Clinical Chemistry 45:8 1162–1167 (1999)
Molecular Diagnostics and Genetics
Detection of Mitochondrial DNA Mutations by Temporal Temperature Gradient Gel Electrophoresis Tian-Jian Chen,1,2 Richard G. Boles,2 and Lee-Jun C. Wong1,2* Background: A unique requirement for the molecular diagnosis of mitochondrial DNA (mtDNA) disorders is the ability to detect heteroplasmic mtDNA mutations and to distinguish them from homoplasmic sequence variations before further testing (e.g., sequencing) is performed. We evaluated the potential utility of temporal temperature gradient gel electrophoresis (TTGE) for these purposes in patients with suspected mtDNA mutations. Methods: DNA samples were selected from patients with known mtDNA mutations and patients suspected of mtDNA disorders without detectable mutations by routine analysis. Six regions of mtDNA were PCR amplified and analyzed by TTGE. Electrophoresis was carried out at 145 V with a constant temperature increment of 1.2 °C/h. Mutations were identified by direct sequencing of the PCR products and confirmed by PCR/allele-specific oligonucleotide or PCR/restriction fragment length polymorphism analysis. Results: In the experiments using patient samples containing various amounts of mutant mtDNA, TTGE detected as little as 4% mutant heteroplasmy and identified heteroplasmy in the presence of a homoplasmic polymorphism. In 109 specimens with 15 different known mutations, TTGE detected the presence of all mutations and distinguished heteroplasmic mutations from homoplasmic polymorphisms. When 11% of the mtDNA genome was analyzed by TTGE in 104 patients with clinically suspected mitochondrial disorders, 7 cases of heteroplasmy ('7%) were detected.
1 Institute for Molecular and Human Genetics, Georgetown University Medical Center, Washington, DC 20007. 2 Division of Medical Genetics, Children’s Hospital Los Angeles, and Department of Pediatrics, University of Southern California, School of Medicine, Los Angeles, CA 90027. *Address correspondence to this author at: Institute for Molecular and Human Genetics, 3800 Reservoir Rd. NW, Suite 4000, Georgetown University Medical Center, Washington, DC 20007. Fax 202-784-1770; e-mail
[email protected]. Received February 11, 1999; accepted April 14, 1999.
Conclusions: TTGE distinguishes heteroplasmic mutation from homoplasmic polymorphisms and appears to be a sensitive tool for detection of sequence variations and heteroplasmy in patients suspected of having mtDNA disorders. © 1999 American Association for Clinical Chemistry
Mitochondrial genetics is non-Mendelian in many aspects. Mitochondrial DNA (mtDNA)3 is maternally inherited. Each cell contains hundreds to thousands of mitochondria. Mutant and wild-type mtDNA may coexist in the same cell to various degrees, a phenomenon known as heteroplasmy (1 ). The mitochondrial disorders represent a group of heterogeneous diseases that are usually manifested in tissues with high energy demands, such as nerve, muscle, endocrine gland, and kidney, and can be caused by mutations in either nuclear DNA or mtDNA (1 ). In the case with mtDNA mutations, clinical expression of disease depends on the percentage of mutant mtDNA in various tissues. Confirmatory diagnosis of a mtDNA disorder is achieved by mutational analysis of mtDNA. In the past decade, .50 mutations in mtDNA have been discovered (1, 2 ). In our recent studies, analysis of 44 known mutations detected disease-causing heteroplasmic mutations in only 5.9% of 2000 patients referred for mtDNA analysis (3 ), suggesting that clinical heterogeneity complicates the diagnosis and that the majority of the pathogenic mutations may not have been identified. These unidentified mutations may occur in either nuclear DNA or mtDNA. Methods for the detection of point mutations as well as small insertions and deletions in clinical diagnostics have been reviewed recently (4 ). For unknown mutations, the gold standard is direct DNA sequencing, although it is not practical to routinely sequence the entire 16.6-kb
3 Nonstandard abbreviations: mtDNA, mitochondrial DNA; DGGE, denaturing gradient gel electrophoresis; TGGE, temperature gradient gel electrophoresis; TTGE, temporal temperature gradient gel electrophoresis; HA, heteroduplex analysis; and EMC, enzyme mismatch cleavage.
1162
Clinical Chemistry 45, No. 8, 1999
1163
Fig. 1. TTGE mutation detection system. In the TTGE mutation detection system, the denaturing environment is formed by a constant concentration of urea in the polyacrylamide gel and a temporal temperature gradient (0.5–3 °C/h). During electrophoresis, double-stranded DNA will become partially denatured. When DNA denaturation begins, its electrophoretic mobility decreases. Because of different melting behaviors, mutant (Mu) and wild-type (Wt) molecules are separated on the gel as they begin to denature at different temperature.
mtDNA in all patients in which a mtDNA mutation is suspected. Commonly used screening methods include denaturing gradient gel electrophoresis (DGGE) (5 ), temperature gradient gel electrophoresis (TGGE) (6 ), singlestranded conformation polymorphism, heteroduplex analysis (HA), chemical mismatch cleavage, enzyme mismatch cleavage (EMC), the protein truncation test, mismatch-binding protein, and cleavase fragment length polymorphism. The drawbacks of these methods include low sensitivity (single-stranded conformation polymorphism, HA), difficulty in casting gels (DGGE), synthesis of GC-clamped primers (DGGE, TGGE), limitation of detection to heterozygous or heteroplasmic mutations (HA, chemical mismatch cleavage, EMC), high background (chemical mismatch cleavage, EMC), lack of experience (cleavase fragment length polymorphism, EMC, mismatchbinding protein), and preferential elimination of unstable mutant transcripts (protein truncation test) (4). mtDNA is highly polymorphic, and these single nucleotide polymorphisms are usually homoplasmic. Thus, a unique requirement for the molecular diagnosis of mtDNA disorders is the ability to detect heteroplasmic mtDNA mutations and to distinguish them from homoplasmic sequence variations. Temporal temperature gradient gel electrophoresis (TTGE) was first introduced by Yoshino et al. (7 ) in 1991. It is based on the sequencespecific melting behavior of wild-type and mutant DNA
in a temporal temperature gradient that increases gradually in a linear fashion over the length of the electrophoresis (Fig. 1). TTGE differs from TGGE, which has been reported several times, in that TGGE has a fixed temperature gradient from top to bottom of the gel (6 ). In TTGE, the temperature at any location of the entire gel is the same at any given time but changes with respect to time (temporal temperature). Thus, it is easier to modulate the temperature over time and provide a wider separation range that increases sensitivity. TTGE, a modified highthroughput form (parallel form) of DGGE, is much more robust and has a broader separation range than DGGE. Thus, several fragments with different melting behaviors can be analyzed on the same TTGE gel. TTGE does not require the preparation of a chemical denaturant gradient gel and can be performed without a GC clamp. Recently, TTGE has been shown to be a powerful tool for the detection of novel nuclear DNA mutations (8 –10 ). In the study reported here, we first evaluated the sensitivity and specificity of TTGE in the analysis of previously identified mtDNA homoplasmic and heteroplasmic mutations. We then used TTGE to search for unknown mtDNA mutations. Our results demonstrate that heteroplasmic and homoplasmic mtDNA mutations can easily and effectively be detected and distinguished from one another by TTGE. Further testing and sequence confirmation of the mutations can be performed only on the
1164
Chen et al.: mtDNA Analyzed by TTGE
heteroplasmic cases, greatly reducing the time and effort spent on the investigation of potentially benign polymorphic homoplasmic mutations.
Materials and Methods Patients suspected of mtDNA disorders were referred to the molecular genetics laboratory at Children’s Hospital Los Angeles for mutational analysis according to protocol 90117, approved by the Committee on Clinical Investigations. DNA was extracted from peripheral blood lymphocytes according to published procedures and stored at 4 °C (11 ). The presence of large deletions and 12 common point mutations were studied by standard Southern analysis and the PCR/allele-specific oligonucleotide method (3, 12 ). The percentage of heteroplasmic mutations was determined by the PCR/restriction fragment length polymorphism method as described previously (13 ). One hundred nine samples with 15 different known mutations and various percentages of heteroplasmy were chosen for the evaluation of potential utility of TTGE method. From .2000 patients who tested negative for the routine analysis to exclude the presence of the most common heteroplasmic mutations—A3243G, A8344G, G8363A, T8993C, and T8993G (3, 14 )—104 patients were selected for TTGE analysis. The selection criteria were based on strong indications of mitochondrial disorders from other studies, such as clinical presentations, biochemical assays, histochemistry of muscle biopsies, and pedigree analysis. Regions of mtDNA were PCR amplified, followed by TTGE analysis. Each region was named based on the tRNAs located within it, although the majority of each region consists of protein-coding genes. The primers used in PCR amplification and the temperature range of the TTGE analysis are listed in Table 1. Each 100-mL PCR reaction mixture contained 13 Promega PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 9.0, 1 mL/L Triton X-100), 1.5 mmol/L MgCl2, 0.2 mmol/L each dNTP, 0.5 mmol/L each primer, 1 U of Taq DNA polymerase (Promega), and 100 ng of genomic DNA. The
reaction mixture was denatured at 94 °C for 4 min, followed by 30 cycles of 30 s of denaturation at 94 °C, 45 s of reannealing at 55 °C, and 45 s of extension at 72 °C. The PCR reaction was completed by a final extension cycle at 72 °C for 4 min. PCR products were denatured at 95 °C for 30 s and slowly cooled to 45 °C for a period of 45 min at a rate of 1.1 °C/min. The reannealed homoduplexes and heteroduplexes were kept at 4 °C until being loaded onto the gel. TTGE was performed on a Bio-Rad D-Code apparatus. Two back-to-back 20 cm 3 20 cm 3 1 mm 6% polyacrylamide (acrylamide:bis ratio, 37.5:1, by weight) gels were prepared in 1.253 Tris-acetate-EDTA buffer containing 6 mol/L urea. Denatured and reannealed PCR product (5 mL) was loaded onto the gel. The electrophoresis was carried out at 145 V for 6 –7 h at a constant temperature increment of ;1.2 °C/h as shown in Table 1. The temperature range was determined by computer simulation (MacMelt software; Bio-Rad Laboratories). The gels were stained in 2 mg/L ethidium bromide for 5 min and imaged with a digital CCD gel documentation system. Confirmation of the nucleotide alteration was performed by direct DNA sequencing of the PCR product, using a dye terminator cycle sequencing kit (PerkinElmer) and an ABI 373A or 377 (Applied Biosystems) automated sequencer. To detect low-percentage mutant mtDNA by sequencing, the homoduplex mutant or the heteroduplex bands were excised from the TTGE gel and PCR amplified before sequence analysis. Once the mutation was identified by sequencing, a second method such as PCR/allele-specific oligonucleotide dot blot or PCR/ restriction fragment length polymorphism analysis was used to confirm the status of homoplasmy or heteroplasmy (13, 14 ).
Results The ability of TTGE to detect known heteroplasmy was demonstrated by the analysis of different percentages of the mutant A3243G heteroplasmy. As shown in Fig. 2, wild-type mtDNA (lanes 1 and 11) consistently produces a sharp single band, whereas homoplasmic sequence
Table 1. Summary of analyzed mtDNA fragments and TTGE conditions. Nucleotide positions
Fragment size, bp
L
3116–3758
643
IQM
4013–4508
496
WANCY
5451–6016
566
K
7804–8380
577
ATPase8/6
8334–9199
866
11688–12360
673
Regions
HSL a
F, forward; R, reverse.
PCR primers
F:a CCTCCCTGTACGAAAGGAC R: AGTAGAATGATGGCTAGGGTGAC F: CCCTCACCACTACAATCTT R: GATGGTAGAGTAGATGACG F: ACACTCATCGCCCTTACCA R: CGAATAAGGAGGCTTAGAG F: AGTCCTCATCGCCCTCCC R: ATTTAGTTGGGGCATTTCACTGTA F: GATTAAGAGAACCAACACCTCTTTACGGT R: TGTCGTGCAGGTAGAGGCTT F: CCGGCGCAGTCATTCTCA R: GGTTATAGTAGTGTGCATG
Temperature range for TTGE, °C
56–64 54–58 54–60 54–60 53–62 53–61
Clinical Chemistry 45, No. 8, 1999
1165
Fig. 2. Detection of the heteroplasmic A3243G mutation. PCR products of 643 bp (nucleotides 3116 –3758) containing the tRNALeu (UUR) and parts of the 16S rRNA and ND1 regions were analyzed. Lanes 1 and 11, wild type; lane 2, homoplasmic T3197C; lane 3, homoplasmic T3197C with 47% heteroplasmy for A3243G; lanes 4 –10, different proportions of A3243G mutant DNA. The numbers under each lane indicate the percentages of mutant A3243G mtDNA.
variations produce a shifted band (Fig. 2, lane 2). Under optimal conditions, a single heteroplasmic mutation produces four bands representing the wild-type and mutant homoduplex bands (Fig. 2, lower two bands of lanes 3–10) and two wild-type/mutant heteroduplex bands (Fig. 2, upper two bands of lanes 3–10). As can be seen in Fig. 2, the intensities of the two heteroduplex and the mutant homoduplex bands increase as the percentage of the mutant A3243G mtDNA increases from 4% to 62% (Fig. 2, lanes 4 –10). Mutant heteroplasmy as low as 4% was detected. The detection of the heteroplasmic A3243G mutation in the presence of a homoplasmic T3197C background is also illustrated, where the wild-type homoduplex and all other bands are down-shifted (Fig. 2, lane 3). Fig. 3 shows the banding shift of homoplasmic single nucleotide substitutions in two different regions of mtDNA. These results clearly display the power of TTGE to detect and distinguish homoplasmic and heteroplasmic mutations as well as to identify heteroplasmy in the presence of a homoplasmic polymorphism. To further establish the utility of TTGE, 109 samples with 15 different known mutations in 6 different regions of mtDNA were analyzed. The percentage of mutant mtDNA in the samples with heteroplasmy varied from 4% to 95%. The results summarized in Table 2A demonstrate that every one of these known mutations was detected and correctly identified as either homoplasmic or heteroplasmic. Each mutation showed a distinct pattern on TTGE that is reproducible on repeat analysis.
TTGE was also applied to detect unknown mutations in a patient population as described in Materials and Methods. In each of these 104 cases, a mitochondrial disorder was suspected to various degrees by the referring clinician. All samples had tested negative for large deletions and common point mutations. Three regions, the L, K, and WANCY regions, representing ;11% of the entire mitochondrial genome were screened by TTGE. Table 2B summarizes the results. Homoplasmic sequence variations (shifted single band) was detected in 11 patients. Seven samples repetitively showed multiple bands, suggesting the presence of heteroplasmy. Outside the hypervariable D-loop region, heteroplasmy is believed to be rare and is more likely to be associated with disease. Thus, heteroplasmy should occur at a higher frequency in a patient population than in the general population. This hypothesis was tested by the analysis of DNA samples from 50 individuals with phenylketonuria, a disorder unrelated to mtDNA mutations. All 50 samples showed a single band in each of the previous three different mtDNA regions (Table 2B), demonstrating the absence of heteroplasmy. Two samples did show a shifted single band, a homoplasmic sequence variation pattern, which is consistent with the known high frequency of polymorphisms in mtDNA. However, multiple banding patterns, which were detected in 7% of the patients when 11% of the mtDNA regions were analyzed, were not detected in any of the 50 phenylketonuria patients. These data suggest that heteroplasmic
Fig. 3. Detection of homoplasmic mtDNA variants. PCR products from the L (643 bp) and IQM (496 bp) regions were analyzed by TTGE according to the conditions described in Table 1. Homoplasmic mtDNA variants, G3315A and G3460A (L region) and T4216C and T4336C (IQM region) showed a single band shift on TTGE gel.
1166
Chen et al.: mtDNA Analyzed by TTGE
Table 2. Summary of mutational analysis by TTGE. A. Patients with known mtDNA mutations tested by TTGE Base substitution
T3197C A3243G A3243G 1 T3197C G3315A T3394C G3460A T4216C A4317G T4336C A8344G G8363A T8993C T8933G G11778A A12308G T12311C Total
Homoplasmy or heteroplasmy
Polymorphism or mutation (phenotype)
No. of patients tested
Homoplasmy Heteroplasmy Homo1hetero
Polymorphism Mutation (MELAS)b Mutation, polymorphism
Homoplasmy Homoplasmy Homoplasmy Homoplasmy Homoplasmy Homoplasmy Heteroplasmy Heteroplasmy Heteroplasmy Heteroplasmy Homoplasmy Homoplasmy Homoplasmy
Polymorphism Polymorphism Mutation, (LHON)d Mutation (LHON) Disease associatione Disease associatione Mutation (MERRF)b Mutation (cardiomyopathy) Mutation (NARP)d Mutation (NARP) Mutation (LHON) Polymorphism Disease associatione
No. of patients with positive results
10 30 1
10 30 1
5 4 1 10 1 7 12 6 10 1 1 9 1 109
5 4 1 10 1 7 12 6 10 1 1 9 1 109
Number of bands detected
Singlea Multiplec Shifted, multiplec Singlea Singlea Singlea Singlea Singlea Singlea Multiplec Multiplec Multiplec Multiplec Singlea Singlea Singlea
B. Patients with various phenotypes and unknown mutations detected by TTGE R/O mitochondrial disorders
Phenylketonuria
Area amplified
Region name
No. of patients tested
No. of patients shift banda
No. of patients mult. bandc
No. of patients tested
No. of patients shift bandc
No. of patients mult. bandc
3116–3758 5451–6016 7804–8380
Lf WANCYg Kh
104 104 104
5 3 3
1 3 3
50 50 50
2 0 0
0 0 0
Single band on gel shifted relative to control 5 homoplasmy sequence variation pattern. MELAS, mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes; homo, homoplasmy; hetero, heteroplasmy; LHON, leber hereditary optic neuropathy; MERRF, myoclonic epilepsy and ragged red fibers; NARP, neuropathy, ataxia, and retinitis pigmentosa; mult., multiple. c Multiple bands on gel 5 heteroplasmy pattern. d In LHON, homoplasmic mutations lead to adult-onset visual loss. NARP is a childhood-onset mitochondrial disorder. e A4317G associated with FICP (fatal infantile cardiomyopathy); T4336C associated with increased risk of Alzheimer/Parkinson disease; T12311C associated with LIMM (lethal infantile mitochondria myopathy). f L region includes the transcription terminator, parts of 16S rRNA and ND1 genes, and t-RNA for Leu. g WANCY region includes part of ND2 gene, the light strand origin of replication, and t-RNAs for Trp, Ala, Asn, Cys, and Tyr. h K region includes part of COXII gene and t-RNA for Lys. a b
mtDNA mutations are rare in controls and, when present, are likely disease causing. Some of our TTGE results for the K and WANCY regions in the patient population are shown in Fig. 4. Each heteroplasmic mutation (Fig. 4, lanes 2– 6) demonstrates a distinct TTGE pattern. Theoretically, a single heteroplasmic mutation in the DNA fragment to be analyzed would produce four bands on TTGE. However, depending on the melting behavior of the mutant DNA fragment, the location of the mutation in the fragment, and the TTGE conditions, it is possible to have three or two bands as shown in Fig. 4. To identify the mutations, mutant bands were excised from the TTGE gel, PCR amplified, and sequenced. The samples in lanes 3– 6 were identified as having the heteroplasmic mutations of T8300C, nt8042del AT, C5499T, and A5951G, respectively. The mutations were further confirmed by either PCR/allele-specific oli-
gonucleotide or PCR/restriction fragment length polymorphism analysis. Other heteroplasmic variations detected by TTGE are being confirmed by sequencing analysis. The nt8042del AT mutation in the gene encoding the cytochrome C oxidase II subunit produces a truncated protein that is 68 amino acids shorter than normal. This mutation is thus predicted to be detrimental. The quantification of the heteroplasmy and the biochemical and clinical significance of these novel mutations will be described elsewhere.
Discussion In two recent reports (15, 16 ), DGGE was used as a rapid and sensitive method for the exhaustive scanning of mtDNA mutations. A narrow- or broad-range denaturant gradient parallel to the direction of electrophoresis was required (15 ). In addition, at least 15 pairs of GC-clamped
1167
Clinical Chemistry 45, No. 8, 1999
TTGE is suitable for the mutational screening of the entire mitochondrial genome in large patient populations. The existence of a cost-effective screening assay for mtDNA mutations would have high utility considering the high variability in the clinical presentation of these disorders. As an example of the potential usefulness of such screening assay, in this study, 7 specimens with heteroplasmy were identified from 104 patients by scanning only 11% of the mitochondrial genome. Our data suggest that mtDNA heteroplasmy may be more common than previously reported. As a heteroplasmy screening assay, TTGE may also be a suitable screening technique for other applications such as in evolutionary studies and forensics.
References Fig. 4. Detection of unknown mutations in mtDNA. PCR products from the K (lanes 1– 4) and WANCY (lanes 5–7) regions, 577 bp and 566 bp in size, respectively, were analyzed by TTGE. Lanes 1 and 7, wild type; lanes 2–5, various heteroplasmic mutations; lane 6, possible multiple heteroplasmic mutations.
primers were synthesized, with most PCR fragments of ;200 –300 base pairs in size. In TTGE, which is based on the principle of DGGE, the denaturant gradient is achieved by temporal temperature gradient, thus eliminating the inconvenience of preparing the chemical denaturant gradient gel. We also improved the method by increasing the fragment size up to 1 kb and eliminating the use of GC clamps. Thus, TTGE is simple and more costeffective without sacrificing sensitivity. The separation range of TTGE is flexible and can be easily regulated by adjusting the temperature range (narrow or broad) and ramp. Heteroplasmy is characteristic of pathogenic mtDNA mutations. An apparent TTGE heteroplasmic pattern may, however, be the result of blood transfusion or bone marrow transplantation. Therefore, analysis of a second blood specimen or a tissue specimen other than blood is necessary to confirm the finding. There are two major goals in molecular diagnosis of mtDNA disorders. The first is to detect any sequence variations at any position of the mtDNA genome. The second is to determine whether the sequence variation is homoplasmic or heteroplasmic. Our data demonstrate that TTGE accomplishes both of these goals; it is both sensitive and specific in the detection of mtDNA heteroplasmy and is more cost-effective because the fragment size is much larger than those used in single-stranded conformation polymorphism, HA, or DGGE. Although it is not possible to determine the false-negative rate across the mtDNA at this time, all of 104 known mutations were correctly detected by this method. A mutation could be detected as close as 29 nucleotides from the end of a fragment. At the present configuration, as many as 50 samples can be analyzed simultaneously for fragments up to 1 kb in length, and the entire procedure can be completed within 1 working day. By screening for the presence of heteroplasmy and ignoring the frequent homoplasmic polymorphisms,
1. Shoffner J, Wallace D. Oxidative phosphorylation diseases. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease, 7th ed. New York: McGrawHill, 1995:1535– 629. 2. Kogelnik AM, Lott MY, Brown MD, Navathe SB, Wallace DC. MITOMAP. A human mitochondrial genome database. Nucleic Acids Res 1996;24:177–9. 3. Wong L, Liang MH. Yield of mtDNA mutation analysis in 2000 patients. Am J Med Genet 1998;77:395– 400. 4. Nollau P, Wagener C. Methods for detection of point mutations: performance and quality assessment. Clin Chem 1997;43: 1114 –28. 5. Myers RM, Maniatis T, Lerman LS. Detection and localization of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol 1987;155:501–27. 6. Wartell R, Hosseini SH, Moran CP Jr. Detecting base pair substitutions in DNA fragments by temperature-gradient gel electrophoresis. Nucleic Acids Res 1990;18:2699 –705. 7. Yoshino K, Nishigaki K, Husimi Y. Temperature sweep gel electrophoresis: a simple method to detect point mutations. Nucleic Acids Res 1991;19:3153. 8. Marsh DJ, Dahia PLM, Caron S, Kum JB, Frayling IM, Tomlinson IPM, et al. Germline PTEN mutations in Cowden syndrome-like families. J Med Genet 1998;35:881–5. 9. Bjorheim J, Lystad S, Lindblom A, Kressner U, Westring S, Wahlberg S, et al. Mutation analysis of KRAS exon 1 comparing three different techniques: temporal temperature gradient electrophoresis, constant denaturant capillary electrophoresis and allele specific polymerase chain reaction. Mutat Res 1998; 403:103–12. 10. Kressner U, Bjorheim J, Westring S, Wahlberg S, Pahlman L, Glimeliu B, et al. Ki-ras mutations and prognosis in colorectal cancer. Eur J Cancer 1998;34:518 –21. 11. Lahiri D, Nurnberger J Jr. A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res 1991;19:5444. 12. Boles R, Chun N, Senadheera D, Wong, L. Cyclic vomiting syndrome and mitochondrial DNA mutations. Lancet 1997;350:1299 –300. 13. Wong L, Lam C. Alternative, noninvasive tissues for quantitative screening of mutant mitochondrial DNA. Clin Chem 1997;43:1241–3. 14. Wong L, Senadheera D. Direct detection of multiple point mutations in mitochondrial DNA. Clin Chem 1997;43:1857– 61. 15. Hanekamp JS, Thilly WG, Chaudhry MA. Screening for human mitochondrial DNA polymorphisms with denaturing gradient gel electrophoresis. Hum Genet 1996;98:243–5. 16. Michikawa Y, Hofhaus G, Lerman LS, Attardi G. Comprehensive, rapid and sensitive detection of sequence variants of human mitochondrial tRNA genes. Nucleic Acids Res 1997;25: 2455– 63.
