Development and Application of Reverse Transcription Loop-Mediated Isothermal Amplification for Detecting Live Shewanella putrefaciens in Preserved Fish Sample Chenghua Li, Qi Ying, Xiurong Su, and Taiwu Li
Abstract: Given that live Shewanella putrefaciens is one of the major causes of spoilage for aquatic products even in chill storage, the rapid and accurate detection process is the first priority. In the present study, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) detecting assay was developed by targeting internal transcribed spacer (ITS) sequence between 16S and 23S rRNA. At the same time, a new procaryotic mRNA isolation strategy was also established by introducing a polyA tail to RNA during cDNA synthesis step. Under the optimal reaction time (60 min) and temperature (64.1 ◦ C), S. putrefaciens could be specially identified from a variety of other tested bacteria by RT-LAMP. The sensitivity analysis showed that RT-LAMP could be identified as lower as 5.4 copies per reaction, which is over 200-fold higher than that of standard PCR (1.08 × 103 copies per reaction). The method could be effectively identified S. putrefaciens in artificially contaminated or spoilaged fish samples with dose-dependent manners. To our knowledge, this is the first report using RT-LAMP assay to detect live S. putrefaciens in fish.
M: Food Microbiology & Safety
Keywords:
live bacteria, ITS, RT-LAMP, Shewanella putrefaciens
Practical Application: The study provided a rapid and accurate detection method for live bacteria in aquatic food and
established a new procaryotic mRNA isolation strategy at the same time, which will be useful for food preservation.
Introduction Food spoilage is one of global concerns as more than 25% of the food produced worldwide is lost in postharvest every year, especially for aquatic product. A combination of various factors like light, oxygen, heat, humidity, and microorganisms has been demonstrated to be the potential cause for this phenomena, in which microbial degradation manifests itself as the key one compared to the other counterparts (Gram and Dalgaard 2002). Live bacteria could produce amines, sulfides, alcohols, aldehydes, ketones, and organic acids during aquatic product preservation, resulting in unpleasant and unacceptable off-flavors. On contrast, the presence of dead bacteria in food do not cause any change on the quality of food (Skjerdal and others 2004). Shewanella putrefaciens, also known as Pseudomonas putrefaciens, was one of species in Alteromonadales, Shewanellaceae, Shewanella. The bacteria attracted much attention because it had been considered as the crucial bacterium for cold stored fish spoilage. Given that the economic importance for aquatic fish perservation, development, and implication of a rapid detection method for the bacteria is the first priority (Caipang and others 2010). Several methods have been established to detect S. putrefaciens in MS 20111236 Submitted 10/11/2011, Accepted 1/5/2012. Authors C. Li, Ying, Su, and T. Li are with the School of Marine Science, Ningbo Univ., Ningbo, Zhejiang 315211, China. Author T. Li is with Ningbo City College of Vocational Technology, Ningbo, Zhejiang 315110, China. Direct inquiries to author Xiurong Su (E-mail:
[email protected],
[email protected]).
M226
Journal of Food Science r Vol. 77, Nr. 4, 2012
food products or in fields. Traditional culture methods such as selective and differential microbiological media can effectively detect and identify S. putrefaciens from preserved fish. However, the method is very time-consuming even though it has been widely used in many laboratories (Miller and others 2011). Polymerase chain reaction (PCR) method has been developed to detect the bacterial strains in the food products rapidly and accurately. A 16S rRNA-targeted oligonucleotide probe specific for S. putrefaciens was constructed by Dichristina and DeLong (1993). Plate-assaybased screening techniques was also employed to identify Mn(IV) reduction-deficient (Mnr) mutants (Brian and others 1998). However, the presence of dead cells limited its use in microbiological detection of aquatic food samples (Chaiyanan and others 2001). Nowadays, several researchers have attempted to utilize products of real time PCR targeted to specific mRNA (Miller and others 2010; Reimann and others 2010; Techathuvanan and others 2010) or rRNA (Kurabachew and others 1998; Hirawati and others 2006) as an alternative marker, and internal transcribed spacer (ITS) is attracting much more attention for its higher resolution of bacteria detection (Cangelosi and others 1996). The major disadvantage to this method is expensive instrument needed and specialized expert required for data analysis. Loop-mediated isothermal amplification (LAMP) is considered to be one of the most promising analytical methods for its advantage of rapid, simple, highly sensitive, and on-site convenience (Zhao and others 2009; Caipang and others 2010). LAMP is based on the principle of strand-displacing Bst DNA polymerase to amplify the target sequence with high selectivity. DNA R C 2012 Institute of Food Technologists doi: 10.1111/j.1750-3841.2012.02636.x
Further reproduction without permission is prohibited
RT-LAMP detecting live S. putrefaciens . . .
Materials and Methods
vector (TAKARA, Dalian, Liaoning province, China) and transformed to competent E. coli DH5α for sequencing.
Design of primers for RT-LAMP Sets of RT-LAMP primers (Table 2) were designed with the aid of the online software Primerexplorer V4 (http:// primerexplorer.jp/elamp4.0.0/index.html) based on the ITS sequences of S. putrefaciens. Preparation bacterial total RNA Thirty milliliters of bacterial cultures at exponential growth stage (OD600 = 0.8) was chilled on ice. Cells were harvested immediately by centrifugation at 5000 × g for 10 min at 4 ◦ C and homogenized vigorously to a fine powder using a homogenizer with a cooling jacket full of liquid nitrogen. The powder was suspended in 1 mL of RNAisol reagent (TAKARA, Dalian, Liaoning province, China) and RNA was extracted by adding 0.25 mL of chloroform followed by centrifugation at 12 000 × g for 15 min at 4 ◦ C. The RNA-containing aqueous phase was collected and the RNA was precipitated by adding 750 μL of isopropanol and centrifuge at 7500 × g for 10 min at 4 ◦ C. After being washed with 75% ethanol and dried at room temperature for 10 min, the RNA pellet was resuspended in 20 μL DEPC water by gently pipetting up and down. RNA concentration was determined by measurement of the optical density at 260 nm. Another 30 mL S. putrefaciens culture was autoclaved at 120 ◦ C for 20 min and RNA was collected to serve as a negative control for RT-LAMP analysis (Ying and others 2011).
Bacterial strains Seven reference strains (see Table 1) including three Grampositive and four Gram-negative bacteria were utilized to develop cDNA synthesis and purification and evaluate the specificity and sensitivity of RT-LAMP assays. PolyA-B3 primer was introduced for bacterial cDNA synthesize to replace conventional primer in commercial cDNA synthesis kit Cloning and analysis intergenic spacer regions (TAKARA, Dalian, Liaoning province, China). The first strand A fragment of S. putrefaciens in internal transcribed spacer was was synthesis in a 20 μL synthesis reaction mixture containing amplified with bacterial gene specific primers BSF and BSR (Chen 1.5 μg total RNA, 2 μL of 10 pmol polyA-B3 primer, 200 units and others 2005), and was subjected to 1.5% agarose electrophore- of M-MLV reverse transcriptase, 4 μL of 5× first strand buffer, sis analysis. The smaller amplicons were excised from the gel and 1 μL of dNTPs (10 mM), and 1 μL of RNase inhibitor. The purified by the Gel DNA Purification Kit (Generay London, UK). reaction was incubated at 42 ◦ C for 1 h followed by 2 min of The purified PCR products were subcloned into the pMD18-T immediate incubation at –20 ◦ C. PolyA-ITS cDNA was isolated from genomic DNA using Oligotex mRNA Mini Kit (Qiagen, Hilden, Germany). Table 1. Reference strains used in this study Species
Strain GIM 1.225a GIM 1.283 GIM 1.27 GIM 1.232 GIM 1.305 GIM 1.209 ATCC 21763b
Bacillus pumilus Bacillus licheniformis Bacillus thuringiensis Listeria welshimeri Shewanella putrefaciens Pseudomonas fluorescens Aeromonas hydrophila a GIM: b
Guangdong Microbial Culture Collection Center, China. ATCC: American Type Culture Collection.
Optimize conditions for RT-LAMP assay Four microliters of the purified polyA-ITS cDNA was used for RT-LAMP amplification. The standard RT-LAMP assay was performed in a total volume of 12.5 μL reaction mix containing 4.0 μL of cDNA, 0.8 μL of each FIP and BIP (10 pmol) (Table 2), 0.2 μL (10 pmol) of F3 and B3 (Table 2), 5.25 μL of PCR grade water, 1.25 μL 10× ThermoPol Reaction Buffer, and 0.5 μL Enzyme Mix of Bst DNA polymerase (NEB). To optimize the reaction condition, the reaction temperature was carried
Table 2 Primers used in this study Primer F3 B3 LF BSR BSF PolyA-B3 FIP BIP
Sequence (5’–3’)
Length (nt)
CTTTTGAGTGTTCACACAGA GACCAAAGAAGTGGACGC ATGTTTCGCTCTACCCGT GGGTTYCCCCRTTCRGAAAT GTGAATACGTTCCCGGGCCT AAAAAAAAAAAAAAAAGACCAAAGAAGTGGACGC TCCAAATTGTTAAAGAACTACATCGACTTGCTTGTTCATCCTGTCT CGAAAGCATTGAACATTGAGTTCTGCCTTAGACTTGAATATTCAAGAC
20 18 18 20 20 34 46 48
Vol. 77, Nr. 4, 2012 r Journal of Food Science M227
M: Food Microbiology & Safety
amplification is performed under isothermal conditions (60– 65 ◦ C) without the thermal cycler. Furthermore, positive samples could exhibit increased turbidity of the reaction solution with the process of LAMP amplification. LAMP has been widely used for rapid detection of bacteria in environment and host (Savan and others 2004; Song and others 2005; Aoi and others 2006; Yeh and others 2006; Criado-Fornelio 2007; Plutzer and others 2010). The major obstacle for the conventional LAMP method was its poor ability to distinguish live cells from dead ones. Taking account into the fact that the most common approach for detecting live bacteria was to detect messenger RNA (mRNA) by RT-PCR (Myint 2002), therefore, reverse transcripted LAMP (RT-LAMP) technique, combination of RT-PCR and LAMP, might be the right answer to resolve the above disadvantage. Although RT-LAMP was used in virus detection to some extend (Christopher and others 2004; Tohru and others 2006; Yin and others 2010), rare study was conducted on its implication in bacteria detection to our knowledge. The main purposes of the present study were: (1) to develop a novel diagnostic method for the rapid detection of growing S. putrefaciens, (2) to establish bacteria cDNA purification strategy that could remove all traces of genomic DNA contamination, (3) to optimize reaction condition for RT-LAMP, (4) to put the technique into use in simulant or spoilaged fish sample detection.
RT-LAMP detecting live S. putrefaciens . . . out at 61.0, 61.7, 63.3, 64.1, and 64.9 ◦ C and reaction time was set up at 30, 45, 60, and 75 min, respectively. The reaction was terminated by heating at 80 ◦ C for 2 min in the end. After the reaction finished, RT-LAMP products were subjected to 2.0% agarose electrophoresis analysis.
Application of RT-LAMP in spoilaged or artificially contaminated fish samples In order to evaluate the feasibility of RT-LAMP assay in fish sample, cultured S. putrefaciens was homogenated with 1 g preserved large yellow croaker (Pseudosciaena crocea) (collected from Jinhong Food Co. Ltd) sample in 10 mL water, and the final concentrations of bacteria in the homogenation were kept at 5000, Determination of RT-LAMP sensitivity and specificity The sensitivity of the RT-LAMP assay was investigated by com- 500, and 50 cfu/μL, respectively. The spoilage fish sample was paring with conventional PCR using the same serially diluted served as positive control. cDNA template at the same concentrations. RT-LAMP was performed according to optimal condition in the above section. PCR Results was carried out in 25 μL reaction mixtures containing 4 μL Sequence analysis of the ITS cDNA, 2 μL dNTP (2.5 mM), 2 μL MgCl2 (25 mM), 0.2 μL A 676 bp fragment representing the complete ITS sequence Taq DNA polymerase (Takara), 2.5 μL 10×buffer, 1.0 μL each from S. putrefaciens GIM 1.305 was cloned with bacterial gene primer (F3 and B3), and 12.3 μL of PCR grade water. PCR conspecific primers BSF and BSR. Blastn analysis confirmed that the ditions were as follows: 35 cycles of denaturing at 94 ◦ C for 15 s, sequence had high similarity to ITS sequence from other bacteria. annealing at 55 ◦ C for 15 s and extension at 72 ◦ C for 15 s, then The sequence was deposited in the GenBank database under accesfollowed by a final extension at 72 ◦ C for 10 min. sion number HQ007351. tRNAscan-SE v.1.21 analysis indicates To assess the specificity of RT-LAMP, seven different bacterial no tRNA genes sequence was existed in the sequence. strains (see Table 1) including S. putrefaciens were selcted as reference. The autoclaved sample was used as the negative control. Optimization of RT-LAMP conditions for detecting
M: Food Microbiology & Safety
S. putrefaciens The reaction temperature and time for RT-LAMP assay were optimized and determined using polyA ITS cDNA of S. putrefaciens as a template (Fig. 1 and Fig. 2). 64.1 ◦ C was considered to be optimal reaction temperature and 60 min was as the most suitable reaction time. Sensitivity of RT-LAMP and PCR The sensitivity of the RT-LAMP assay was determined and shown in Fig. 3. RT-LAMP method was able to detect up to Figure 1–Effect of temperature on amount of RT-LAMP product. M: DL2000 5.4 copies per reaction, while PCR strategy could generate posi3 Marker, Lane 1: negative control, Lane 2: amplification at 61 ◦ C, Lane 3: am- tive signal when bacteria concentration reached up to 1.08 × 10 plification at 61.7 ◦ C, Lane 4: amplification at 63.3 ◦ C, Lane 5: amplification copies per reaction. In another words, the sensitivity of LAMP was at 64.1 ◦ C, Lane 6: amplification at 64.9 ◦ C. 200-fold greater compared to that of the standard PCR method. Specificity of RT-LAMP and PCR Assay for special detection of S. putrefaciens was investigated with six bacterial strains as control (Table 1) and the result was shown in Fig. 4a. RT-LAMP could specially detect S. putrefaciens, consistent with the result of PCR method (Fig. 4b). RT-LAMP in detecting live S. putrefaciens The result of RT-LAMP in detecting live S. putrefaciens was shown in Fig. 5. RT-LAMP products were only observed in the positive control group and group with live S. putrefaciens. No signal Figure 2–Effect of reaction time on RT-LAMP. M: DNA Marker, Lane 1: 75 was identified in the autoclaved bacterial sample and negative control group. mim, Lane 2: 60 min, Lane 3: 45 min, Lane 4: 30 min. Figure 3–Sensitivity of RT-LAMP (a) compared to PCR assay (b). M: DL2000 Marker, Lane 1: cDNA of 5.4 × 105 copies, Lane 2: cDNA of 5.4 × 104 copies, Lane 3: cDNA of 5.4 × 103 copies, Lane 4: cDNA of 5.4 × 102 copies, Lane 5: cDNA of 5.4 × 101 copies, Lane 6: cDNA of 5.4 copies.
M228 Journal of Food Science r Vol. 77, Nr. 4, 2012
RT-LAMP in detecting spoilaged fish sample The result of RT-LAMP in detecting S. putrefaciens in fish sample was shown in Fig. 6. RT-LAMP could identify S. putrefaciens not only from artificially contaminated fish samples with dosedependent manners, but from spoiaged sample. No bands were detected in the negative control groups.
Discussion In this study, we set up a set of highly specific LAMP primers targeting the ITS of S. putrefaciens and developed a RT-LAMP
Figure 4–Specificity of LAMP (a) and PCR assay (b). M: DL2000 Marker, C: negative control, Lane 1: cDNA from Shewanella putrefaciens GIM 1.305, Lane 2: cDNA from Bacillus pumilus GIM 1.225, Lane 3: cDNA from Bacillus licheniformis GIM 1.283, Lane 4: cDNA from Bacillus thuringiensis GIM 1.27, Lane 5: cDNA from Listeria welshimeri GIM 1.232, Lane 6: cDNA from Pseudomonas fluorescens GIM 1.209, Lane 7: cDNA from Aeromonas hydrophila ATCC 21763.
method to specially detect live bacteria. The conditions for RTLAMP were optimized to be incubated at 64.1 ◦ C for 60 min, which was consistent with the optimized condition for virus detection by Yin and others (2010). The sensitivity of RT-LAMP could be identified by the lower concentration of bacteria to 5.4 copies/reaction, whereas that of PCR method was 1.08 × 103 copies/reaction, indicating that LAMP method is 200-fold sensitive than the standard PCR. The sensitivity of LAMP system was about 100-fold higher than a conventional RT-PCR, as also reported by other researchers (Caipang and others 2010; Wang and others 2011). Aoi and others (2006) also indicated the sensitivity of LAMP could be down to 102 DNA copies of target DNA in monitoring ammonia-oxidizing bacteria. Concerning the specificity of the method, RT-LAMP allowed the detection of both fish sample artificially contaminated by S. putrefaciens strains and spoilage fish samples. Shao and others (2011) developed a higher specificity LAMP method named mLAMP-RFLP for simultaneous detection of Salmonella strains and Shigella strains in milk with 5 CFU/10 mL. From the above analysis, RT-LAMP was preferable to other molecular methods in detecting the existence of spoilage S. putrefaciens with rapidity (≤ 60 min), sensitivity and simplicity advantages. RT-LAMP had been reported to be widely used in the detection of RNA-viruses in many references (Christopher and others 2004; Tohru and others 2006; Masahiro and others 2006). The quality of RNA extraction was considered to be a key factor for the success of the method. In order to apply the method for detecting live bacteria, RNA quality was the most important compared to RNA-virus for traces of DNA contamination would also significantly affect the results. Therefore, establishing a high efficiency RNA isolation strategy was very important to improve its specificity. Nowadays, many commercial kits are available for mRNA purification from the eukaryotic cells based on the polyadenylated nature of eukaryotic mRNA. However, it was unfeasible to purify prokaryotes mRNA for its absence of polyadenylated tail. To overcome its disadvantage and collect RNA without DNA contamination, poly A was added to the tails of ITS mRNA. Consistent with our hypothesis, the method could be clearly able to differentiate live bacteria from the dead ones (Fig. 5).
Conclusion The developed-RT-LAMP assay is an extremely sensitive, specific, and rapid diagnostic method for live S. putrefaciens detection. The method requires only simple conditions and less time to obFigure 5–Detection of live S. putrefaciens by RT-LAMP. M: DL2000 Marker, tain a result compared with traditional gel electrophoresis. To our Lane 1: cDNA from autoclaved S. putrefaciens, Lane 2: cDNA from active knowledge, this is the first report to use the RT-LAMP technique S. putrefaciens, Lane 3: negative control, Lane 4: positive control. for the detection of live bacteria. We recommend that this technique be applied routinely in farm cultures and food processing factories to eliminate early-stage contamination.
Acknowledgments This work was financially supported by State Oceanic Administration of the People Republic of China (Nr 2011418007), Ningbo Science Bureau of China (Grant Nr 2008C50027) and K. C. Wong Magna Fund at Ningbo Univ. Figure 6–RT-LAMP detection S. putrefaciens in fish sample. M: DL2000 References Marker, Lane 1: Distrilled water, Lane 2: supertanant from fish homogena- Aoi Y, Hosogai M, Tsuneda S. 2006. Real-time quantitative LAMP (loop-mediated isothermal amplification of DNA) as a simple method for monitoring ammonia- oxidizing bacteria. tion without S. putrefaciens, Lane 3: 5000 copies S. putrefaciens in fish J Biotechnol 125: 484–91. homogenation, Lane 4: 500 copies S. putrefaciens in fish homogenation, Brian SB, Michael JM, Thomas JD. 1998. Design and application of two rapid screening techLane 5: 50 copies S. putrefaciens in fish homogenation, Lane 6: positive niques for isolation of Mn(IV) reduction-deficient mutants of Shewanella putrefaciens. Appl Environ Microbiol 2716–20. control.
Vol. 77, Nr. 4, 2012 r Journal of Food Science M229
M: Food Microbiology & Safety
RT-LAMP detecting live S. putrefaciens . . .
RT-LAMP detecting live S. putrefaciens . . .
M: Food Microbiology & Safety
Caipang CM, Kulkarni A, Brinchmann MF, Korsnes K, Kiron V. 2010. Detection of Francisella piscicida in Atlantic cod (Gadus morhua L) by the loop-mediated isothermal amplification (LAMP) reaction. Vet J 184:357–61. Cangelosi GA, Brabant WH, Britschgi TB, Wallis CK. 1996. Detection of rifampin- and ciprofloxacin-resistant Mycobacterium tuberculosis by using species-specific assays for precursor rRNA. Antimicrob Agents Chemother 40:1790–5. Chaiyanan S, Huq A, Maugel T, Colwell RR. 2001. Viability of the nonculturable Vibrio cholerae O1 and O139. Syst Appl Microbiol 24:331–41. Chen CC, Teng LJ, Kaiung S, Chang TC. 2005. Identification of clinically relevant viridans streptococci by an oligonucleotide array. J Clin Microbiol 43:1515–21. Christopher A, Caipang M, Ikumi H, Tsuyoshi O, Ikuo H, Takashi A. 2004. Rapid detection of a fish iridovirus using loop-mediated isothermal amplication (LAMP). J Virol Methods 121:155–61. Criado-Fornelio A. 2007. A review of nucleic-acid-based diagnostic tests for Babesia and Theileria, with emphasis on bovine piroplasms. Parassitologia 1:39–44. Dichristina TJ, DeLong EF. 1993. Design and application of rRNA-targeted oligonucleotide probes for the dissimilatory iron- and manganese-reducing bacterium Shewanella putrefaciens. Appl Environ Microbiol 12:4152–60. Gram L, Dalgaard P. 2002. Fish spoilage bacteria—problems and solutions. Curr Opin Biotechnol 13:262–6. Hirawati KK, Chauhan DS, Singh HB, Sharma VD, Singh M, Kashyap M, Katoch VM. 2006. Detection of M. leprae by reverse transcription-PCR in biopsy specimens from leprosy cases: a preliminary study. J Comm Dis 38:280–7. Kurabachew M, Wondimu A, Ryon JJ. 1998. Reverse transcription-PCR detection of Mycobacterium leprae in clinical specimens. J Clin Microbiol 36:1352–6. Masahiro I, Masahiro W, Naoko N, Toshiaki I, Yoshinobu O, Notomi T. 2006. Rapid detection and typing of influenza A and B by loop-mediated isothermal amplification: comparison with immunochromatography and virus isolation. J Virological Methods 135:272–27. Miller ND, Davidson PM, D’Souza DH. 2011. Real-time reverse-transcriptase PCR for Salmonella Typhimurium detection from lettuce and tomatoes. LWT – Food Sci Technol 44:1088–97. Miller ND, Draughon FA, D’Souza DH. 2010. Real-time reverse-transcriptase- polymerase chain reaction for Salmonella enterica detection from jalapeno and serrano peppers. Foodborne Pathog Dis 7:367–73. Myint S. 2002. Recent advances in the rapid diagnosis of respiratory tract infection. Br Med Bull 61:97–114. Plutzer J, Torokne A, Karanis P. 2010. Combination of ARAD microfibre filtration and LAMP methodology for simple, rapid and cost-effective detection of human pathogenic Giardia duodenalis and Cryptosporidium spp. in drinking water. Lett Appl Microbiol 50:82–8.
M230 Journal of Food Science r Vol. 77, Nr. 4, 2012
Reimann S, Grattepanche F, Rezzonico E, Lacroix C. 2010. Development of a real-time RTPCR method for enumeration of viable Bifidobacterium longum cells in different morphologies. Food Microbiol 27:236–42. Savan R, Igarashi A, Matsuoka S, Sakai M. 2004. Sensitive and rapid detection of edwardsiellosis in fish by a loop-mediated isothermal amplification method. Appl Environ Microbiol 70:621–4. Shao Y, Zhu S, Jin C, Chen F. 2011. Development of multiplex loop-mediated isothermal amplification-RFLP (mLAMP-RFLP) to detect Salmonella spp. and Shigella spp. in milk. Int J Food Microbiol 148(2):75–9. Skjerdal OT, Lorentzen G, Tryland I, Berg JD. 2004. New method for rapid and sensitive quantification of sulphide-producing bacteria in fish from arctic and temperate waters. Intl J Food Microbiol 93:325–33. Song T, Toma C, Nakasone N, Iwanaga M. 2005. Sensitive and rapid detection of Shigella and enteroinvasive Escherichia coli by a loop-mediated isothermal amplification method. FEMS Microbiol Lett 243:259–63. Techathuvanan C, Draughon FA, D’Souza DH. 2010. Real-time reverse transcriptase PCR for the rapid and sensitive detection of Salmonella typhimurium from pork. J Food Protect 73:507–14. Tohru M, Tomoya K, Ram S, Masahiro S, Jiraporn K, Terutoyo Y, Toshiaki I, 2006. Detection of yellow head virus in shrimp by loop-mediated isothermal amplication (LAMP). J Virological Methods 135:151–6. Wang C, Lien K, Wang T, Chen TY, Lee GB. 2011. An integrated microfluidic loop-mediatedisothermal-amplification system for rapid sample pre-treatment and detection of viruses. Biosen Bioelectron 26:2045–52. Yeh HY, Shoemaker CA, Klesius PH. 2006. Sensitive and rapid detection of Flavobacterium columnare in channel catfish Ictalurus punctatus by a loop-mediated isothermal amplification method. J Appl Microbiol 100:919–25. Ying Q, Li T, Su X, Li Y, Zhou J, Cui J, Wang Z, Li S. 2011. Establishment of loopmediated isothermal amplification method for detection of Bacillus pumilus. Biotechnol Bulletin 2:179–83. Yin S, Shang Y, Zhou G, Tian H, Liu Y, Cai X, Liu X. 2010. Development and evaluation of rapid detection of classical swine fever virus by reverse transcription loop-mediated isothermal amplication (RT-LAMP). J Biotechnol 146:147–50 Zhao X., Li Y, Wang L, You L, Xu Z, Li L, He X, Liu Y, Wang J, Yang L, 2009. Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol Biol Reports 37: 2183–8.
