ISSN 00268933, Molecular Biology, 2015, Vol. 49, No. 6, pp. 899–903. © Pleiades Publishing, Inc., 2015. Original Russian Text © E.S. Ioudinkova, A.V. Nefedochkina, O.V. Iarovaia, S.V. Razin, 2015, published in Molekulyarnaya Biologiya, 2015, Vol. 49, No. 6, pp. 1002–1006.
MOLECULAR CELL BIOLOGY UDC 577.21
Detection of Complementary Transcripts for the Intergenic Region of the Chicken αGlobin Gene Domain E. S. Ioudinkovaa, A. V. Nefedochkinab, O. V. Iarovaiaa, and S. V. Razina, b a
Institute of Gene Biology, Russian Academy of Sciences, Moscow, 117334; email:
[email protected] bBiological Faculty, Moscow State University, Moscow, 119992 Russia Received March 4, 2015; in final form, March 24, 2015
Abstract—Strandspecific reverse transcription with specific primers and subsequent quantitative realtime PCR with TaqMan probes were used to characterize the transcription profile for both strands of a chicken α globin gene domain region that harbors the embryonic gene π, the adult gene αD, and a spacer region between them. Complementary transcripts of the spacer region were observed in erythroid cells of the adult lineage. The observation implicates RNA interference in controlling the switch in αglobin gene expression. DOI: 10.1134/S0026893315060229 Keywords: αglobin gene domain, regulation of transcription, gene expression
INTRODUCTION As is well known, the protein component of hemo globin is an ultimate product of globin gene expres sion. A hemoglobin molecule consists of two α and two βsubunits, which are encoded by α and βglobin genes, respectively. Vertebrate hemoglobin changes in structure during differentiation, its structural forms being encoded by different gene groups. Expression switches from one gene group to another during devel opment. The mechanisms of the switch have been studied for a long time, and it is clear now that differ ent switching models are utilized in chromatin domains of different types. For instance, the active chromatin hub is reconfigured to include or include certain gene groups, thus ensuring the expression switch in the case of the chicken βglobin gene domain, which is a closed domain [1–3]. Another sce nario is characteristic of the αglobin gene domain, which is a domain with open boundaries, on evidence of 3C mapping. It has been shown that an adulttype active chromatin hub is already formed in blood eryth rocytes of 3dayold chicken embryos and that the embryonic gene does not belong to the hub [4]. Another model suggests the formation of an inactive het erochromatin subdomain as a mechanism repressing the embryonic gene [5]. However, inactivation of the embry onic gene has not been associated with the formation of an inactive chromatin domain in adulttype erythroblasts by probing the chromatin status of the relevant region (histone modification profiling within the αglobin gene domain in erythrocytes of 3 and 9dayold chicken embryos and an analysis of DNase I sensitivity for various regions of the domain) [6].
Ample recent data implicate small RNAs in regu lating gene expression [7–9]. RNA interference might contribute to inactivation of the embryonic αglobin gene in adult cells. Bidirectional transcription is one of the sources of small interfering RNAs (siRNAs) in the cell. In this work, the sense and antisense transcription profiles of the region that included the embryonic (π) and adult (αD) chicken globin genes were examined before and after the expression switch. Both of the DNA strands proved transcribed, potentially yielding doublestranded RNAs. EXPERIMENTAL RTPCR analysis of RNA. Total cell RNA was iso lated from blood cells of 3 and 9dayold chicken embryos with Trizol (Invitrogen) and digested with DNase I. The reverse transcription mixture contained 1 μg of RNA, specific primers, and Thermo Scientific RevertAid Premium reverse transcriptase (EP0731, Fermentas). Water was added in place of reverse tran scriptase in a negative control sample. Reverse tran scription was carried out at 60°С. The resulting cDNA was examined by realtime PCR with TaqMan probes and Hotstart DNA polymerase (SibEnzyme, Russia). Amplification included 94°С for 5 min and 55 cycles of 94°С for 15 s and 60°С for 60 s. Nucleotide sequences of the primers and TaqMan probes are shown in the table. To obtain a calibration curve for estimating the relative cDNA amount, PCRs were car ried out with several consecutive dilutions of chicken wholegenome DNA. PCR was run on a BioRad CFX96 RealTime System. The PCR results were pro cessed using BioRad CFX Manager software.
899
900
IOUDINKOVA et al.
Primers and TaqMan probes used for RTPCR analysis Target fragment
1
2
3
4
5
6
Nucleotide sequence, 5' → 3'
Oligonucleotide function Forward primer
GCTCACAGCAGTTTGAAGACCT
Reverse primer
CAAAACGCCTGGAGGAGAAC
TaqMan probe
(FAM)ACGCAT(BHQ1)GATCCGCACTTGAAATACA
Forward primer
TTCCAAACTTCAAGCTTCCAAA
Reverse primer
AAGACAACAAAGTTCAGCAGTGG
TaqMan probe
(FAM)ACGCAT(BHQ1)GATCCGCACTTGAAATACA
Forward primer
GGTCTCTGTGCTTTCATCTTTCA
Reverse primer
CACAGCTTAGTATTTTCCCCTCT
TaqMan probe
(FAM)ATTTCCAAACACACT(BHQ1)GCCTAAÀÑÀCGA
Forward primer
GTGTGGTATCATCCAGTGCATCT
Reverse primer
TCTCACTGGAAGAGCAGGGATA
TaqMan probe
(FAM)AGGAAGTGT(BHQ1)CTGCGTCTAAAGGCAGAGT
Forward primer
ACAGGACAGTGACTGCCAAC
Reverse primer
CTCACAGGCAGCTCCACACT
TaqMan probe
(FAM)CATCAAGGCT(BHQ1)GCACCCTGCAGT
Forward primer
CAGGCTCCTCCATCACACATT
Reverse primer
CCTCCTGGTGGGAAGCG
TaqMan probe
(FAM)TGGATGAGCT(BHQ1)TCTTGTCCTCGGCA
RESULTS AND DISCUSSION Expression of the embryonic π gene is limited, while expression of the αD and αA adult genes increases in the chicken αglobin gene domain on day 5 of embryo development [10]. Hence, blood cells of 3 and 9dayold chicken embryos were used in our experiments. The transcription status of the region of interest was probed by reverse transcription with spe cific primers and subsequent cDNA detection by real time PCR. Nonspecific primer annealing is a substan tial problem of this approach. To avoid nonspecific annealing, reverse transcription was carried out at a high temperature (60°С), using Thermo Scientific RevertAid Premium reverse transcriptase (EP0731, Fermentas). A model experiment showed that the enzyme ensures highly specific cDNA synthesis from the annealing sites of unique primers. A scheme of the model experiment is shown in Fig. 1a. Primer 1a/s was used to perform reverse transcription, and the result ing cDNA was detected using two primer sets, which annealed within one transcription unit, 3' (test frag ment 1) and 5' (test fragment 2) of the annealing site of
the specific reverse transcription primer. As is seen, when a lowtemperature reverse transcriptase was used for cDNA synthesis with the specific primer, the cDNA resulting from nonspecific primer annealing (fragment 2) accumulated to almost 80% of the spe cific cDNA (fragment 1) amount. With the reverse transcriptase that allowed the primer annealing tem perature to be increased to 60°С, the nonspecific cDNA proportion decreased to 2% (Fig. 1c), indicat ing that our system was sufficiently specific. Using the above scheme, we quantified the cDNAs synthesized from transcripts corresponding to the globin direction and oppositely directed transcripts in samples obtained before and after the αglobin gene expression switch. Six test fragments were chosen to cover the αglobin gene cluster. The same primers were employed in reverse transcription and subsequent PCR, like in the model experiment. Reverse (a/s) primers provided for cDNA synthesis from RNAs cor responding to the globin direction; and direct (s) ones, cDNA complementary to antiglobindirection RNA (Fig. 1). The resulting cDNA was quantified by real MOLECULAR BIOLOGY
Vol. 49
No. 6
2015
DETECTION OF COMPLEMENTARY TRANSCRIPTS
901
(a) 1s 1tm
2s 2tm
1
2 1a/s
2a/s
(b) 100 80 60 40 20 0 1
2 (c)
100 80 60 40 20 0 1
2
Fig. 1. Results of the model experiment performed to select the conditions for detecting bidirectional transcription from the chicken αglobin gene domain. (a) Scheme of the experiment. Primer and probe positions are indicated with arrows; s (sense), forward primer; a/s (antisense), reverse primer; tm, TaqMan probe. (b, c) RTPCR analysis with (b) EP0441 reverse transcriptase (Fermentas) and (c) thermostable EP073 reverse transcriptase (Fermentas). Ordinate, relative mRNA (cDNA) amount in the sample. The amount of the most abundant mRNA was taken as 100%. Whiskers show the standard deviation of the mean in a series of three independent experiments.
time PCR. Thus, the abundance of a particular test fragment reflected the level of transcription in both directions for a target region. The results were expressed as a ratio of the antiglobindirection tran scription level to the globindirection transcription level. Actively transcribed globin genes—namely, the embryonic gene in blood cells of 3dayold embryos and the αA and αD genes in blood cells of 9dayold embryos—were thereby excluded from the analysis. The results are shown in Fig. 2. First, it should be noted that the region between the embryonic π gene and the adult αD gene was transcribed in the globin direction in erythrocytes of both early and late embryos. The observation agrees with our previous data that lowlevel transcription in the globin direc tion involves the total αglobin gene domain, includ ing intergenic regions [11]. The spacer between the π and αD genes was transcribed predominantly in the MOLECULAR BIOLOGY
Vol. 49
No. 6
2015
globin direction in 3dayold embryos, the antiglobin to globindirection transcription level ratio being far lower than unity. The ratio increased to 1.7 in 9day old embryos; i.e., transcription in the antiglobin direc tion predominated. Thus, as the embryonic erythroid cell lineage is changed to a definitive one, the spacer between the embryonic and adult genes shows a sub stantial increase in transcription that proceeds in the direction opposite to the transcription direction of the globin genes. The finding indicates that RNA interfer ence is possible as a mechanism that switches off embryonic gene expression. Recent studies have associated RNA interference and siRNA with heterochromatin formation and gene silencing in various organisms, including plants and animals [7–9]. The siRNAmediated transcriptional regulation does not necessarily involve epigenetic
902
IOUDINKOVA et al. (a)
π 1
2
3
αD 4
5
4
5
6 0.5 kb
(b)
2.5 2.0 1.5 1.0 0.5 0 1
2
3
6
Fig. 2. RTPCR analysis of the transcription status of the αglobin gene region in chicken embryo cells. (a) Positions of the test fragments within the regions under study. (b) Ratio of the antiglobindirection transcription level (cDNA amount) to the globin direction transcription level (ordinate) was estimated for the test fragments (abscissa) RNA was isolated from blood cells of 3 and 9dayold embryos (dark gray and light gray columns, respectively). Whiskers show the standard deviation of the mean in a series of three independent experiments.
modification of chromatin. Small doublestranded RNAs complementary to promoter and intergenic noncoding regions have been found to regulate tran scriptional activity [12]. For instance, siRNA comple mentary to the cmyc promoter inhibits сmyc tran scription without epigenetic changes in chromatin composition. It is thought that transcription initiation is prevented by siRNA in this case [13]. Another study has implicated antisense RNAs in gene silencing at the level of promoter DNA methylation in mammalian cells [14]. The studies have shown again the important role small RNAs play in regulating gene expression, suggesting that a certain mechanism or several mech anisms should mediate siRNAdependent inactiva tion of transcription. We observed that antiglobindirection transcrip tion is substantially elevated in regions adjacent to the embryonic gene when the gene is functionally inactive. The finding gives grounds for assuming that antisense RNAs are involved in stagespecific repression of the π gene. A silencing of the chicken π gene has been shown to correlate with CpG methylation in the pro moter region [15]. It is possible that complementary RNAs help to recruit DNA methyltransferases, which methylate cytosines in promoter DNA. ACKNOWLEDGMENTS This work was supported by the Russian Science Foundation (project no. 142400022).
REFERENCES 1. Razin S.V., Ulianov S.V., Ioudinkova E.S., Gushchan skaya E.S., Gavrilov A.A., Iarovaia O.V. 2012. Domains of α and βglobin genes in the context of the struc turalfunctional organization of the eukaryotic genome. Biochemistry (Moscow). 77, 1409–1423. 2. de Laat W., Grosveld F. 2003. Spatial organization of gene expression: The active chromatin hub. Chromo some Res. 11, 447–459. 3. Tolhuis B., Palstra R.J., Splinter E., Grosveld F., de Laat W. 2002. Looping and interaction between hyper sensitive sites in the active betaglobin locus. Mol. Cell. 10, 1453–1465. 4. Gavrilov A.A., Razin S.V. 2008. Spatial configuration of the chicken alphaglobin gene domain: immature and active chromatin hubs. Nucleic Acids Res. 36, 4629–4640. 5. RinconArano H., Guerrero G., ValdesQuezada C., RecillasTarga F. 2009. Chicken alphaglobin switching depends on autonomous silencing of the embryonic π globin gene by epigenetics mechanisms. J. Cell Biochem. 108, 675–687. 6. Ioudinkova E.S., Ulianov S.V., Bunina D.A., Iarovaia O.V., Gavrilov A.A., Razin S.V. 2011. The inactivation of the π gene in chicken erythroblasts of adult lineage is not mediated by packaging of the embryonic part of the αglobin gene domain into a repressive heterochroma tinlike structure. Epigenetics. 6, 1481–1488. 7. Burton N.O., Burkhart K.B., Kennedy S. 2011. Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 108, 19683–19688. 8. Giles K.E., Ghirlando R., Felsenfeld G. 2010. Mainte nance of a constitutive heterochromatin domain in ver MOLECULAR BIOLOGY
Vol. 49
No. 6
2015
DETECTION OF COMPLEMENTARY TRANSCRIPTS
9.
10. 11.
12.
tebrates by a Dicerdependent mechanism. Nat. Cell. Biol. 12, 94–99. Verdel A., Vavasseur A., Le Gorrec M., TouatTodes chini L. 2009. Common themes in siRNAmediated epigenetic silencing pathways. Int. J. Dev. Biol. 53, 245–257. Knezetic J., Felsenfeld G. 1993. Mechanism of devel opmental regulation of α–π, the chicken embryonic αglobin gene. Mol. Cell. Biol. 13, 4632–4639. Razin S.V., Rynditch A., Borunova V., Ioudinkova E., Smalko V., Scherrer K. 2004. The 33 kb transcript of the chicken alphaglobin gene domain is part of the nuclear matrix. J. Cell Biochem. 92, 445–457. Janowski B.A., Corey D.R. 2010. Minireview: Switch ing on progesterone receptor expression with duplex RNA. Mol. Endocrinol. 24, 2243–2252.
MOLECULAR BIOLOGY
Vol. 49
No. 6
2015
903
13. Napoli S., Pastori C., Magistri M., Carbone G.M., Catapano C.V. 2009. Promoterspecific transcriptional interference and cmyc gene silencing by siRNAs in human cells. EMBO J. 28, 1708–1719. 14. Morris K.V., Chan S.W.L., Jacobsen S.E., Looney D.J. 2004. Small interfering RNAinduced transcriptional gene silencing in human cells. Science. 305 (5688), 1289–1292. 15. Singal R., van Wert J., Ferdinand L. 2002. Methylation of alphatype embryonic globin gene alpha pi represses transcription in primary erythroid cells. Blood. 100, 4217–4222.
Translated by T. Tkacheva
