Cyclic AMP-dependent constitutive expression of gal ... - Europe PMC

Proc. Natl. Acad. Sci. USA Vol. 80, pp. 4775-4779, August 1983

Genetics

Cyclic AMP-dependent constitutive expression of gal operon: Use of repressor titration to isolate operator mutations (promoters/plasmid/Escheriehia coli)

M. IRANI*, L. OROSZt, S. BUSBYt, T.

TANIGUCHIO, AND S. ADHYAS

Lahoratorv of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205 Communicated by Bernard D. Davis, April 1, 1983

described here showed constitutive synthesis of gal enzymes only in cya+ cells and not in cya- cells.

ABSTRACT When the gal operator region is present in a multicopy plasmid it binds to all ("titrates") the gal repressor and "induces" the chromosomal gal operon. To make operator mutations (Oa) with reduced affinity toward the repressor, plasmid DNA was irradiated with UV light and mutant derivatives were isolated that were unable to release the chromosomal gal genes from repression. Then with such an Oa plasmid operator revertants were isolated that had reacquired the ability to release repression. Both sets of mutations have been localized by DNA sequence analysis. When the Oa mutations were transferred from the plasmid to the chromosome by recombination these mutant operators were found to make gal expression constitutive (independent of repressor) but still dependent on cAMP, whereas the previously reported gal operator mutants (0C) are constitutive both in the presence and in the absence of cAMP. The titration method of isolating mutants enables the isolation of strains with operator mutations that also affect normal promoter activity, and it provides an easy way to isolate revertants of operator mutations.

MATERIALS AND METHODS The E. coli K-12 strains used in this study are C600 (F- thithr- leu- lacY- suII), SA1293 (Hfr H thi- galRss), SA1293C (SA1293 ilv-2: :TnlO cya-1039), and Ml101 [F- his- str relAl lac- lacPuv5 A(gal-bio) A(galR-lysA)]. All other strains used, including those described in Table 1, were derived from Ml101 by a single or successive steps of P1 phage transduction with appropriate markers. The ilv-2:TnlO and cya-854 alleles present in some of the strains originated from BM4468 of A. Campbell and CA8306 of J. Beckwith, respectively. Phage strains AcI857 A(attL-int)313 A(gal)165, AcI857lySA galR,8, and Plkc are from our collection. The AcI857 gal8dc transducing phage was obtained from D. Court and is described in Fig. 2. The media composition are from Miller (9). Ampicillin and tetracycline were used at' 50 and 15 ,ug/ml, respectively. AgalOa phage, described in Results, were distinguished from AgalO+ by spotting on methyl f-D-thiogalactoside/galactose minimal agar plates, seeded with a Agal (Ak) strain. On this plate cells constitutively making gal enzymes grow but those that are inducible do not (8). Restriction enzymes, RNA polymerase, phage T4 DNA ligase, and pBR322 DNA were from Bethesda Research Laboratories or New England BioLabs and were used as recommended by them. Calf intestinal alkaline phosphatase was from Boehringer, polynucleotide kinase from P-L Biochemicals, and hydrazine, dimethyl sulfate, and piperidine from Eastman-Kodak. Kinase and epimerase assay reagents were from Sigma. The radioisotopes [ y-32P]ATP and [a-32P]UTP were supplied by New England Nuclear and ['4C]galactose by Amersham. The CRP was a gift from J. Krakow. The plasmid DNAs were prepared by lysing the cells with Triton X-100 followed by chromatography on Sepharose 4B (Pharmacia) (10). DNA fragments for RNA transcription, DNA sequence analysis, or protection against DNase digestion were separated on polyacrylamide gels and extracted by the methods described by Maxam and Gilbert (11). For ligation, the DNA

The initial controlling step of a negatively regulated operon is the modulation of transcription initiation from its promoter by binding of specific repressor molecules with the operator site (1).'The operator is usually identified by mutations (QC) that make the operon constitutive but do not affect the promoter. However, when the operator and promoter loci overlap, conventional selection would preclude the isolation of strains with operator mutations located in the overlap region. In this paper we describe a method for isolating the full range of gal operator mutations with a reduced affinity for gal repressor. The gal operon can be transcribed from either of its two overlapping promoters, PG1 or PG2 (Fig. 1; refs. 3, 6, and 7; unpublished data). On gal DNA, pGi-promoted transcription starts at +1 position (S1), and PG2 at -5 (S2). cAMP and its receptor protein (CRP) regulate the activities of PGi and PG2 in opposite ways, stimulating transcription from PG1 and inhibiting transcription at PG2. Thus, synthesis beginning at Si predominates in wild-type (cya+) cells, and synthesis beginning at S2 predominates in adenylate cyclase mutants (cya-). Analysis of promoter mutations and other studies have established that cAMP-CRP binds at a single target site (cat), located around position -35. Binding at this site is responsible for both stimulation of transcription at PGI and inhibition at PG2 (2, 4, 5). The gal repressor protein, the product of the galR gene, regulates both the promoters (6, 8). The operator defined by several Oc mutations and galR- mutations derepress the synthesis of the gal enzymes and they do it in both cya+ and cya- cells-i.e., they make both PGI and PG2 constitutive. Unlike the previously reported OC mutants, the 03 mutants

Abbreviations: CRP, cAMP receptor protein; bp, base pair(s); Gal', galactose-utilizing; Gal-, galactose-negative; TMGs, sensitive to methyl ,B3D-thiogalactoside; AmpR, ampicillin resistant. * Present address: Dept. of Biochemistry, University of Washington, Seattle, WA 98195. t Present address: Dept. of Genetics, Attila Jozsef -University, Szeged, Hungary. t Present address: Institut Pasteur, Dept. Biologie Moleculaire, Paris, France. § Present address: Dept. of Biochemistry, Kouchi Medical College, Nangoku-Shi, Kouchi, Japan. ¶To whom reprint requests should be addressed.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 4775

4776

Genetics: lrani et al.

Proc. Natl. Acad. Sci. USA 80 (1983)

pMl3

EcoRi I

Hind III

I I

I I

AN

galE

I

,'

gal K

-__

~~~~CA -70

i

CAT

GT

'9 '9 '9 -80

1L

-_

OPERATOR

'9

-137

gaIT

1L

~~~~~~~~0'33,3 60

-50

-

-40

-30

-20

-10

+1

+10

+45

CCAA---GGCTAAATTCTTGTGTAAACGATTCCACTAATTTATTCCATGTCACACTTTTCGCATCTTTGTITATG TATGGTTATTTCATACCATAAG ---CCG GGTT---CCGATTTAAGAACACATTTGCTAA>GATTAAATAAGGTACAGTGTSiAAA AGCGTAGAAACAATAC T ACCI TAAAGTATGGTATTC---GGC B1

°38 °034°S°4

S2

ACT

A T

TGA

01e3 G C

T A A T

SI

0e3o5 T A

FIG. 1. Structure of the plasmid pMI3 as described in ref. 2 and the gal operon of Escherichia coli. The gal controlling region covers the two transcription starts S1 (+ 1) and S2 (-5) and their respective promoters, including the Pribnow sequences (boxed regions) (3), the cat site around the -35 region (4), and the operator segment around -58 (5). The coordinates refer to the start point of the cAMP CRP-dependentgal transcription, S1, taken to be + 1. The operator is amplified and shows the sequence changes associated with the three oa mutations, Ol, Oa, and O', described in this paper along with seven O' mutations, including O°1, described before (5, 6). The plasmid pMI3 carries the regulatory region extending from +45 to -187, between the HindMI and EcoRI sites of pBR322. The BstEII restriction site present at +42 has been used to reconstitute the intact gal operon from pMI3 as described in the text and Fig. 2. Small square indicates base protected by cAMP CRP from methylation by dimethyl sulfate. Wavy underlinings indicate protection against DNase digestion by cAMP*CRP at the 3' side of the indicated base (4).

fragments were isolated from agarose gels by the perchlorate method (12). Transformations were performed with host cells that were. aged for 3-24 hr in 75 mM CaCl2 on ice. For DNA sequence analysis, the plasmid DNA was opened with HindIll and the 5' ends were labeled with polynucleotide kinase. After digestion with EcoRI, the 270-base-pair (bp) fragment was isolated from a 5% (wt/vol) polyacrylamide gel and its sequence was determined by the method of Maxam and Gilbert (11). For UV light mutagenesis, host cells were irradiated with 13 J/m2 and were transformed immediately with DNA samples previously.irradiated with a dose of 540 J/m2. For isolation of revertants, cells were grown overnight in the presence of Nmethyl-N'-nitro-N-nitrosoguanidine at 100 pug/ml in LB medium. Epimerase and kinase assay conditions have been described previously (13). Units of enzyme are nmol of product formed per min per ml of cells. RESULTS Isolation of Strains with Operator Mutations with Reduced Repressor Affinity. The operator segment of the gal operon, when present in multiple copies in a cell, is able to bind to all ("titrate") the gal repressor in trans and derepress the chromosomal gal genes (5, 14). Thus if a plasmid carries a mutation

that reduces the binding of the repressor to the plasmid gal operators, it would fail to derepress the chromosomal gal genes. To perform the current study, we inserted a small fragment of gal DNA containing all known control sites into plasmid pBR322. The resultant plasmid, pMI3, harbors a 270-bp piece of gal DNA that contains the operator, two promoters (including the two transcription start sites), and the coding sequence for the first six amino acids of the galE cistron (Fig. 1). When pMI3 (galO+) is introduced into a strain (SA1293) carrying a gal super-repressor mutation, galRS, it changes the cell phenotype from galactose-negative (Gal-) to galactose-utilizing (Gal'). Thus, SA1293/pMI3 grows on galactose minimal agar plates and forms red colonies on MacConkey galactose agar plates. SA1293 without the plasmid does not grow on minimal galactose and forms white colonies on MacConkey galactose agar plates, because the super-repressor binds to the operator even in the presence of galactose. Also, pMI3 enables an inducible galR+ strain (C600) to grow on minimal galactose agar in the presence of the gratuitous anti-inducer-methyl p-D-thiogalactoside. C600, without the plasmid, does not grow on methyl thiogalactoside/galactose. These results indicate that pMI3 can derepress the chromosomal gal operon by binding to all the repressor in trans. Thus, a mutant pMI3 that fails to bind the gal repressor would be scored as Gal- in a galRs strain or as methyl thiogalactosidesensitive (TMGs) in a galR+ strain. pMI3 DNA was irradiated with UV light as described in Ma-

Proc. Natl. Acad. Sci. USA 80 (1983)

Genetics: Irani et aL

4777

occasionally obtained by ligation of HindIII/EcoRI-digested pBR322 DNA. The phenotype of pMI30, pMI31, and pMI40 was confirmed by measuring the levels of chromosomal galactokinase, the product of the galK gene, of galRS strains carrying the wild-type or the mutant plasmids. pMI3-carrying cells synthesized significant amount of kinase, whereas those carrying the mutant plasmids, as expected, did not show derepression (data not shown). DNA Sequence Analysis of the Operator-Affinity Mutations (Oa). The three affinity mutations described above are designated as Oa mutations. They were located by DNA sequence analysis of the respective 270-bp gal DNA fragments, as described in Materials and Methods. pMI30 and pMI40 showed the same transition from ANT to G-C at position -64. The mutations are referred to as Oa and Oa, respectively (Fig. 1). pMI31 showed a COG to APT transversion at position -53 and is assigned the Oa allele. Both the changes are located in the same "region" defined by the previously isolated Oc mutations of the gal operon (5, 6). Reversion of the (0 Mutations. pMI31 plasmid in a host with gal deleted was mutagenized in LB medium containing N-methylN'-nitro-N-nitrosoguanidine. The mutagenized plasmid DNA was extracted and used to retransform the galRs strain SA1293. AmpR Gal+ revertants were obtained at a frequency of 10-6 on minimal galactose/ampicillin agar plates from the transition

terials and Methods. In experiment I, this DNA was directly used to transform the galRs strain, and the ampicillin-resistant (AmpR) transformants were screened for Gal- (white) colonies on MacConkey galactose/ampicillin agar plates. AmpR Galcolonies were obtained at a frequency of about 0.1%. Three of these were characterized further and shown to have the mutations associated with the plasmids. One carried a mutant plasmid with a low copy number as judged by quantifying the plasmid DNA extracts by gel electrophoresis. The other two (pMI30 and pMI31) carried mutations in the 270-bp HindIII/EcoRI gal DNA fragment as shown by reconstructing the mutant plasmid by ligating the 270-bp purified fragments from mutant clones into restriction endonuclease-treated pBR322 DNA that had not been irradiated with UV light. In experiment II, the 270-bp gal DNA fragment was excised from the UV-irradiated pMI3 plasmid by digestion with HinduIII and EcoRI, purified by gel electrophoresis, and then ligated into unirradiated pBR322 DNA to reconstruct the pMI3 structure. The pool of ligated DNA was used to transform the galR+ strain. The AmpR colonies were screened on minimal methyl thiogalactoside/galactose/ampicillin agar plates. Of 150 colonies screened, 2 were TMGs. One of them (pMI40) was shown by restriction analysis to carry a mutation in the 270-bp gal DNA and the other a deletion of this fragment. The latter must be created by fusion of HindIII and EcoRI sites of pBR322-perhaps an artifact of the ligation. Similar illegitimate fusions were

Pvu II

PvuII

Pst

/ /

Agal8dc

AgalOa

BstE 11

, A

\

PO+I

K

RI

jSTEP 2 K

,,~f

p Oa

E

T

,-

aroG

CHROMOSOME

K

P0

165 I-2ULnRAtl4CnR AC,

aroG .-a. --- KAPO+ A

-

aroG

blu a.

K

T

K

no

104

A

STEP 4 'E

A /Aatt A X bio att

ISTEP 3 .,M blu

MMLUS.

165

CHROMOSOME

A

8

A

LIMMumuburvit

att

8

__A --M.

E

T

f 8bio 8 att

N

-

AoaA n

F--T-

.,

---bio

I

8 att a

FIG. 2. Steps of transferring the oa mutations from an operator fragment in the plasmids to the chromosome. The plasmids and the gal in the text. The principles of the four steps are also described in the text. The thin lines represent plasmid phage DNA, thick and double lines represent bacterial DNA, and wavy lines represent insertion DNA. The triangles stand for various deletions. The A phage integrates at the normal attachment site. X shows the insertion of prophage A. aroG, blu, and bio are neighboring bacterial markers. operon

are explained

or

4778

Genetics: Irani et al.

mutant O'. Presumably, the mutant plasmids have regained the ability to titrate the gal repressor. Two such independent revertants were found by DNA sequence analysis to contain the transition G-C to A-T at position -64, demonstrating that both are true revertants. These results give credence to the participation of Oa alleles in the gal operator function and also authenticate our affinity method of isolating operator mutants and their revertants in studying the interaction between operator and repressor. Transfer of the Oa Mutations from Plasmid to Chromosome. To study the cis effect of the Oa and Oa mutations on the gal operon, we transferred the mutations from the plasmid to the chromosome as described below (Fig. 2). Step 1. Plasmids carrying an intact gal operon with the oa mutations were constructed by replacing the EcoRI/BstEII fragment from the wild-type gal plasmid pAA102 (2) with the EcoRI/BstEII fragments derived from pMI3, pMI30, and pMI31 (see Fig. 1). The corresponding reconstructed plasmids, pMI50 (Of), pMI51 (Oa), and pMI52 (Oa), when introduced into a host with a gal deletion (Ml101) expressed comparable levels of both UDP-galactose-4-epimerase, the product of the galE gene (870, 1,120, and 1,150 units at OD590 = 1.0, respectively), and galactokinase (1,740, 1,727, and 2,423 units at OD590 = 1.0, respectively), indicating that there is no defect in the promoters. Step 2. The wild-type and the mutant gal operators and the adjoining DNA regions were transferred from pMI50, pMI51, and pMI52 into a plaque-forming Agal transducing phage, Agal8dc, carrying a deletion-substitution in the galET region (see Fig. 2). Agal+ recombinants were obtained at a frequency of 0.5-4%. Such recombinants arose by two cross-overs between the plasmid and the phage regions of homology that flank the deletion-substitution segment. Because the cross-over in the operator region could be to either side of the Oa mutations, the resulting Agal+ phages could be either AgalO+ or AgalOa. An oa mutation should make the expression of the gal operon constitutive, an initial assumption proved true as shown below. About 20% of the Agal+ phage from pMI51 and pMI52 were gal constitutive and thus carried the galoa mutations, but none (0/18) showed constitutivity when they originated from pMI50. Step 3. The O+, Oa, and Oa alleles, present in the Agal phages isolated above, were transferred into the E. coli chromosome. The phages carrying a heat-sensitive A repressor mutation (clts857) were used to lysogenize a gal deletion host (Agall65 attA+). The structures of the prophage and the contiguous gal regions are shown in Fig. 2. Such lysogens were all Gal+ and did not grow at 42°C. Temperature-resistant survivors at 42°C have lost the prophage by recombination between homologous gal DNA sequences around the A165 marker. Temperature-resistant Gal+ survivors were obtained at a frequency of 5-30% of total survivors. More than 90% of the Gal+ survivors were constitutive-i.e., resistant to methyl thiogalactoside when the parental lysogens carried AgalOa or AgalOa, but only inducible Gal+ colonies were obtained from a AgalO+ lysogen. Note that all of the Gal+ cells carrying O+, Oa, or Oa alleles in the chromosome inherited the A8 deletion from the phage (Fig. 2). Step 4. An isogeneic set of cya- strains was constructed by introducing the cya-854 allele from.SA2345 (cya-854 ilv-2: :TnlO donor) by P1 transduction and selection for tetracycline resistance and screening for sorbitol utilization defect on MacConkey sorbitol agar plates. Effect of the oa Mutations on the Expression of a Cognate Operon. Table 1 shows the differential rate of synthesis of the chromosomal gal enzvmes in the Oa mutants constructed above. Oa and O° are partially constitutive for both epimerase and kinase and can be fully induced in a cya' strain (Table 1, lines 2 and 3), suggesting a partial loss of their repressor affinity. In

Proc. Natl. Acad. Sci. USA 80 (1983) Table 1. Differential rates of synthesis of UDP-galactose-4epimerase and galactokinase in the Oa mutants Kinase Epimerase No No inducer Inducer inducer Inducer Genotype Strain 21.2 1.9 45.4 2.3 1. MI601 galO+ 29.0 11.2 53.8 18.0 2. MI801 galO1 30.8 9.4 44.1 27.0 3. M1803 galO2 32.0 41.0 77.2 54.0 4. MI805 galO18 9.3 0.9 55.0 4.8 5. MI602 galO+ cya-854 8.2 1.0 66.0 3.5 6. MI802 galOa cya-854 12.2 1.0 86.0 2.7 7. M1804 galO2 cya-854 14.5 8.9 123.0 8. MI806 galOsc cya-854 88.0 Cells were grown in ampicillin-containing medium to OD590 = 0.2 in M56 minimal fructose/Casamino acids/biotin medium (6). Various times thereafter, samples were removed and assayed for epimerase and kinase. The units of activity were plotted as a function ofcell density. The differential rate of epimerase and kinase synthesis was computed from the slope. Wherever necessary, a correction factor has been applied to compensate for the differences in copy number between wild-type and mutant plasmids. Cultures were induced with 0.2% D-galactose added when OD590 was 0.2. The strains are derivatives of MI101. The relatively reduced levels of kinase in cya- strains is because of a natural polarity observed in the gal operon under conditions of cAMP deficiency (15). Assay of separate extracts from cells of the same strain grown under the same conditions showed approximately the following variabilities: kinase, ± 15%; epimerase, ±20% for high enzyme levels and ±50% for low levels (6).

contrast, the synthesis of the gal enzymes remains repressed in the cya- (cya-854) derivatives of the two oa mutants, as in their O+ parent, and is inducible (Table 1, lines 6 and 7). Addition of cAMP to the growth media of the cya-854 derivatives restores constitutive expression of the gal enzymes in the O', and Oa but not in the O+ strains (data not shown). Normal repression of Oa and Oa operons in cya- cells has been confirmed in another cya mutation, cya-1039 (data not shown). In contrast, the O' mutations isolated previously showed full constitutivity in both cya+ and cya- strains, suggesting total loss of repressor affinity (Table 1, lines 4 and 8) (6). The normal levels of gal enzymes in the fully induced oa mutant cells under both cya+ and cya- conditions confirm that there is no impairment of the promoters. Binding of cAMP CRP Complex to the oa Mutants. The specific binding of cAMP-CRP to wild-type and mutant gal DNA (from +45 to -90 region) was studied by the DNase protection method (4). Fig. 3 shows the effect of cAMP CRP on DNase I digestion of the lower strand of the cat segment (from -15 to -75) of the wild-type and O1 gal DNA. It is evident that the digestion pattern is very similar for the two DNAs. The cAMP-CRP complex protects the 5' side of G42, A38, A36, and A35 from DNase digestion and enhances it at the 5' side of A49 and C39. Transcription of the 270-bp gal DNA containing O+ or 1 allele in a purified system in the presence of 100 utLM cAMP plus CRP at 3 or 10 ,ug/ml were identical (unpublished results; refs. 3 and 16). These results show that the Oa mutation does not alter the interaction of the cAMP CRP complex with the gal promoter and RNA polymerase. DISCUSSION gal Operator Mutations with Reduced Affinity for Repressor. Operator loci have been previously identified by the isolation of strains with mutations (OC) that make the expression of the cognate structural genes constitutive in the presence of

Genetics: Irani et aL

Proc. Natl. Acad. Sci. USA 80 (1983)

a °

WT

t'

-85

t**SI-65 B '4!-55 -.4 35

i~j25

1 2 34 56

-5 7 8 91011

CRP

cAMP,

pM

40 4-

404

--

FIG. 3. DNase protection by cAMP-CRP on gal operator-promoter fragments. The autoradiograph shows the effect of cAMP and CRP upon DNase I digestion of O gal DNA (lanes 7-10) and 0! DNA (lanes 25). The radioactive DNA fragments used in both cases were labeled at theHindill site. They were incubated with DNase (0.1 /Ag/mI) for 1 min with no cAMP or CRP (lanes 5 and 10), no cAMP and CRP at 10 /Ag/ml (lanes 4 and 9), 4 pM cAMP and CRP at 10 pug/ml (lanes 3 and 8), or 40 aM cAMP and CRP at 10 ,ug/ml (lanes 2 and 7). The resulting mixtures were separated on the gels, which were calibrated with the products of the sequence analysis reactions performed with the same labeled fragments. The wild-type A+G reaction (lane 11) and the mutant C and A+G reactions (lanes 1 and 6, respectively) were used. The calibration numbers shown denote the number of bp upstream of the S1 transcription start (see Fig. 1). repressor. This approach yields not only operator mutations but also mutations that create a new promoter insensitive to the repressor, and it leaves out operator mutations that overlap with the promoter. We have developed a strategy to isolate operator mutations that eliminates these difficulties and is based on a stringent definition of the operator locus as the site of repressor binding. In this strategy we have employed a multicopy plasmid carrying the gal operator, and we have isolated operator mutants with reduced repressor affinity (O0), as well as their revertants. We have also described a method of transferring these mutations to the host chromosome so that their effect on the gal operon could be studied in cis. Effect of cAMP on gal Constitutivity. The study of the behavior of the gal operator affinity mutations (O0) located in the chromosome has revealed an effect of cAMP upon gal repression. The gal repressor is normally active on wild-type gal operator both in the presence and in the absence of cAMP, whereas strong Oc mutations are constitutive under both conditions. However, the two mutations (01 and 02) described here cause and only in a cya+ strain. In a cya- strain, partial constitutivity, Oa 0 and have no effect. The induced levels of enzymes in both cya+ and cya- strains are normal, suggesting that the activities of the promoters and their interactions with cAMP-CRP are not affected by the mutations. The latter is also evident from the cAMP-CRP binding and the transcription experiments with

O; in vitro. We have considered the following models to explain the behavior of the oa mutants. (i) Although the gal operator site

(around -60) and the cat locus (around -35) are physically distinct, a functional competition between the gal repressor and

4779

the cAMPCRP complex has been observed during in vitro transcription experiments (17). Normally the higher affinity of operator and repressor keeps the promoters repressed in vivo. In an operator with somewhat reduced affinity toward repressor (O; or O2), the cAMP CRP complex displaces the repressor, resulting in a partially constitutive phenotype in cya' (but not cya ) cells. (ii) The oa mutations change the binding of gal DNA to gal repressor so that the repressor effectively represses PG2 but not pGi. Use of the Titration Method. The trans titration method of isolating operator-affinity mutants described here could be useful for several purposes: (i) It may be used to identify negative regulation of an operon. If a multicopy plasmid carrying the putative operator segment of the operon increases the expression of corresponding chromosomal structural genes, it strongly indicates the presence of an unlinked repressor gene. (ii) Because the system utilizes the multicopy operator independently of the operon, one is able to isolate operator mutations that also decrease promoter function in a system in which operator and promoter loci overlap. Because the method of selection of the operator-affinity mutants does not demand promoter function, such oa mutations when assayed for their cis effect on the cognate operon may yield new information. (iii) The method provides a very powerful tool to isolate and study second-site revertants of Oc or Oa mutations. (iv) We believe that the titration method may be useful in isolating DNA-site mutations for other site-spectfwc DNA-protein interactions. The only restraints are that the protein should bind stably and normally be present in the cell in small amounts, in order to elicit a phenotypic response to its titration in trans. Note Added in Proof. We have recently discovered the existence of a second operator locus inside the galE structural gene (18). With the use of an appropriate plasmid, the affinity method would allow the isolation of strains with operator mutations that also cause a GalE- phenotype. We thank Max Gottesman and Douglas Ward for valuable discussions, Ira Pastan and Don Court for critical reading of the manuscript,

and Frances Herder and Annette Kuo for assistance.

1. Miller, J. H. & Reznikoff, W. S. (1978) The Operon (Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY).

2. Busby, S., Irani, M. & de Crombrugghe, B. (1982)J. Mot BioL 154, 197-209. 3. Musso, R. E., di Lauro, R., Adhya, S. & de Crombrugghe, B. (1977)

Cell 12, 847-854.

4. Taniguchi, T., O'Neill, M. & de Crombrugghe, B. (1979) Proc. NatL Acad. Sci. USA 76, 5090-5094. 5. di Lauro, R., Taniguchi, T., Musso, R. & de Crombrugghe, B. (1979) Nature (London) 279, 494-500. 6. Adhya, S. & Miller, W (1979) Nature (London) 279, 492-494. 7. Aiba, H., Adhya, S. & de Crombrugghe, B. (1981)J. BioL Chem. 256, 11905-11910. 8. Buttin, G. (1963)J. Mot Biol 7, 183-205. 9. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold Spring

Harbor Laboratory, Cold Spring Harbor, NY). Sobel, M. E., Adams, S. L., Avvedimento, E. V., di Lauro, R., Pastan, I., de Crombrugghe, B., Showalter, A., Pesciotta, D., Fietzek, P. & Olsen, B. (1980)J. Biol Chem. 255, 2612-2615. 11. Maxam, A. & Gilbert, W (1980) Methods EnzymoL 65, 499-560. 12. Chen, C. W. & Thomas, C. A., Jr. (1980) Anal Biochem. 101, 33910. Yamamoto, T.,

341. 13. Wilson, D. & Hogness, D. (1966) Methods Enzymol 8, 220-240. 14. Willard, M. & Echols, H. (1968)J. Mot Biol 32, 37-46. 15. Ullmann, A., Joseph, E. & Danchin, A. (1979) Proc. Natl Acad. Sci. USA 76, 3194-3197. 16. Nissley, S. P., Anderson, W. B., Gottesman, M. E., Perlman, R. L. & Pastan, I. (1971)J. BioL Chem. 246, 4671-4678. 17. Nakanishi, S., Adhya, S., Gottesman, M. & Pastan, I. (1973)J BioT Chem. 248, 5937-5942. 18. Irani, M., Orosz, L. & Adhya, S. (1983) Cell 32, 783-788.