Conversion of Sox17 into a Pluripotency Reprogramming Factor by ...

EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS Conversion of Sox17 into a Pluripotency Reprogramming Factor by Reengineering Its Association with Oct4 on DNA RALF JAUCH,a# IRENE AKSOY,b# ANDREW PAUL HUTCHINS,b#* CALISTA KEOW LENG NG,a,c XIAN FENG TIAN,b JIAXUAN CHEN,b PAAVENTHAN PALASINGAM,a PAUL ROBSON,b,d LAWRENCE W. STANTON,b,d PRASANNA R. KOLATKARa,d Laboratory for Structural Biochemistry and bStem Cell and Developmental Biology, Genome Institute of Singapore, Singapore; cSchool of Biological Sciences, Nanyang Technological University, Singapore; Department of Biological Sciences, National University of Singapore, Singapore a

Key Words. Sox transcription factors • Induced pluripotent stem cells • Reprogramming • Pluripotency • Endoderm differentiation

ABSTRACT Very few proteins are capable to induce pluripotent stem (iPS) cells and their biochemical uniqueness remains unexplained. For example, Sox2 cooperates with other transcription factors to generate iPS cells, but Sox17, despite binding to similar DNA sequences, cannot. Here, we show that Sox2 and Sox17 exhibit inverse heterodimerization preferences with Oct4 on the canonical versus a newly identified compressed sox/oct motif. We can swap the cooperativity profiles of Sox2 and Sox17 by exchanging single amino acids at the Oct4 interaction interface

resulting in Sox2KE and Sox17EK proteins. The reengineered Sox17EK now promotes reprogramming of somatic cells to iPS, whereas Sox2KE has lost this potential. Consistently, when Sox2KE is overexpressed in embryonic stem cells it forces endoderm differentiation similar to wild-type Sox17. Together, we demonstrate that strategic point mutations that facilitate Sox/Oct4 dimer formation on variant DNA motifs lead to a dramatic swap of the bioactivities of Sox2 and Sox17. STEM CELLS 2011;29:940–951

Disclosure of potential conflicts of interest is found at the end of this article.

INTRODUCTION The Sox and POU (Oct) families of transcription factors consist of 20 and 14 members, respectively, and often act synergistically during vertebrate development (reviewed in [1–3]). Despite their diverse biological roles, the specificity of Sox proteins for DNA elements is largely indistinguishable and the amino acids involved in specific DNA contacts are highly conserved [4]. Therefore, a transcription factor acting alone may lack site-specific binding, though selective dimerization with binding partners may provide the means to achieve specificity in transcriptional control [5]. Indeed, several distinct Sox/POU pairs have been implicated as key regulators of cellular fates: Sox2/Oct4 are essential factors in embryonic stem (ES) cells [6–8]; Sox2/Brn2 is important in neural development [9]; Sox11/Brn1 pair regulates glial cells [10]; and Sox17 has been shown to cooperate with Oct4 during mesendoderm formation [11]. In early development, though both are capable of interaction with Oct4, Sox2, and Sox17 bring about fundamen-

tally different developmental effects. Sox2 is required for the development of the epiblast [12], whereas Sox17 is essential in the formation of the definitive gut endoderm [13]. In addition, while Sox2 is a pluripotency factor, Sox17, when forcibly expressed in mouse and human ES cells pushes the cells toward an endoderm-like cell fate [14]. Furthermore, Sox17 cannot replace Sox2 in reprogramming somatic cells into induced pluripotent stem (iPS) cells [15]. This demonstrates that, despite binding essentially the same DNA motif, Sox2 and Sox17 have highly divergent developmental capabilities. We became interested in competitive interactions between Sox2 and Sox17 for the binding to Oct4 for two reasons. First, our recent x-ray crystallographic analysis of the DNAbinding domain (DBD) of Sox17 revealed that the Oct4 interaction surface displays a markedly different electrostatic interface when compared with Sox2. These differences could potentially impart distinct abilities on Sox2 and Sox17 to interact with Oct4 [16]. Second, our single-cell gene expression analysis of preimplantation development [17] indicated that prior to the formation of the Oct4þ/Sox17þ primitive

Author contributions : R.J., I.A., and A.P.H.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; C.K.L.N., X.F.T., J.C., and P.P.: collection of data; P.R., L.W.S., and P.R.K.: financial support, administrative support, data analysis and interpretation, manuscript writing, final approval of manuscript. #

R.J., I.A., and A.P.H. contributed equally to this article.

*Present address: Immunology Frontier Research Centre, Osaka University, Osaka, Japan. Correspondence: Lawrence W. Stanton, Ph.D., Genome Institute of Singapore, 60 Biopolis Street #02-01, Singapore 138672. Telephone: þ65-6-808-8006; Fax: 6-808-8291; e-mail: [email protected] or Prasanna R. Kolatkar, Ph.D., Genome Institute of Singapore, 60 Biopolis Street #02-01, Singapore 138672. Telephone: þ65-6-808-8006; Fax: 6-808-8291; e-mail: [email protected] Received C AlphaMed February 17, 2011; accepted for publication March 14, 2011; first published online in STEM CELLS EXPRESS April 6, 2011. V Press 1066-5099/2009/$30.00/0 doi: 10.1002/stem.639

STEM CELLS 2011;29:940–951 www.StemCells.com

Jauch, Aksoy, Hutchins et al.

941

endoderm and Oct4þ/Sox2þ epiblast, individual early inner cell mass cells coexpress all three factors, thus, representing a biological system where competition between Sox2 and Sox17 could have real development consequences. The role of the Sox2/Oct4 pair as an inducer of pluripotency is well established [8, 18], and there is evidence that Sox17 and Oct4 functionally cooperate during endoderm differentiation [11, 19, 20]. It is, therefore, conceivable that Sox2 and Sox17 can compete for Oct4 and form stable complexes on specific genomic regions characterized by distinct composite cis-regulatory motifs. To test this, we set out to identify variant sox/oct motif configurations in genomic regions occupied by Sox2 and Oct4 in mouse ES cells [21] and identified a novel compressed element. In vitro heterodimerization assays, however, revealed that Sox17/Oct4, but not Sox2/Oct4, was able to cobind this element, whereas the Sox2/Oct4 complex predominates on the canonical site. By designing mutations using structural models, we generated point mutations that swapped the heterodimerization preferences of Sox2 and Sox17. This change not only affected the dimerization capability of Sox17/Oct4 versus Sox2/Oct4, but concomitantly converted Sox17 into a potent reprogramming factor and Sox2 into an inducer of the endodermal fate.

procedures [23]. Binding buffer contains 20 mM Tris-HCl pH 8.0, 50 lM ZnCl2, 100 mM KCl, 10% glycerol, 2 mM b-merceptoethanol, 0.1 mg/ml bovine serum albumin (BSA), and 0.1% (v/ v) Igepal CA-630. A total of 250 nM dsDNA probes were mixed with proteins in binding buffer and incubated for 1-hour at 4 C in dark. Samples were loaded into a prerun 12% (w/v) 1 Trisglycine polyacrylamide gel in 1XTG (25 mM Tris, pH 8.3; 192 mM glycine) buffer and imaged.

Reporter Assays Approximately 105 human embryonic kidney 293 cells in 24-well plates were transfected with 275 ng pGL4-TK luciferase reporter plasmids containing a dual repeat of idealized compressed (50 CGGCGCGGCATTGTATGCAAATCGGCGGCGCGGCGCGGC ATTGTATGCAAATCGGCGGCG0 -30 ) and canonical (50 -GG CGCGGCATTGTCATGCAAATCGGCGGCGGGCGCGGCATT GTCATGCAAATCGGCGGCG-30 ) motif, 2 ng pRL-SV40 Renilla transfection control and 360 ng pcDNA3.1/nV5 plasmids contaning Sox or Oct4 coding sequences using Lipofectamine and Optimem reagents (Invitrogen). After overnight incubation, the transfection mix was replaced with Dulbecco’s modified Eagle’s medium growth media containing 10% fetal bovine serum þ 2 mM L-glutamine. Cells were lysed after 3 days and the luciferase and renilla activities were detected using the dual luciferase assay kit (Promega). The experiments were repeated twice with three technical replicates each.

Generation and Characterization of iPS cell

MATERIALS

AND

METHODS

Computational Analysis To search for different sox/oct motif configurations, we took the motif derived from the Oct4/Sox2 chromatin immunoprecipitation (ChIP)-seq data [21] and implemented a position–weight matrix (PWM) search tool that scans through sets of FASTA sequences (further details are contained in the Supporting Information procedures). To construct different configurations of the sox/oct motif, we generated variants of the motifs, inserting unbiased base pairs in between the sox/oct motif, or making reverse complement versions. This way we constructed different hypothetical configurations of the sox/oct motif, from the canonical (soxf_0bp_octf), order (octf_0bp_soxf), convergent (soxf_0bp_octr; f and r signify the strand of the motif element) and divergent (octr_0bp_soxf). We also removed or introduced spacer base pairs (soxf_-1bp_octf, soxf_0bp_octf, soxf_1bp_octf .. soxf_10bp_octf).

Recombinant Proteins HMG domains of mouse Sox2, Sox7, and Sox17 were cloned and heterologously expressed and purified to homogeneity as described [16, 22]. An extended version of the Sox2HMG (denoted Sox2HMGl spanning amino acids 33–141, swissprot-id P48432) was cloned using the TOPO and GATEWAYTM LR technologies (Invitrogen, Singapore, www.invitrogen.com) and purified as described [22]. The POU domain of mouse Oct4 (residues 126–289, swissprot id P20263) was produced as described in the Supporting Information procedures.

Site-Directed Mutagenesis Amino acid substitutions were introduced using the QuikChangeXL site-directed mutagenesis kit (Stratagene, Singapore, www.genomics.agilent.com) using DNA oligos listed in Supporting Information procedures. Recombinant mutant proteins were expressed and purified as described above.

Electrophoretic Mobility Shift Assays (EMSAs) All EMSAs were carried out using double-stranded 50 Cy5-labeled DNA (Sigma Proligo, Singapore, www.sigmaaldrich.com; see Supporting Information Table S1) following published

www.StemCells.com

The iPS assay was carried out using procedures modified from [24]. Experimental details of the iPS generation and validating experiments such as quantitative (Q) RT-PCR, immunostaining, viral titer determination, teratoma, and chimera formation are described in the Supporting Information procedures.

Generation of Stable Sox Variant Expressing Cell Lines The stable introduction of V5 and Venus-tagged Sox proteins into E14 mouse ES cells is detailed in the experimental procedures.

RESULTS Analysis of Sox/oct Motif Configurations in Mouse ESC We devised a PWM scanning tool to quantify the occurrence of different configurations of the composite Sox2/Oct4 DNA binding motif (see Experimental Procedures and Supporting Information Figure S1). We systematically assessed sox/oct motif configurations (Fig. 1A). For motif scans, we interrogated 200bp windows of the mouse genome that have been shown by ChIP to be occupied by Sox2 and Oct4 in ES cells [21]. Motif frequencies for differently spaced sox/oct in the canonical orientation (soxf_nbp_octf where f denotes the forward orientation, r the reverse complement, and n the number of spacer base pairs) are detailed in Figure 1B (see Supporting Information Figure S2 for a complete list). As expected, the canonical sox/oct motif was most strongly enriched (370% above background). Many of the other motifs with spacer nucleotides inserted were found to be only modestly enriched. The second most abundant motif detected in the Sox2/ Oct4 dataset was a novel ‘‘compressed’’ motif (here labeled as: soxf_-1bp_octf, Figure 1C, a 54% increase over background). The compressed motif differs from the canonical motif by deletion of a single nucleotide at position seven of the canonical motif that is only weakly specified in the

942

Reengineering Sox Transcription Factors

Figure 1. In silico discovery of sox/oct variant motifs. (A): Schematic of the variant motifs generated in this study. All the combinations were explored with 0–10 bp of spacer between the sox and oct parts of the motif, also a ‘‘compressed’’ motif was created by deleting the base pair between the sox and oct motif. (B): Frequency of variant motifs with 1, 1 through 10 bp’s of spacer. The frequency of motif is expressed as percentage increase over a random list of genomic coordinates. A second, independently, generated random list is included for comparison. (C): The WebLogos of motifs discovered by the position weight matrix matching tool. (D): Percentage increase over background of motif against the different ChIP-seq lists derived from [21], ‘‘Oct4/Sox2’’ is an overlap list containing all of the overlapping Oct4/Sox2 bound sites. The ‘‘Oct4’’ and ‘‘Sox2’’ lists contain all of the Oct4 and Sox2 binding sites, respectively. Abbreviation: ChIP, chromatin immunoprecipitation.

canonical motif (Fig. 1C). We recovered the sequences identified by this alternative, compressed PWM and generated a weblogo representation (Fig. 1C). Next, we compared the motif frequencies in genomic regions bound by Sox2 or Oct4 alone with regions cobound by Sox2 and Oct4 (Fig. 1D). As anticipated, canonical and compressed composite motifs were detected less frequently at sites occupied by individual transcription factors (TFs) as compared with cobound sites.

Profiling of Sox/Oct4 Binding to Differentially Configured Motifs To assess the preference of Sox2 and Oct4 to physically assemble on differentially configured sox/oct motifs, we conducted EMSAs using purified DBDs of Sox2 and Oct4. We screened the heterodimerization potential of Sox2/Oct4 DBD pairs on a panel of systematically modified sox/oct motifs (Fig. 1A). As expected, we observed a strong cooperative interaction of Sox2 and Oct4 on the canonical element (Fig. 2A, lanes 5–7). However, the dimerization was substantially diminished if a spacer of one or two base pairs was introduced (Fig. 2A, lanes 8–13). Heterodimerization was enabled on elements with a spacer length between 3 and 10 nucleotides, albeit with reduced efficiency, suggesting an additive or

weakly competitive binding mode (Fig. 2A, lanes 15–39). If the arrangement of the motifs is altered (Fig. 1A, 2A, lanes 41–49), dimer formation is abrogated for a changed motif order (octf_0bp_soxf), strongly diminished for the converging motif (soxf_0bp_octr) and reduced for the diverging orientation (soxr_0bp_octf). Unexpectedly, the newly identified compressed motif did not enable heterodimer formation (Fig. 2A, lanes 2–4). We reasoned that three scenarios could explain the abundance of a compressed motif in genomic regions cotargeted by Sox2 and Oct4 despite the inability of the two proteins to heterodimerize on this sequence. First, the over-representation of the compressed motif could be caused by independent ChIP enrichment of Sox2 or Oct4 bound singly to this site and the averaging over a large population of cells creates the notion of co-occurrence. Second, compressed motifs could be located in the proximity to canonical motifs that recruit functional Sox2/Oct4 heterodimers causing it to copurify in ChIP experiments, whereas the actual binding event occurs at a nearby canonical motif. Third, the apparent enrichment of the compressed motif is inflated by its similarity to the canonical motif. To explore the last two issues, we measured the cooccurrences of both canonical and compressed motifs in the Sox2/Oct4 bound regions. There are 1,784 Sox2/Oct4-bound


943

regions, and the canonical motif is present at least once in 995 of these locations, whereas the compressed motif occurs 548 times. A total of 425 regions contained both a compressed and a canonical motif, which was a statistically significant co-occurrence (p ¼ 8.6 e 13; Fig. 2B). To establish that the compressed motif constitutes a genuine motif and not a cryptic motif hidden within the canonical motif we recovered the locations of the motifs and analyzed the intersection of genomic coordinates (Fig. 2C). We found that 135 compressed/canonical motifs shared genomic coordinates within 1bp of each other’s coordinate centers, indicating motif overlap (Fig. 2C). However, the majority of compressed motifs (528) are distinct from the canonical motif suggesting that the compressed motif constitutes a genuine motif variant. Finally, we asked whether the compressed motif is actually a subset of the canonical motif. To this end, we conducted a careful analysis of the PWMs and the sequences that match the PWM and found that the majority of sequences retrieved by the PWMs for the compressed and canonical motifs are distinct (Supporting Information Procedures). We previously have shown that the binding affinities of Sox2 and Sox17 to sox motifs are indistinguishable [16]. To compare the Oct4 heterodimerization properties of Sox2 and Sox17, we assessed their differential assembly using to same panel of sox/oct motif configurations tested for Sox2 and Oct4. We observed that the overall pattern of heterodimerization on most motif configurations recapitulates observations made for the Sox2/Oct4 pair (Fig. 2D, lanes 5–49). However, in contrast to the inability of Sox2 and Oct4 to coassemble on the compressed motif, Sox17 and Oct4 exhibited a cooperative-binding mode on this element (Fig. 2D, lanes 2–4). This finding indicates a qualitative binding difference of the Sox2/Oct4 versus the Sox17/Oct4 heterodimers on DNA motifs, which might constitute the biochemical basis for their distinct roles in mammalian development.

Assembly of Distinct Sox/Oct4 Pairs Depends on the cis-Regulatory Context Figure 2. Differential assembly of Sox2HMG plus Oct4POU (A) and Sox17HMG plus Oct4 (D) on a series of different motif configurations. Motif configurations were systematically designed as outlined in Figure 1A using 30-bp DNA elements containing identical Sox (CATTGTC) and Oct4 (ATGCAAAT) sequences. To minimize binding anomalies due to cryptic elements at the periphery or within the spacer region, we used idealized motifs (CATTGTC for sox and ATGCAAAT for oct) and introduced G’s and C’s as spacer and boundary nucleotides. Each DNA element was mixed with individual transcription factor proteins as well as with both Sox2 and Oct4 DBDs in combination. A total of 250 nM each cy5-labeled DNA element was incubated with 50 nM Sox2HMGl/Sox17HMG and 250 nM Oct4POU proteins alone and in combination followed by PAGE to assess the formation of ternary Sox/Oct4/DNA complex. Using Oct4POU in excess was necessary to ensure similar shifts in lanes where only Sox2/17 or Oct4 was added because the active fraction of Oct4 was measured to be 5-fold lower than the active fraction of Sox2HMGl (data not shown). The position of the various protein DNA complexes are marked by arrows. The number of spacer basepairs is indicated above and below the gels. X ¼ 1 denotes the compressed and X ¼ 0 the canonical elements. TANDEM denotes two consecutive sox motifs preceding the oct motif. The co-occurrence of canonical and compressed motifs within genomic regions cobound by Sox2 and Oct4 in mouse embryonic stem cells is depicted in (B). The significance of the overlap as compared with a randomly generated list was established using a binomial test. (C): Shows the portion of motifs with shared genomic coordinates.

www.StemCells.com

To further dissect the differential assembly of the Sox2/Oct4 versus Sox17/Oct4 pairs, we conducted competition binding experiments. Figure 3A lanes 3–5 indicate that all binding partners retarded equal amounts of DNA when added individually. To assess whether the sequence of the addition of the protein components affects the heterodimerization efficiency, we premixed the labeled DNA probe first with either Sox2 or Sox17 or the Oct4-binding partners before adding the remaining proteins to the reaction. Lanes 7–8 and 10–11 reiterate that only the Sox17/Oct4 heterodimer was capable of assembling on the compressed sox/oct element, whereas the cobinding of Sox2 and Oct4 was obstructed. The heterodimerization of Sox17 and Oct4 on the compressed element was not abrogated in the presence of Sox2 (lanes 16–19). A similar experiment was carried out to study the assembly behavior on the canonical sox/oct motif (Fig. 3B). Sox2 and Oct4 exhibited a cooperative binding mode on this element as indicated by a complete supershift of the Oct4/DNA complex if Sox2 was present (lanes 7–8). However, when Sox17 and Oct4 were incubated with the canonical element, the supershift of the Oct4/DNA complex was incomplete. Furthermore, when the three factors were incubated together, the majority of supershifted Oct4 migrated in a Sox2/Oct4/ DNA complex, whereas the Sox17/Oct4/DNA complex was of markedly lower abundance. The bulk of the Sox17 protein remained singly bound to DNA. The sequence of

944


Figure 3. Differential assembly of Sox2/Oct4 and Sox17/Oct4 on the (A) compressed and (B) canonical elements. Proteins were added to 250 nM DNA elements in the sequences indicated above the lanes. To distinguish shifts caused by Sox2 and Sox17, a N- and C-terminally extended Sox2-HMG (Sox2HMGl) domain was used in these experiments. As a consequence, both, the Sox2/DNA and the Sox2/Oct4/DNA complex, migrate slower than the corresponding Sox17 complexes, allowing us to visualize a Sox2/Oct4 and Sox17/Oct4 DNA complex on the same gel. Protein–DNA mixtures were incubated for 10 minutes before the next protein component was added. Sox2 and Sox17 were kept at 50 nM and Oct4POU at 250 nM final concentration. Positions of binary Sox/DNA and Oct4/DNA as well as of ternary Sox/Oct4/DNA complexes are indicated. (C): Model summarizing the differential assembly of Sox2/Oct4 and Sox17/Oct4 on the canonical versus the compressed element.

addition did not significantly affect the experimental outcome. We conclude that Sox2 out-competes Sox17 on the canonical sox/oct element. Together, although Sox17/Oct4 binding was sterically possible on the canonical element (lanes 10–11) complex formation was strongly enhanced on the compressed element for the Sox17/Oct4 pair (Fig. 3A, lanes 10–11). Conversely, Sox2/Oct4 dimerization was occluded on the compressed motif, presumably due to steric hindrance (Fig. 3C). We also tested another F-group Sox protein, Sox7, a shorter version of the Sox2 protein restricted to the core of the HMG domain, and we altered the spacer residue of the canonical motif to establish the significance of our findings (Supporting Information Figure S3). In summary, Oct/Sox assembly on the compressed element is a robust property of the HMG domain of F-group Sox proteins Sox7 and Sox17, whereas Sox2/Oct4 dimerization is impaired on this motif.

Point Mutations at the Oct4 Interaction Surface Swap the DNA-Dependent Dimerization Potential of Sox2 and Sox17 Next, we sought to identify the structural elements that equip Sox2 and Sox17 with distinct Oct4 interaction surfaces. Structural studies on Sox17 [16] and Sox2 [25, 26] revealed that their DNA-binding and DNA-bending mechanisms are virtually identical. However, we observed a difference at helix three [16] that constitutes the presumed Oct4 contact interface [25, 26]. Interestingly, B group Sox proteins contain a basic lysine within this helix that is replaced by an acidic glutamate in F group Sox proteins (Fig. 4A) [16]. To test if this residue affects the differential assembly of Sox2 and Sox17 with Oct4, we reciprocally mutated lysine 95 in Sox2 into a glutamate (Sox2KE) and glutamate 122 in Sox17 into a lysine (Sox17EK, Fig. 4B). We also generated Sox2 and Sox17 constructs in which all eight helix-3 residues in proximity to the putative


945

Figure 4. (A): Alignment of the amino acid sequence of all mouse Sox proteins. The Sox subfamilies [1] are indicated to the right. The numbering corresponds to the Sox17 sequence. Alpha helices are marked with a red bar. The Phe-Met wedge is indicated with an orange bar below the alignment and other DNA interacting residues are marked by black closed circles. Highly conserved and similar sequences are shaded in black or gray. Empty blue circles correspond to the additional Oct1/Sox2 interface contacts seen in 1o4x (Oct1/Sox2/DNA) excluding the critical K95(sox2). (B): Sequences of helix3 of the wild-type and mutated Sox proteins under study. Mutated amino acids that deviate from the wildtype are depicted in red. The position of the highlighted sequences with the structure is indicated with a dotted line. Structural model prepared with pymol [27] by using the structural coordinates for Sox17 [16] and the Sox2/Oct1 on DNA [26]. The van der Waals surface of the DNA derived from the Sox2/Oct1 structure is shown in light gray. Sox17 (blue) was superimposed onto Sox2 (gray). Oct1 is shown in black. The glutamate (Sox17) and the lysine (Sox2) mutated are shown as ball-and-sticks. The position of other helix-3 residues that differ between Sox2 and Sox17 are indicated. (C): Point mutations at the Sox/Oct4 interface swap the differential assembly behavior of Sox2 and Sox17 on the canonical versus the compressed element. Indicated Sox proteins were incubated with DNA individually and in combination with Oct4. Positions of binary Sox/DNA and Oct4/DNA as well as of ternary Sox/Oct4/DNA complexes are indicated.

Oct4 contact interface were converted into their corresponding counterparts found in the other Sox protein, leading to a complete swap of helix-3 between Sox2 and Sox17 (denoted Sox2H3-17 and Sox17H3-2, Fig. 4B). As further controls, we produced proteins with swapped helix-3 while retaining the www.StemCells.com

Glu122 in Sox17 and Lys95 in Sox2 (Sox17H3-2exE and denoted Sox2H3-17exK; Fig. 4B). Next, we assessed the potentials of the six mutated Sox proteins for coassembly with Oct4. The ability of the mutated Sox2 constructs, Sox2KE and Sox2H3-17, to dimerize with Oct4 on the canonical motif was

946

substantially weakened as illustrated by an incomplete supershift of the Sox-monomers (compare Fig. 4C lanes 4, 8, and 10). However, when Lys95 was kept and only the other seven amino acids of the Oct interaction region were mutated a wild type-like binding was observed (Fig. 4C, lane 4 and 12). Conversely, Sox17EK and Sox17H3-2, cooperated more strongly with Oct4 than wild type (WT) Sox17 on the canonical element, whereas Sox17H3-2exE cooperates as weakly as the WT Sox17 protein (lanes 6, 12, 16, and 18). Consistently, assessment of binding of the mutated Sox constructs to Oct4 on the compressed element showed the reverse pattern. Mutating the Sox2HMG to Sox2KE or Sox2H3-17 installed the ability of this construct to assemble with Oct4 that was denied to the wild-type domain or Sox2H3-17exK (lanes 22, 26, 28, 30). Conversely, the Sox17EK and Sox17H3-2 mutations eliminated a key feature necessary for coassembling with Oct4 on the compressed element, whereas Sox17H3-2exE cobound with Oct4 in a wild-type manner (lanes 24, 32, 34, 36). These results establish that a single amino acid at the Oct4 contact interface swaps the binding preferences of the Sox2/Oct4 versus the Sox17/Oct4 transcription factor pairs on motif variants. So far, only the impact of the spacing and orientation between idealized sox/oct motifs has been assessed. However, the bipartite POU domains of Oct proteins have been shown to adopt pronounced structural rearrangements on different binding sites [28, 29] and subtle sequence variations within the sox and oct sites, as well as in the periphery, may also affect dimerization of Sox and Oct proteins. To test whether Sox2 and Sox17 also exhibit qualitative binding differences with Oct4 on nonideal elements, we conducted differential assembly experiments on sox/oct motifs known to recruit Sox2 and Oct4 in vivo [8, 26, 30–32]. All tested motifs exhibit a canonical arrangement of sox and oct subsites but vary within the recognition sequences and the periphery (Fig. 5A). Indeed, we found that the overall efficiency of dimer formation differs between the tested elements (Fig. 5B). For example, the formation of a Sox2/Oct4 dimer on the canonical Utf1 element is less efficient than on most other elements. Nevertheless, the overall pattern corroborates the model that the canonical arrangements of sox/ oct subsites favors binding of Sox2 and Oct4, whereas the compressed versions of all tested motifs abrogates Sox2/Oct4 assembly and Sox17/Oct4 bind in a highly cooperative manner. Next, we wondered whether the rational mutagenesis of Sox2 and Sox17 also affects the binding to DNA in cells in the context of the full-length proteins. To test this, we expressed V5 tagged full-length Sox2, Sox2KE, Sox17, and Sox17EK proteins in mouse ES cells and performed ChIP experiments using V5 antibodies. We subsequently quantified the enrichment of ChIP-ed DNA at two prominent genomic loci known to be bound by Sox2 and Oct4 and essential for the expression of the Nanog and Pou5f1 genes in mouse ES cells [16, 30]. Although Sox2 was detected at both genomic loci, Sox2KE was no longer recruited to this site (Fig. 5C). Conversely, only the Sox17EK mutation installed binding to these sites but WT Sox17 was not. To investigate the impact of the differentially configured sox/oct motifs on gene expression, we performed luciferase reporter assays in HEK293 cells with transiently expressed Sox variants and Oct4. Sox2 strongly activated luciferase expression in the presence of the canonical motif, whereas Sox2KE and Sox17 showed a significantly weaker response (Fig. 5D). Sox17EK, however, activated the reporter more strongly than WT Sox2. The inverse trend was observed for the compressed motif, Sox17 activated expression, whereas the Sox17EK mutation had a significantly diminished activity. In accordance with assembly experiments, Sox2 was incapable of activating expression from a com-


pressed element, but Sox2KE was now capable of activating expression. Together, these results concur with the biochemical activities measured using purified component and indicate that the differential recognition of the canonical and compressed motifs by rationally designed Sox variants and Oct4 also takes place in a cellular context.

Generation of iPS cells Using a Rationally Engineered Sox17 Construct Sox2 and Sox17 differ in their ability to generate iPS cells [15]. Although Sox2 in combination with Oct4, Klf4, and cMyc can reprogram somatic cells, Sox17 cannot. To investigate the functional significance of the amino acid substitution that dramatically altered the biochemical properties of Sox2 and Sox17, we used iPS cell generation to assess the capacity of our redesigned Sox variants to induce pluripotency. Four cotransfected transcription factors are able to efficiently generate mouse iPS cells: Oct4, c-Myc, Klf4, and Sox2 [24]. In our reprogramming assay, we used mouse embryonic fibroblasts (MEFs), isolated from C57Bl6 mice, containing a green fluorescence protein (GFP) under the control of the Oct4 promoter to assess the capacity of the reengineered Sox factors to induce reprogramming. Oct4-GFP MEFs were infected with retroviral vectors expressing Oct4, c-Myc, and Klf4 (OCK) together with one wild-type or mutated Sox factor—Sox2, Sox2KE, Sox17, or Sox17EK. In accordance with previous reports [15, 24], we observed GFPpositive (GFPþ) colonies in MEFs transduced with OCK þ Sox2, whereas MEFs transduced with OCK þ Sox17 did not yield any (Fig. 6A). Sox17EK gave rise to GFPþ colonies with a morphology and Oct4-GFP levels indistinguishable from those generated with Sox2. On the contrary, the Sox2KE mutant was unable to generate any GFPþ colonies (Fig. 6A). To compare the efficiency of Sox2 and Sox17EK in reprogramming experiments, we counted the total number of GFPþ colonies obtained per plate of MEFs in three independent experiments. After 21 days of infection, an average of 78 iPS clones were induced with OCK þ Sox2, from initial 267,000 transduced fibroblasts, whereas no GFPþ colonies appeared when Sox2 was omitted (Fig. 6B). Interestingly, when Sox2 was replaced by Sox17EK, an average of 295 iPS colonies was obtained (Fig. 6B). We verified that the quantitative differences are not due to viral titer variations (Supporting Information Figure S4). To confirm the integration of OCK þ Sox17EK transgenes in the iPS clones, we performed primerspecific PCRs and validated, by DNA sequencing, that the insert indeed contained the Sox17EK mutation (Supporting Information Figure S5). After the formation of the iPS colonies, as expected, the transgenes were efficiently silenced (Supporting Information Figure S6). Also, the Sox17EK-reprogrammed cells were found to be karyotypically normal (Supporting Information Figure S7). Next, we studied the pluripotent nature of the iPS cells generated by Sox17EK using a series of different experimental techniques. First, we expanded several of the iPS colonies and measured the expression of a set of marker genes by QRT-PCR (Fig. 6C). All the pluripotency markers tested, Eras, Nanog, Zfp206, and Zic3, exhibited expression levels in OCK þ Sox17EK-derived iPS cells comparable with normal ES cells and OCK þ Sox2 iPS cells, whereas the original MEFs showed very low expression (Fig. 6C). Next, immunostainings were carried out and the Sox17EK iPS clones showed clear signals for the pluripotency markers Nanog and SSEA-1, which were indistinguishable from Sox2 iPS clones. Likewise, all iPS clones were positive for alkaline phosphatase (Fig. 6D). To demonstrate pluripotency in vivo, two independent Sox17EK iPS clones were injected into immunocompromised mice, and


947

Figure 5. Binding of Sox2 and Sox17 to functional sox/oct motifs in vitro and in vivo. (A): Sequences of sox/oct motifs that were shown to recruit Sox2 and Oct4 in vivo. The compressed version of the motifs was generated by deleting the central base pair and placing it at the 50 end. (B): Differential assembly of WT Sox2 and Sox17 HMG domains on actual sox/oct motifs from the indicated genes as performed for the idealized sox/oct in Figure 4C. (C): Chromatin immunoprecipitation experiment using the indicated V5-tagged Sox proteins heterologously expressed in mouse ES cells as described in the Supporting Information procedures. Fold enrichments (relative to input DNA) were assessed at Sox2-binding sites in the Pou5f1 and Nanog promoter regions. (D): Luciferase reporter assays using HEK-293 cells cotransfected with reporter plasmids containing none, canonical, or compressed DNA elements as well as indicated Sox effectors and Oct4. ‘‘E’’ denotes empty Sox effector plasmids, ‘‘2’’ Sox2, ‘‘17’’ Sox17, ‘‘KE’’ Sox2KE, and ‘‘EK’’ Sox17EK.

their potential for teratoma formation was assessed. Individual iPS clones induced by Sox2 and Sox17EK formed teratoma that were composed of tissues derived from all three germ layers: ectoderm (neural tissues), mesoderm (muscle, cartilage), and endoderm (ciliated epithelium; Fig. 6E). For a definitive assessment of the pluripotentiality of Sox17EK clones, mouse blastocysts injections were carried out. Sox2 and Sox17EK iPS cells, constitutively expressing the fluorescent marker mCherry gave rise to E13.5 chimeric embryos (Fig. 6F). Collectively, these data demonstrate that Sox17EK, in cooperation with OCK, is able to induce reprogramming like wild-type Sox2. On the contrary, the mutated Sox2KE protein lacks this activity. www.StemCells.com

Given the inverted efficiency of Sox17EK and Sox2KE to biochemically cooperate with Oct4 on canonical sox/oct elements, we conclude that Sox17EK acquired the iPS inducing potential by dimerizing with Oct4 on enhancers of pluripotency genes, an ability lost by Sox2KE.

The Ability to Promote Endodermal Differentiation Is Swapped Between Sox2 and Sox17 Several recent studies demonstrated that the overexpression of Sox17, but not Sox2, pushed ES cells to differentiate into endodermal tissue [33–35]. Having established that Sox17EK is capable of inducing pluripotency, we wondered if the

948


Figure 6. Characterization of induce pluripotent stem (iPS) clones reprogrammed by Sox17EK. (A): Combined bright-field and fluorescent photographs of iPS colonies. Shown are representative clones of iPS cells derived from MEFs containing a GFP reporter driven from a minimal Oct4 promoter that were transduced with Oct4, cMyc, Klf4 plus Sox2, Sox2KE, Sox17, or Sox17EK. Scale bars ¼ 100 lm. (B): The numbers of iPS colonies generated by wild-type and mutant version of Sox2 and Sox17 from three independent experiments are shown. The indicated versions of the Sox factors were cotransduced with OCK into Oct4-GFP MEFs. Oct4-GFP-positive colonies appearing on each plate, performed in biological and technical triplicates (average 6 SD), were counted 3 weeks postinfection. (C): Quantitative real-time PCR analysis on iPS clones generated with Sox2 and Sox17EK. Gene expression levels of Nanog, Zfp206, Zic3, and Eras relative to nontransduced Oct4-GFP MEFs and mouse embryonic stem cells (E14) from three replicates are presented as average 6 SD. (D): Cells derived from two independent iPS clones obtained by OCK-Sox17EK (C5, C15) transduction and cells from one clone obtained by OCK-Sox2WT (C201) transduction were immunostained for expression of pluripotency markers SSEA-1 and Nanog. Oct4-GFP expression of the same cells is also shown. The rightmost column depicts AP expression of those cells. Scale bars ¼ 100 lm. (E): Teratomas derived from iPS clones generated from OCK-Sox2 and OCK-Sox17EK. iPS cells derived from Oct4-GFP MEFs that were transduced with Oct4, c-Myc, Klf4 plus Sox2 (clone C201), or Sox17EK (clone C15) were injected intramuscularly into immunodeficient SCID mice. Three to five weeks later teratomas were dissected, fixed, and stained. (F): Pictures of E13.5 chimeric mice generated with iPS cells reprogrammed with OCK þ Sox17EK and infected with a lentiviral vector expressing constitutively the fluorescent protein mCherry. Abbreviations: AP, alkaline phosphatase; GFP, green fluorescence protein; MEF, mouse embryonic fibroblasts; WT, wild type.


949

Figure 7. Characterization of mouse ES cells derived after overexpression of Sox variants. (A): Bright-field photographs of representative cell lines derived from E14 mouse ES cells after infection with lentiviral vectors to overexpress Sox2, Sox2KE, Sox17, or Sox17EK. Pictures were taken four passages after infection. Scale bars ¼ 50 lm. (B): Quantitative real-time PCR analysis were performed to determine expression level of pluripotency markers Nanog, Zfp42, Klf4, and Oct3/4, (C) specific endoderm markers Sox7, Gata4, Gata6, and FoxA2 and (D) specific ectoderm Sox1, Nestin, and mesoderm markers, Mixl1 and T-brachyury in cells expressing Sox variants as indicated. Gene expression levels from three replicates are presented as average 6 SD. For comparison, the expression levels of all markers in the original mouse ES cell line (E14) are also presented. (E): Expression of SSEA-1, Nanog, Gata4, and Dab-2 proteins in cells stably expressing Sox2, Sox2KE, Sox17, and Sox17EK. The cell lines were immunostained for expression of pluripotency markers SSEA-1, Nanog, and endoderm markers Gata4 and Dab-2. Merged images with DAPI are shown. Scale bars ¼ 50 lm. Abbreviations: DAPI, 40 ,6 diaminido-2-phenylindole; ES cell, embryonic stem cell.

converse is true; that the Sox2KE mutant can induce endoderm differentiation in ES cells in a manner similar to Sox17. To test this, we infected mouse ES cells with lentiviral vectors expressing Sox2, Sox17EK, Sox17, or Sox2KE transgenes, coupled to a Venus selection marker for fluorescenceactivated cell sorting sorting using the Venus marker, and www.StemCells.com

established cell lines stably expressing the Sox variants. We observed that cells expressing Sox17 and Sox2KE adopted an endodermal morphology, whereas cells expressing Sox2 and Sox17EK maintained an ES cell-like phenotype (Fig. 7A). To further analyze these cells, we quantified the expression of pluripotency and differentiation markers by QRT-PCR. We


950

observed that the expression of the pluripotency markers Zfp42, Nanog, Oct4, and Klf4 were reduced in Sox17 and Sox2KE expressing cells, as compared with control ES cells as well as to Sox2- and Sox17EK-expressing cells (Fig. 7B). Conversely, the endoderm-specific markers Gata4, Gata6, FoxA2, and Sox7 were strongly induced in cells expressing Sox17 or Sox2KE, whereas they were virtually absent in Sox2- and Sox17EK-expressing cells (Fig. 7C). The cellular phenotype was further analyzed by immunostaining revealing that Sox2 and Sox17EK cells express the pluripotency markers Nanog and SSEA1, whereas Sox17 and Sox2KE cells express the endoderm markers Gata4 and Dab2 (Fig. 7E). To test if Sox2KE, like Sox17, selectively induces endodermal differentiation of ES cells or whether it causes a general loss of pluripotency and the formation of all three germ layers, we analyzed the expression of mesoderm and ectoderm markers Sox1, Nestin, Mixl1, and T-brachyury. Neither mesodermal nor ectodermal markers were found to be significantly upregulated in Sox17 and Sox2KE cells, as compared with pluripotent cells, suggesting that Sox2KE acquired Sox17-like properties of forcing ES cells specifically toward an endodermal fate (Fig. 7D). Together, these results indicate that strategically placed point mutations at protein-interaction surfaces swap the bioactivities of Sox2 and Sox17. The Sox2 mutant, Sox2KE, has lost the activity to maintain pluripotency and has instead gained the ability to induce endoderm in ES cells. Conversely, mutating Sox17 to Sox17EK abolished its role as a driver toward endoderm but equips it with the ability to maintain ES cell pluripotency.

DISCUSSION In this study, we progress from the in silico identification of a novel compressed motif, to the biochemical demonstration that this DNA motif can recruit different Sox/Oct pairs in contrast to its canonical counterpart, to the reverse engineering through structure-based mutagenesis of the differential assembly behavior. Ultimately, we demonstrate that a single point mutation rationally introduced at a site that affects Oct4 interaction on composite DNA motifs, with only subtly different motif spacings in vitro, drastically changes gene expression programs and swaps the activities of Sox17 and Sox2 in biological assays. This mutation gives rise to a fundamental change in the developmental outcomes triggered by the Sox proteins. Forced expression of wild-type Sox2 and Sox17EK have no effect on ES cells, but expression of wild-type Sox17 and Sox2KE in ES cells causes differentiation toward an endoderm fate. Sox17EK can now potently reprogram MEFs into iPS cells, whereas the wild-type Sox17 is incapable of this feat. These data suggest that Sox17EK has gained the ability to specify pluripotency, but lost its endoderm promoting potential, whereas Sox2KE has lost its reprogramming behavior and gained the ability to specify an endoderm phenotype. To our knowledge, this is the first example of the rational conversion of a protein into a reprogramming factor by rational mutagenesis. That these developmental phenotypes are reflected in the binding capability of Sox/Oct4 to variant DNA motifs demonstrates the crucial importance of the Sox2/ Oct4 dimerization in specifying pluripotency. It is surprising that a single amino acid change causes such a dramatic functional swap. Although both, B1 and F group Sox proteins contain a C-terminal transactivation domain, actual sequence conservation outside the HMG domain is poor [36]. Nevertheless, both, Sox2 and Sox9 can recruit p300 to exert transcriptional control despite highly divergent

sequences within their transactivation domains [37, 38]. Therefore, the binding to generic coactivators, such as p300, does not implicitly depend on conserved domains within the peripheral regions and Sox2 and Sox17 may be equally capable to recruit this cofactor. Hence, the qualitatively distinct developmental roles of Sox2 and Sox17 do not appear to be determined by their transactivation domains but by their ability to team up with Oct4 on specific cis-regulatory modules (CRMs). Indeed, the Sox17EK mutation installs the activity to assemble at selected genomic loci that are known to be constructively targeted by Sox2 and Oct4. On the contrary, Sox2KE has lost this activity. Further studies are required to assess the redistribution of Sox17EK and Sox2KE binding in comparison with WT proteins on a genomic scale. It is possible that gene sets specifying a particular developmental lineage are earmarked by distinct sox/oct motif configurations. Indeed, some evidence is consistent with the hypothesis that different configurations of sox/oct motifs recruit particular combinations of members of Sox and POU family [9, 10, 39–41]. Whether or not the compressed sox/oct motif or a derivative thereof comprises a core component of, for example, endodermal CRMs, remains to be investigated. We believe that this work provides general insights into TF function and could guide further studies on the combinatorial control of gene expression. Gene regulation requires multiple inputs involving the assembly of combinations of transcription factors on CRMs and deciphering some sort of ‘‘regulatory code’’ is intensely sought after. It is unclear whether a precise arrangement of TF-binding sites is necessary to execute a regulatory event [42]. By showing that the protein contact interface encodes the potential to cobind differently spaced motif variants, we propose a biochemical rationale for constrained motif configurations that might apply to other transcription factor combinations. We, furthermore, demonstrate that altering the differential assembly potential has pronounced functional consequences. Together, this suggests that individual sequence specificities and the ability to recruit the downstream regulatory machinery are conserved features of Sox family TFs (and perhaps others), whereas the potential to differentially assemble on distinct composite cisregulatory elements determines their distinct biological roles. Future work should systematically address the question whether distinct motif configurations indeed earmark genes specific for a particular biological process and recruit specific TF combinations. The variety of functionally important Sox/POU pairs provides a suitable model system to test this possibility.

ACKNOWLEDGMENTS We thank Rory Johnson and Shyam Prabhakar for valuable comments on the article and Selina Poon Kwee Lan, Choo Siew Hua, Kee Yew Wong, and Siaw-Wei Teng for technical support. We are grateful to Petra Kraus and V Sivakamasundari from the GIS-GAP for cell injections, teratoma removals, and histology. This work was supported by the Agency for Science, Technology and Research (A*STAR; www.a-star.edu.sg) Singapore. A.P.H. is currently affiliated with the Immunology Frontier Research Centre, Osaka University, Suita, Osaka, Japan.

DISCLOSURE

OF OF

POTENTIAL CONFLICTS INTEREST

The authors indicate no potential conflicts of interest.


REFERENCES 1 2 3 4 5 6 7 8 9 10 11 12 13 14

15 16 17 18 19 20 21 22

Bowles J, Schepers G, Koopman P. Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev Biol 2000;227:239–255. Ryan AK, Rosenfeld MG. POU domain family values: Flexibility, partnerships, and developmental codes. Genes Dev 1997;11: 1207–1225. Wegner M. From head to toes: The multiple facets of Sox proteins. Nucleic Acids Res 1999;27:1409–1420. Badis G, Berger MF, Philippakis AA et al. Diversity and complexity in DNA recognition by transcription factors. Science 2009;324: 1720–1723. Ravasi T, Suzuki H, Cannistraci CV et al. An atlas of combinatorial transcriptional regulation in mouse and man. Cell 2010;140:744–752. Boyer LA, Lee TI, Cole MF et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 2005;122:947–956. Loh YH, Wu Q, Chew JL et al. The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat Genet 2006;38:431–440. Rodda DJ, Chew JL, Lim LH et al. Transcriptional regulation of nanog by OCT4 and SOX2. J Biol Chem 2005;280:24731–24737. Tanaka S, Kamachi Y, Tanouchi A et al. Interplay of SOX and POU factors in regulation of the Nestin gene in neural primordial cells. Mol Cell Biol 2004;24:8834–8846. Kuhlbrodt K, Herbarth B, Sock E et al. Cooperative function of POU proteins and SOX proteins in glial cells. J Biol Chem 1998;273: 16050–16057. Stefanovic S, Abboud N, Desilets S et al. Interplay of Oct4 with Sox2 and Sox17: A molecular switch from stem cell pluripotency to specifying a cardiac fate. J Cell Biol 2009;186:665–673. Avilion AA, Nicolis SK, Pevny LH et al. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev 2003;17:126–140. Kanai-Azuma M, Kanai Y, Gad JM et al. Depletion of definitive gut endoderm in Sox17-null mutant mice. Development 2002;129: 2367–2379. Niakan KK, Ji H, Maehr R et al. Sox17 promotes differentiation in mouse embryonic stem cells by directly regulating extraembryonic gene expression and indirectly antagonizing self-renewal. Genes Dev 2010;24:312–326. Nakagawa M, Koyanagi M, Tanabe K et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol 2008;26:101–106. Palasingam P, Jauch R, Ng CK et al. The structure of Sox17 bound to DNA reveals a conserved bending topology but selective protein interaction platforms. J Mol Biol 2009;388:619–630. Guo G, Huss M, Tong GQ et al. Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst. Dev Cell 2010;18:675–685. Nichols J, Zevnik B, Anastassiadis K et al. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 1998;95:379–391. Kurimoto K, Yabuta Y, Ohinata Y et al. An improved single-cell cDNA amplification method for efficient high-density oligonucleotide microarray analysis. Nucleic Acids Res 2006;34:e42. Reim G, Mizoguchi T, Stainier DY et al. The POU domain protein spg (pou2/Oct4) is essential for endoderm formation in cooperation with the HMG domain protein casanova. Dev Cell 2004;6:91–101. Chen X, Xu H, Yuan P et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells. Cell 2008;133:1106–1117. Ng CK, Palasingam P, Venkatachalam R et al. Purification, crystallization and preliminary X-ray diffraction analysis of the HMG domain

951

23 24 25 26

27 28 29 30 31

32 33 34 35 36

37 38

39

40 41 42

of Sox17 in complex with DNA. Acta Crystallogr Sect F Struct Biol Cryst Commun 2008;64:1184–1187. Jauch R, Ng CK, Saikatendu KS et al. Crystal structure and DNA binding of the homeodomain of the stem cell transcription factor Nanog. J Mol Biol 2008;376:758–770. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006;126:663–676. Remenyi A, Lins K, Nissen LJ et al. Crystal structure of a POU/ HMG/DNA ternary complex suggests differential assembly of Oct4 and Sox2 on two enhancers. Genes Dev 2003;17:2048–2059. Williams DC, Jr, Cai M, Clore GM. Molecular basis for synergistic transcriptional activation by Oct1 and Sox2 revealed from the solution structure of the 42-kDa Oct1.Sox2.Hoxb1-DNA ternary transcription factor complex. J Biol Chem 2004;279:1449–1457. DeLano WL. The PyMOL Molecular Graphics System. San Carlos, CA, USA: DeLano Scientific, 2002. Remenyi A, Tomilin A, Pohl E et al. Differential dimer activities of the transcription factor Oct-1 by DNA-induced interface swapping. Mol Cell 2001;8:569–580. Tomilin A, Remenyi A, Lins K et al. Synergism with the coactivator OBF-1 (OCA-B, BOB-1) is mediated by a specific Pou dimer configuration. Cell 2000;103:853–864. Chew JL, Loh YH, Zhang W et al. Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Mol Cell Biol 2005;25:6031–6046. Nishimoto M, Fukushima A, Okuda A et al. The gene for the embryonic stem cell coactivator UTF1 carries a regulatory element which selectively interacts with a complex composed of Oct-3/4 and Sox-2. Mol Cell Biol 1999;19:5453–5465. Tomioka M, Nishimoto M, Miyagi S et al. Identification of Sox-2 regulatory region which is under the control of Oct-3/4-Sox-2 complex. Nucleic Acids Res 2002;30:3202–3213. Qu XB, Pan J, Zhang C et al. Sox17 facilitates the differentiation of mouse embryonic stem cells into primitive and definitive endoderm in vitro. Dev Growth Differ 2008;50:585–593. Seguin CA, Draper JS, Nagy A et al. Establishment of endoderm progenitors by SOX transcription factor expression in human embryonic stem cells. Cell Stem Cell 2008;3:182–195. Shimoda M, Kanai-Azuma M, Hara K et al. Sox17 plays a substantial role in late-stage differentiation of the extraembryonic endoderm in vitro. J Cell Sci 2007;120:3859–3869. Lefebvre V, Dumitriu B, Penzo-Mendez A et al. Control of cell fate and differentiation by Sry-related high-mobility-group box (Sox) transcription factors. Int J Biochem Cell Biol 2007;39: 2195–2214. Nowling TK, Johnson LR, Wiebe MS et al. Identification of the transactivation domain of the transcription factor Sox-2 and an associated co-activator. J Biol Chem 2000;275:3810–3818. Tsuda M, Takahashi S, Takahashi Y et al. Transcriptional co-activators CREB-binding protein and p300 regulate chondrocyte-specific gene expression via association with Sox9. J Biol Chem 2003;278: 27224–27229. Ambrosetti DC, Basilico C, Dailey L. Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol Cell Biol 1997;17: 6321–6329. Dailey L, Basilico C. Coevolution of HMG domains and homeodomains and the generation of transcriptional regulation by Sox/POU complexes. J Cell Physiol 2001;186:315–328. Yuan H, Corbi N, Basilico C et al. Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes Dev 1995;9:2635–2645. Segal E, Widom J. What controls nucleosome positions? Trends Genet 2009;25:335–343.

See www.StemCells.com for supporting information available online.