Rapid Detection of Rabies Virus by Reverse Transcription Loop ...

5 downloads 142 Views 144KB Size Report
(San Meteo, Isabela). 111 brain dog. Philippines. 2006. (Gattaran, Cagayan). 106 ... (San Antonio, Quezon). Z-05-002 brain dog. Philippines. 2005. (San Antonio ...
Jpn. J. Infect. Dis., 62, 187-191, 2009

Original Article

Rapid Detection of Rabies Virus by Reverse Transcription Loop-Mediated Isothermal Amplification Bazartseren Boldbaatar1,2, Satoshi Inoue1,2*, Naoko Sugiura1,2, Akira Noguchi2, Jun Ryan C. Orbina3, Catalino Demetria3, Mary Elizabeth Miranda3, and Akio Yamada1,2 1

Department of Veterinary Science, National Institute of Infectious Diseases, Tokyo 162-8640; The United Graduate School of Veterinary Science, Gifu University, Gifu 501-1193, Japan; and 3 Department of Health, Research Institute for Tropical Medicine, Muntinlupa City, the Philippines 2

(Received February 12, 2009. Accepted March 30, 2009) SUMMARY: In this study, reverse transcription loop-mediated isothermal amplification (RT-LAMP) was established which can detect 103 copies of viral RNA corresponding to approximately 5 fg of RNA. RT-LAMP with the Phil primer set designed according to the nucleotide sequences obtained from a Kyoto patient who contracted rabies in the Philippines was able to amplify all 16 street viral sequences derived from the Philippines. The specificity of RT-LAMP products was easily confirmed by digestion with RsaI restriction enzyme. The reaction of RT-LAMP could be completed within 1 h and could be conducted under isothermal conditions using a conventional water bath or heat blocks, indicating that RT-LAMP is ideal for the diagnosis of rabies in developing countries. Although further study is required to establish more universal RT-LAMP primers applicable to viruses from other regions or countries, the fast, easy, simple, sensitive and specific RT-LAMP method established here might be useful for rabies diagnosis and can facilitate studies of rabies epidemiology where rabies is enzootic, particularly in developing countries. countries. The loop-mediated isothermal amplification (LAMP) assay was first described by Notomi et al. (2). The principle is based on strand displacement by Bst polymerase and formation of the stem-loop structure by four specifically designed primers that can recognize six distinct regions on the target DNA. A revised method which accelerated the reaction through the inclusion of additional loop primers was later reported by Nagamine et al. (3). This reaction is conducted under isothermal conditions using a conventional water bath or heat blocks. Thus, this method is ideal for diagnosing rabies in both humans and animals in developing and underdeveloped countries in which it is difficult to conduct a DFA test or RTPCR. We, therefore, attempted to develop a rapid and reliable test for the diagnosis of rabies by applying a one-step RTLAMP method.

INTRODUCTION Rabies is a viral disease that is characterized by fatal encephalitis in all mammals including humans, and the virus belongs to the Lyssavirus genus of the Rhabdoviridae family. Rabies is endemic in almost all parts of the world, with the exception of a few countries including New Zealand, Australia, Hawaii, the United Kingdom and Japan (1). At least 50,000 human deaths are estimated to occur and 10 million post-exposure treatments are estimated to be carried out throughout the globe. Rabies is preventable by proper vaccination even after exposure, particularly when the vaccination is administered with anti-rabies immunoglobulin (1). A sensitive, specific and reliable rabies diagnosis is required to avoid unnecessary postexposure treatment, which might pose a financial burden as well as psychological stress on patients because of the extremely high fatality rate and incurability of the disease. A direct fluorescent antibody (DFA) test is the most frequently used test to diagnose rabies in animals, while reversetranscription polymerase chain reaction (RT-PCR) is conducted for the antemortem diagnosis of human rabies. RTPCR can also be applied for the diagnosis of rabid animals. These methods, however, seem to be difficult to adopt in developing countries, in particular, those with lesser gross domestic products. Since neither the DFA test nor RT-PCR can be done without expensive equipment such as fluorescence microscopes or sophisticated PCR machines, the development of a cheap and effective method for rabies diagnosis is a prerequisite to fighting rabies in developing

MATERIALS AND METHODS Cell and virus: The CVS-11 strain of rabies virus (RABV) (kindly provided by Dr. C. E. Rupprecht, CDC, USA) was propagated on mouse neuroblastoma (MNA) cells as described before (4). Clinical specimens and preparation of template RNA: Twelve dogs and two cats were captured in the Philippines because they showed typical signs of rabies (Table 1). These animals were humanely euthanized, and the brain specimens were stored at –80°C until use. All the animals tested positive when their brains were examined by DFA test for the presence of RABV-specific antigens (5). The brain tissues and salivary glands obtained from two Japanese (Kyoto and Yokohama) patients who died of rabies contracted in the Philippines (6,7) were also included in this study (Table 1). Total RNA was extracted from either 9 × 104 MNA cells infected with the CVS-11 strain or from brain tissues ob-

*Corresponding author: Mailing address: Department of Veterinary Science, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan. Tel: +81-3-52851111 ext. 2620, Fax: +81-3-5285-1179, E-mail: sinoue@nih. go.jp 187

tained from clinical specimens of rabid animals using the RNEasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and the eluted RNA was stored at –80°C until use. For the preparation of RNA from the tissues of two patients, TRIzol reagent (Invitrogen, Carlsbad, Calif., USA) was employed. All infectious materials were handled in BSL2 and BSL3

laboratories according to the regulations instituted by the National Institute of Infectious Diseases and the Research Institute for Tropical Medicine. In vitro synthesis of template RNA for determination of RT-LAMP sensitivity: The quantitative analysis of RTLAMP sensitivity was conducted using viral RNA transcribed in vitro. In brief, RNA was transcribed from the N-gene of the CVS-11 strain inserted into the pGEM-T-Easy (Promega, Madison, Wis., USA) under control of the SP6 promoter. The copy number of the transcripts was deduced from the amount of RNA determined based on the optical density (OD) obtained using a spectrophotometer (NanoDrop 1000; Thermo Scientific, Wilmington, Del., USA). The RNA concentration was then adjusted to 1 ng of N-gene transcript per 1 μl corresponding to 1×109 copies (http://www.jbios.co.jp/calc.html). Primer design: A total of 10 primers including 4 outer primers, 2 loop primers, and 4 inner primers (Table 2) were designed using the LAMP primer designing software Primer Explorer V3 (Eiken, Tokyo Japan; http://primerexplorer.jp) based on the nucleotide sequence of the CVS-11 strain (GenBank accession no. AB069973) or that determined for the DNA fragment amplified from the Kyoto patient. The FIP primers consisted of sequences corresponding to the F1c and F2 regions, while BIP primers consisted of those corresponding to the B1c and B2 regions (Fig. 1). The BLP primers were designed so that the BLP primers could hybridize to the loop formed between the B2 and B1 regions. The outer primers, the F3 and the B3, were located outside of the F2 and B2 regions (Fig. 1). The outer primers were also used for RT-PCR. RT-LAMP: The RT-LAMP was carried out in a 25-μl reaction volume using the Loopamp RNA amplification kit protocol (Eiken). The reaction mixture consisted of 40 pmol each of the FIP and BIP primers, 5 pmol each of the F3 and B3 primers, 20 pmol of the BLP primers, 1.0 μl of enzyme mixture containing avian myeloblastosis virus (AMV) reverse transcriptase and Bst DNA polymerase, 12.5 μl of 2× reaction mixture (40 mM Tris-HCI, 20 mM KCI, 16 mM MgSO4, 20 mM (NH4)2SO4, 0.2% Tween20, 1.6 M Betaine, and 2.8 mM of each dNTPs) and 5 μl of RNA sample. The

Table 1. Clinical specimens used in this study Name

Tissue

Host human

Japan (Kyoto)

2006

human

Japan (Yokohama)

2006

122

Brain, salivary gland Brain, salivary gland brain

dog

2006

111

brain

dog

106

brain

dog

Z-05-374

brain

dog

Z-05-085

brain

dog

Z-05-002

brain

dog

Z-05-001

brain

dog

Z-04-667

brain

dog

Z-04-398

brain

dog

Z-04-410

brain

dog

Z-03-758

brain

dog

Z-03-194

brain

dog

Z-03-882

brain

cat

Z-03-249

brain

cat

Philippines (San Meteo, Isabela) Philippines (Gattaran, Cagayan) Philippines (San Meteo, Isabela) Philippines (Socorro, Oriental Mindoro) Philippines (San Antonio, Quezon) Philippines (San Antonio, Nueva Ecija) Philippines (San Luis, Aurora) Philippines (Imus, Cavite) Philippines (Bacoor, Cavite) Philippines (Paranaque, Metro Manila) Philippines (Santa Rosa, Laguna) Philippines (Boaue, Bulacan) Philippines (Muntinlupa, Metro Manila) Philippines (Dasmarinas, Cavite)

Kyoto Yokohama

Isolated country (place)

Year

2006 2006 2005 2005 2005 2004 2004 2004 2004 2003 2003 2003 2003

Table 2. Primers used in this study Primer name

Sequence 5´ - 3´

CVS1) C-F3 C-B3 C-BLP C-FIP2) C-BIP3)

Sense

ACATGTCCGGAAGACT CAGACTCAGGAGAAGACC GGCATGGAATTGACAAGGGACC ACTAGAGAGTTTGGGGTGA-GGACCAGCTATGGAATCC ACGGGAATTGGGCTCTGAC-CTAAAGATGCATGTTCAG

M6) G7) M G-M (F1c + F2) M-G (B1c + B2)

250 - 265 424 - 441 373 - 394 308 - 326 + 266-283 350 - 368 + 403-421

Phil4) P-F3 P-B3 P-BLP P-FIP P-BIP

ACATGCCCTGAAGATT AAGACTCAGGAGAAGACC GGTATGGAGCTGACAAGGGACC ACAAGGGAATCAGGGGTGA-GGACTAGCTATGGGATCT AAGGAAATTGGGCTCTGAC-CTAAAGACGCATGTTCTG

M G M G-M (F1c + F2) M-G (B1c + B2)

250 - 265 424 - 441 373 - 394 308 - 326 + 266 - 283 350 - 368 + 403 - 421

RT5) JW12

ATGTAACACCYCTACAATG

M

55 - 73

1)

Position

: The CVS primers were designed based on the N-gene sequence of the CVS-11 strain of rabies virus. 2) : The FIP primer consisted of F1c and F2 sequences (see Fig. 2). 3) : The BIP primer consisted of B1c and B2 sequences (see Fig. 2). 4) : The Phil primers were designed based on the N-gene sequence obtained from the specimen of the Kyoto patient. 5) : JW12 was a primer reported by Heaton et al. (8). 6) : Messenger sense. 7) : Genome sense.

188

after ethidium bromide staining. Restriction enzyme digestion of the RT-LAMP product: The restriction enzyme digestion was carried out with 2 μl of the RT-LAMP product and 0.5 μl of RsaI enzyme (Toyobo, Tokyo, Japan) at 37°C for 1 h. Nucleotide sequence analysis of the RT-LAMP product: The fastest migrating band of the RT-LAMP product was cut out from the gel and purified by Qiaquick column (Qiagen). Sequencing was performed using the Genetic Analyzer 3130 (Applied Biosystems, Foster City, Calif., USA) with the FIP or BIP primers (Table 2). Fig. 1. The primer locations on the target gene.

RESULTS

mixture was incubated at 63°C for 1 h, and the reaction was stopped by heating at 80°C for 5 min. The RT-LAMP product was visualized under a UV transilluminator after 1.5% agarose gel electrophoresis with TAE buffer followed by ethidium bromide staining. RT-PCR: The template RNAs were converted into cDNA using AMV reverse transcriptase (Promega) in the presence of JW12 primer (8). The resultant cDNA was amplified by conventional PCR using the TaKaRa ExTaq PCR kit (TaKaRa, Otsu, Japan) in the presence of the respective F3 and B3 LAMP outer primers under the following conditions: 95°C for 5 min; then 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 30 s; and 1 cycle of 95°C for 30 s, 50°C for 30 s, and 72°C for 10 min. The PCR product was separated by agarose gel electrophoresis and detected under a UV transilluminator

Establishment of RT-LAMP for RABV: At first we attempted to establish RT-LAMP for the detection of RABV using the fixed virus strain, CVS-11. When RNA isolated from CVS-11-infected MNA cells was subjected to RT-LAMP using the CVS primer set, successful amplification was achieved (Fig. 2A). Digestion of amplified products with RsaI yielded a single band of approximately 100 bp (Fig. 2A, lane 2). Although the presence of RsaI restriction sites strongly suggested that the amplified products were derived from the N-gene of RABV, we sequenced the fastest migrating fragments after excision from the agarose gel. The results indicated that the fragments were indeed amplified from the RABV N-gene (Fig. 2B). Sensitivity of RT-LAMP: To determine the sensitivity of the newly established method, we used synthetic viral RNA transcribed from the cloned N-gene. Ten-fold serially diluted synthetic viral RNA was subjected to RT-LAMP in the presence of the CVS primer set. As shown in Table 3, unequivocal amplification was observed when more than 1,000 copies of RNA were in the reaction. When compared with the conventional RT-PCR, RT-LAMP showed approximately 10-fold higher sensitivity. Similarly varying amounts of viral RNA purified from the CVS-11 strain of RABV were also tested, and the results showed that RT-LAMP was able to detect the virus if the virus titer was greater than 10–1 FFU (data not shown). RT-LAMP for clinical samples: Next we attempted to use the CVS primer set for the detection of viral RNA extracted from clinical samples. Total RNA obtained from the brain tissue of the Kyoto patient was subjected to RT-LAMP using the CVS primer set. The CVS primer set, however, did not work for the street virus that caused rabies in the Kyoto patient (Table 4). Since the N-gene fragment was amplified from this RNA by conventional PCR with the F3 and B3 primers,

Fig. 2A. Specificity of RT-LAMP products. RT-LAMP products amplified from RNA extracted from CVS-11 infected cells (lane 1) and the brain sample from the Kyoto patient (lane 3) were digested with RsaI (lanes 2 and 4). DNA size marker (lane M) were run simultaneously. White asterisk shows target product for sequencing.

Fig. 2B. Comparison of the nucleotide sequences (mRNA sense) of the fastest migrating bands (white asterisk) of the RT-LAMP products. RsaI restriction enzyme sites are boxed. Black bold letters with arrow show primer location.

189

the failure of the amplification by RT-LAMP seemed attributable to the design of the primers other than these two. Since the nucleotide sequence of this position of the virus that caused rabies in the Kyoto patient was available (Noguchi et al., unpublished), we designed a new primer set (Phil primer set) to determine whether RT-LAMP with the Phil primer set could detect viral sequences in the Kyoto patient. This new Phil primer set successfully amplified the RABV gene fragment from RNA extracted from the brain specimen of the Kyoto patient. However, there was no amplification of CVSspecific sequences when RT-LAMP was performed using in vitro transcribed RNA as the template together with the Phil primer set (Table 4). As shown in Table 5, RT-LAMP with

the Phil primer set could detect viral genome not only in the brain of the Kyoto patient but also in the brain of the Yokohama patient. Similarly the extracted RNAs from the salivary glands of the Kyoto and Yokohama patients gave rise to positive amplification when they were examined by RT-LAMP using the Phil primer set. It was also shown that RT-LAMP was 100 times as sensitive as RT-PCR when applied to the RNA obtained from clinical specimens. Furthermore, RT-LAMP products converged in a single band of approximately 100 bp after digestion with RsaI (Fig. 2A, lane 4). Nucleotide sequence analysis of the fastest migrating amplicon revealed that there were 24 nucleotide differences between CVS-11 and the gene fragment amplified from the Kyoto patient (Fig. 2B). The Phil primer set was then tested to determine whether the primers can detect street RABV present in the organs of rabid animals captured in the Philippines (Table 1). Fourteen samples from 10 different regions of the Philippines were examined by RT-LAMP with the Phil primer set. Conventional PCR using P-F3 and P-B3 primers was carried out simultaneously. All the street viruses tested positive when they were subjected to RT-LAMP with the Phil primer set, whereas three of them were found to be negative by the conventional PCR conducted at the same time (data not shown).

Table 3. Sensitivity of RT-LAMP and RT-PCR using of CVS primers RT-LAMP2) Exp 1 Exp 2 Exp 3

Copy no.1) 108 107 106 105 104 103 102

+ + + + + + –

+ + + + + + –

RT-PCR3) Exp 1 Exp 2 Exp 3

+ + + + + + –

+ + + + + – –

+ + + + + – –

+ + + + + – –

: Copy number of synthetic viral RNA (1×109 copy/μl) transcribed from the N-gene of CVS-11 strain inserted into the pGEM-T-Easy. 2) : CVS primer sets designed based on the N-gene sequence of CVS11 strain was used. 3) : C-F3 and C-B3 primers of the CVS primer set were used for the RT-PCR reaction (Table 2). 1)

DISCUSSION Since the 1990s, nucleic acid-based amplification methods such as nucleic acid sequence-based amplification (NASBA) (9,10), RT-PCR (8,11-18) and real-time TaqMan PCR (19,20) have been established as more sensitive for rabies diagnosis compared to the DFA test. However, these methods not only take a long time (3 - 4 h) but also require sophisticated, expensive equipment as well as expertise. In contrast, the one-step RT-LAMP established in this study is rapid, easy and simple compared to those molecular diagnostic methods. RT-LAMP can be conducted in 1 h or less and only requires a conventional water bath or heat block. RT-LAMP is useful for laboratories not only in developing countries but also in developed countries. The RT-LAMP established here detected 103 copies of viral RNA, which corresponded to approximately 5 fg of RNA. The lowest amount of RNA detectable by the other molecular methods so far reported varied from 4 fg for NASBA (9) to 100 pg for heminested PCR (20). It is thus evident that the RT-LAMP reported in this study is one of the most sensitive

Table 4. Sensitivity of RT-LAMP conducted with CVS and Phil primer sets Primer CVS Phil

Copy no. of RNA1) 108 107 106 105 104 103 102

10–1 10–2 10–3 10–4 10–5 10–6 10–7

– – – – – – –

+ + + + + + –

Primer CVS Phil

Dilution of viral RNA2)

– – – – – – –

+ + + + + + –

: Synthetic viral RNA (1 × 109 copy/μl) transcribed from the N-gene of CVS-11 strain inserted into the pGEM-TEasy was diluted 10-fold in distilled water (DW). 2) : Viral RNA extracted from brain specimen of Kyoto patient (102.7 TCID50/0.1 ml) was diluted 10-fold in DW. 1)

Table 5. Comparison of sensitivity between RT-LAMP and RT-PCR for detection of street rabies virus sequences in specimens obtained from humans Dilution of RNA 10–1 10–2 10–3 10–4 10–5 10–6 10–7

Brain (Kyoto)1) RT-LAMP3) RT-PCR4) Exp Exp Exp 1 2 3 + + + + + + –

+ + + + + + –

+ + + + + + –

Brain (Yokohama)1) RT-LAMP RT-PCR

Exp Exp Exp 1 2 3 + + + + – – –

+ + + + – – –

+ + + + – – –

Exp Exp Exp 1 2 3 + + + + + + –

+ + + + + – –

+ + + + + – –

Salivary gland (Kyoto)2) RT-LAMP RT-PCR

Exp Exp Exp 1 2 3 + + + – – – –

+ + + – – – –

+ + + – – – –

1)

Exp Exp Exp 1 2 3 + + + – – – –

+ + + – – – –

+ + + – – – –

Salivary gland (Yokohama)2) RT-LAMP RT-PCR

Exp Exp Exp 1 2 3 + – – – – – –

+ – – – – – –

+ – – – – – –

Exp Exp Exp 1 2 3 + + + – – – –

+ + – – – – –

+ + – – – – –

Exp Exp Exp 1 2 3 + – – – – – –

+ – – – – – –

+ – – – – – –

: Total RNA were extracted from the brain specimens of Kyoto and Yokohama patients containing 102.7 and 102.3 TCID50/0.1 ml of infectious virus, respectively. : Total RNA extracted from the salivary glands were also used. Virus infectivities were not available; however, it should be less than 100 TCID50/0.1 ml. 3) : Phil primer sets was used for RT-LAMP. 4) : P-F3 and P-B3 primers of the Phil primer set were used for RT-PCR primer pairs. 2)

190

This study was supported by the grant from the Ministry of Health, Labour and Welfare of Japan (H20-Shinko-Ippan-013).

methods for the detection of RABV. The specificity of RTLAMP products was confirmed by the RsaI restriction enzyme (Fig. 2). Since the restriction enzyme site is located near the center of the strands flanked by F1c and B1c primers on the target sequence (Fig. 1), RsaI digestion yielded two independent bands of very similar size which appeared as a single band on the gel (Fig. 2A). One limitation of this method was that designing a primer set which can be used for the amplification of many RABV strains originating in different regions was challenging. The primer set designed for the detection of the fixed CVS-11 strain worked for viral sequences derived neither from the patients nor animals infected with RABV in the Philippines. We, therefore, designed a new primer set based on the nucleotide sequence obtained from the Kyoto patient’s sample. This primer set, the Phil primer set, was shown to successfully amplify viral sequences from all samples taken not only from humans who had contracted rabies in the Philippines but also from rabid dogs and cats captured in the Philippines. As those samples were collected in 10 different parts of the northern Philippines, it is clear that the Phil primer set could successfully amplify variants in the Philippines. Comparison of the nucleotide sequences of the target regions between the CVS-11 and Kyoto strains (Fig. 2B) revealed that there was a nucleotide difference at the exact 3´ end of the FIP primer. Since the presence of the mismatched nucleotide at this position was known to inhibit strand elongation, it seemed likely that the nucleotide difference found at the 3´ end of the FIP primer was responsible for the lack of amplification of strains from the Philippines by the CVS primer set and vice versa. We, therefore, replaced the C-FIP primer of the CVS primer set with P-FIP, and they were examined for their abilities to amplify strain-specific sequences of the CVS and Kyoto strains by RT-LAMP. The Phil primer set with the C-FIP was similarly tested. The results clearly indicated that the nucleotide difference found in the FIP primer was critical for successful amplification in our system (data not shown). A close look at the nucleotide sequences of LAMP primers in 20 Asian strains from 6 countries (India, Iran, Kazakhstan, South Korea, Sri-Lanka and Thailand) deposited in the Genbank database revealed that several strains had nucleotide substitutions at the 3´ end of the sequences corresponding to the FIP primer. It was, however, noticed that the nucleotide corresponding to the 3´ end of the FIP primer was shared by either one of the two (data not shown). This suggests that these Asian RABV strains could be identified by RT-LAMP using either the CVS or Phil primer set, although the possible presence of RABV strains which could not be identified by either primer set could not be ruled out. In summary, we have established fast, easy, simple and sensitive RT-LAMP method which might be useful for rabies diagnosis. The method might facilitate studies of rabies epidemiology where rabies is enzootic, particularly in developing countries.

REFERENCES 1. World Health Organization (2005): WHO Expert Consultation on Rabies. WHO Tech. Rep. Ser., no. 931. First report. World Health Organization, Geneva. 2. Notomi, T., Okayama, H., Masubuchi, H., et al. (2000): Loop-mediated isothermal amplification of DNA. Nucleic Acids Res., 28, e63. 3. Nagamine, K., Hase, T. and Notomi, T. (2002): Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol. Cell. Probes, 16, 223-229. 4. Inoue, S., Sato, Y., Hasegawa, H., et al. (2003): Cross-reactive antigenicity of nucleoproteins of lyssaviruses recognized by a monospecific antirabies virus nucleoprotein antiserum on paraffin sections of formalin-fixed tissues. Pathol. Intl., 53, 525-533. 5. Dean, D.J., Abelseth, M.K. and Atanasiu, P. (1996): The fluorescent antibody test. p. 88-95. In F.X. Meslin., M.M. Kaplan and H. Koprowski, Laboratory Techniques in Rabies. 4th ed. World Health Organization, Geneva. 6. Yamamoto, S., Iwasaki, C., Oono, H., et al. (2008): The first imported case of rabies into Japan in 36 years: a forgotten life-threatening disease. J. Travel Med., 15, 372-374. 7. Takahashi, H., Sagara, H., Fujita, S., et al. (2007): Clinical course of the imported rabies case occurred after an interval of 36 years-Yokohama. Infect. Agents Surveillance Rep., 28, 64-65 (in Japanese). 8. Heaton, P.R., Johnston, P., McElhinney, L.M., et al. (1997): Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses. J. Clin. Microbiol., 35, 2762-2766. 9. Wacharapluesadee, S. and Hemachudha, T. (2001): Nucleic-acid sequence based amplification in the rapid diagnosis of rabies. Lancet, 358, 892893. 10. Sugiyama, M., Ito, N. and Minamoto, N. (2003): Isothermal amplification of rabies virus gene. J. Vet. Med. Sci., 65, 1063-1068. 11. Ermine, A., Larzul, D., Ceccaldi, P.E., et al. (1990): Polymerase chain reaction amplification of rabies virus nucleic acids from total mouse brain RNA. Mol. Cell. Probes, 4, 189-191. 12. Nagaraj, T., Vasanth, J.P., Desai, A., et al. (2006): Ante mortem diagnosis of human rabies using saliva samples: comparison of real time and conventional RT-PCR techniques. J. Clin. Virol., 36, 17-23. 13. Sacramento, D., Bourhy, H. and Tordo, N. (1991): PCR technique as an alternative method for diagnosis and molecular epidemiology of rabies virus. Mol. Cell. Probes, 5, 229-240. 14. Whitby, J.E., Johnstone, P. and Sillero-Zubiri, C. (1997): Rabies virus in the decomposed brain of Ethiopian wolf detected by nested reverse transcription-polymerase chain reaction. J. Wildl. Dis., 33, 912-915. 15. Nadin-Davis, S.A. (1998): Polymerase chain reaction protocols for rabies virus discrimination. J. Virol. Methods, 75, 1-8. 16. Crepin, P., Audrey, L., Rotivel, Y., et al. (1998): Intravital diagnosis of human rabies by PCR using saliva and cerebrospinal fluid. J. Clin. Microbiol., 36, 1117-1121. 17. Smith, J., McElhinney, L.M., Heaton, P.R., et al. (2000): Assessment of template quality by the incorporation of an internal control into a RTPCR for the detection of rabies and rabies-related viruses. J. Virol. Methods, 84, 107-115. 18. Ito, M., Itou, T., Sakai, T., et al. (2001): Detection of rabies virus RNA isolated from several species of animals in Brazil by RT-PCR. J. Vet. Med. Sci., 63, 1309-1313. 19. Hughes, G.J., Smith, J.S., Hanlon, C.A., et al. (2004): Evaluation of a Taq-Man PCR assay to detect rabies virus RNA: influence of sequence variation and application to quantification of viral loads. J. Clin. Microbiol., 42, 299-306. 20. Wakeley, P.R., Johnson, N., McElhinney, L.M., et al. (2005): Development of a real-time, TaqMan reverse transcription-PCR assay for detection and differentiation of lyssavirus genotypes 1, 5, and 6. J. Clin. Microbiol., 43, 2786-2792. 21. Imai, M., Ninomiya, A., Minekawa, H., et al. (2007): Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop-mediated isothermal amplification method. J. Virol. Methods, 141, 173-180.

ACKNOWLEDGMENTS The authors would like to thank Drs. Yoshihiro Kaku, Kozue Hotta, Akiko Okutani, and Osamu Fujita, Department of Veterinary Science, National Institute of Infectious Diseases, Tokyo, Japan, for their helpful discussion.

191

Suggest Documents