolution. Ou r results sugges ted that CHS expressed in wheat seeds with t iss ue specificity, but F3'5'H and DFR expressed not only in seeds but also in seedlings, which accumulated in young leaves may have other function(s). In the blue-grained wheat, CHSs iso lat ed were d eriv ed from co mmo n wh eat an d Th . ponticum. This suggests that there must have some genes fro m Th . p ont icu m express ed no rmally in blue-grain ed wheat, and there may have s ome key gen es to cont rol or contribute to the blue pigmentation. The reverse Northern blotting analysis suggested that CHS expressed prior to F3'5 'H, and DFR exp ressed later than F3'5'H did. This ord er is iden tical to the expression pattern of genes in the anthocyanin biosynthetic pathway in other plant species (Holton and Cornish, 1995; Shirley, 2002). Therefore, there may exist an anthocyanin biosynthetic pathway in the formation of blue pigment. RT-PCR res ults s ho wed th at th ere may hav e so me reg ulat ory gene(s) to reg ulate the expressio n of thes e genes o n the pathway in the developing seeds of white-grained and bluegrained wheats, but the regulatory pattern in blue-grained seeds may not be the same as that in white-grained wheat derived fro m blue-grained mo noso mic line and Chin ese Spring. Acknowledgements: We thank Dr. ZHANG Xue-Yong for his critical review of this manuscript. References:

５９３

Jaakola L, M aatta K, P irttila A M , Torronen R, Karenlampi S, Hohtola A. 2002. Expression of genes involved in anthocyanin biosynthesis in relation to anthocyanin, proanthocyanidin, and flavonol levels during bilberry fruit develop ment. Plant Physiol, 130: 729－739. Koes R E, van Blokland R, Quattrocchio F, van Tunen A J, M ol J. 1990. Chalcone synthase promoters in petunia are active in pigmented and unpigmented cell typ es. Plant Cell, 2: 379－ 392. Li Z S, M u S M , Jiang L X, Zhou H P. 1983. A cytogenetic study of blue-grained wheat. Z. Pflanzenzuchtg, 90: 265－272. Li Z S, M u S M , Zhou H P, Wu J K. 1986. The establishment and application of blue-grained monosomics in wheat chromosome engineering. Cereal Res Commun, 14: 133－137. Li Z-S, M u S-M , Jiang L-X, Zhou H-P , Wu J-K, Yu L. 1982. A study on blue-grained monosomic wheat (1). Acta Genet Sin , 9: 431－439. (in Chinese with English abstract) M o Y, Nagel C, Taylor L P. 1992. Biochemical complementation of chalcone synthase mutants defines a role for flavonols in functional pollen. Proc Natl Acad Sci USA, 89: 7213－7217. M oore B S, Hertweck C, Hopke J N, Izumikawa M , Kalaitzis J A, Nilsen G, O’Hare T, Piel J, Shipley P R, Xiang L, Austin M B, Noel J P. 2002. P lant-like biosynthetic p athway s in bacteria: from benzoic acid t o chalcone (1). J Nat Prod, 65: 1956－1962. Quatt rocchio F, Wing J F, Lep pen H, M ol J, Koes R E. 1993. Regulatory genes cont rolling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes. Plant Cell, 5: 1497－1512. Sambrook J, Fritsch E F, M aniatis T. 1989. M olecular Cloning: a

Aida R, Yoshida K, Kondo T, K ishimoto S, Shibat a M . 2000.

Laboratory M anual. 2nd ed. New York: Cold Spring Harbor Laboratory Press. 737－753.

Copigmentation gives bluer flowers on transgenic torenia plants

Shirley B W. 2001. It takes a garden. How work on diverse plant

with the ant isense dihydroflavonol 4-reductase gene. Plant Sci, 160: 49－56.

sp ecies has contribut ed to an understanding of flavonoid metabolism. Plant Physiol, 127: 1399－1404.

Bartel B , M atsuda S P T. 2003. Seeing red. Science, 299: 352－

Shirley B W. 2002. Biosynthesis of flavonoids and effects of

353. Dellaport S L, Wood J, Hicks J B. 1983. A rapid method for DNA

stress. Curr Opin Plant Biol, 5: 218－223. Suh D Y, Fukuma K, Kagami J, Yamazaki Y, Shibuya M , Ebizuka

extraction from plant tissue. Plant Mol Biol Rep, 1: 19－21.

Y, Sankaw a U. 2000. Identificat ion of amino acid residues

Gao J W, Liu J Z, Li B, Li Z S. 2001. Isolation and purification of function total RNA from blue-grained wheat endosperm tis-

important in the cyclization reactions of chalcone and stilbene synthases. Biochem J, 1: 229－235.

sue containing high levels of atarches and flavonoids. Plant

Thain S C, M urtas G, Lynn J R, M cGrath R B, M illarA J. 2002.

Mol Biol Rep, 19: 185a－185i. Gao J-W, Liu J-Z, Li B , Feng B-S, Yu G-Q, Li Z-S. 2000. Prelimi-

T he circadian clock t hat controls gene exp res s ion in Arabidopsis is tissue specific. Plant Physiol, 130: 102－110.

nary study on pigments in seed aleurone layer of blue-grained

Todd J J, Vodkin L O . 1996. D uplications t hat s uppress and

wheat. Acta Bot Boreali-Occidentalia Sin , 20: 936－941. (in Chinese with English abstract)

deletions t hat res tore expression from a chalcone synt hase multigene family. Plant Cell, 8: 687－699.

Holton T A, Cornish E C. 1995. Genetics and biochemist ry of

Verhoeyen M E, Bovy A, Collins G, M uir S, Robinson S, de Vos

anthocyanin biosynthesis. Plant Cell, 7: 1071－1083.

C H, Colliver S. 2002. Increasing antioxidant levels in toma-

５９４

Ａｃｔａ　Ｂｏｔａｎｉｃａ　Ｓｉｎｉｃａ　　植物学报　　Ｖｏｌ．４６　　Ｎｏ．５　　２００４ toes through modification of the flavonoid biosy nt het ic pathway. J Exp Bot, 53: 2099－2106.

Yang J, Huang J, Gu H, Zhong Y, Yang Z. 2002. Duplication and adapt ive evolut ion of t he chalcone sy nt has e genes of

Yang G-H , Li B , Liu J -Z,Ying J, M u S-M , Zhou H-P , Li Z-S.

Dendranthema (Asteraceae). Mol Biol Evol, 19: 1752－1759.

2002. Identification of blue-grained w heat and it s irradiation-mutated offsprings by genomic in situ hybridiz ation (GISH). Acta Genet Sin , 29: 255－259. (in Chinese with English abstract)

(Managing editor: ZHAO Li-Hui)